YAP1 spermaceti mutant protein as well as coding gene, recombinant vector and application of YAP1 spermaceti mutant protein

Abstract

The invention discloses a YAP1 spermaceti mutant protein, the YAP1 spermaceti mutant protein is specifically a human YAP1 protein carrying a spermaceti mutation site A214S, compared with the human YAP1 protein, the 214 site of the amino acid of the protein mutates from alanine to serine, and the nucleotide sequence of the protein is shown as SEQ ID NO: 1. The invention also discloses a coding gene and a recombinant vector of the YAP1 spermaceti mutant protein as well as a construction method and application of the recombinant vector, and the influence of the mutant protein on inhibition of migration and invasion of cancer cells and the effect of inhibiting growth and migration of tumor-bearing in a mouse body are determined.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a YAP1 cetacean mutant protein. The present invention also relates to a coding gene and application of the YAP1 cetacean mutant protein. Background Art

[0002] The occurrence of cancer has a significant impact on life expectancy. According to statistics from the World Health Organization (WHO), nearly 10 million people die from cancer each year, so inhibiting the occurrence of cancer is one of the most critical strategies to extend life expectancy.

[0003] In order to extend their lifespan, wild mammals have evolved mechanisms to protect themselves from cancer. Whales are an ideal research model for studying longevity and cancer suppression. The AnAge database (http: / / genomics.senescence.info / species / ), a mammal lifespan database, shows that 9 of the top 10 mammals with the longest lifespan are whale species. Field anatomical data show that only 14 of 1,800 stranded whales were found to have tumors in autopsies, with a cancer rate of only 0.78%. In another whale autopsy report, 50 dead individuals were randomly sampled and no tumors were detected. It is speculated that whales have evolved unique tumor suppression mechanisms to extend their lifespan. Therefore, analyzing their genetic mechanisms of tumor suppression can provide new insights into human cancer prevention and treatment.

[0004] The YAP1 gene is the main effector protein in the HIPPO signaling pathway. It not only regulates organ size but also widely participates in the occurrence and development of tumors, cell proliferation and differentiation, and cell apoptosis. Mutations in the YAP1 gene can lead to the occurrence of a variety of cancers. However, whether the cetacean YAP1 gene is involved in the cetacean tumor suppression process has not been reported. Summary of the invention

[0005] The first object of the present invention is to provide a YAP1 cetacean mutant protein, which has a clear effect on inhibiting cancer cell migration and invasion.

[0006] The second object of the present invention is to provide a gene encoding the above YAP1 cetacean mutant protein.

[0007] The third object of the present invention is to provide a recombinant plasmid comprising a YAP1 cetacean mutant protein.

[0008] The fourth object of the present invention is to provide a recombinant CT26 cell line expressing YAP1 cetacean mutant protein.

[0009] The fifth objective of the present invention is the application of YAP1 cetacean mutant protein in the field of inhibiting cancer occurrence.

[0010] The first technical solution adopted by the present invention is: YAP1 cetacean mutant protein, which is specifically a human YAP1 protein carrying the cetacean mutation site A214S. Compared with the human YAP1 protein, the amino acid 214 position of the protein is mutated from alanine to serine, and its amino acid sequence is shown in SEQ ID NO: 2.

[0011] The second technical solution adopted by the present invention is: the coding gene of the above-mentioned YAP1 cetacean mutant protein, the nucleotide sequence of the YAP1 cetacean mutant protein is shown in SEQ ID NO:1.

[0012] The third technical solution adopted by the present invention is: a recombinant plasmid pcDNA3.1-YAP1 plasmid, which can transiently express the above-mentioned YAP1 cetacean mutant recombinant protein in cells.

[0013] The fourth technical solution adopted by the present invention is: a method for constructing a recombinant plasmid pcDNA3.1-YAP1 plasmid, which is specifically implemented according to the following steps: Step 1. Human YAP1 gene primer design: According to the coding sequence of human YAP1 gene, 5'-3': ATGGATCCCGGGCAGCAGC was used as the upstream primer, and 5'-3': CTATAACCATGTAAGAAAGC was used as the downstream primer; Step 2, obtaining the human YAP1 gene cDNA sequence: using the upstream primer and the downstream primer mentioned above to perform PCR amplification to obtain a large amount of YAP1 gene coding sequence; Step 3. Design of primers for homology arms of human YAP1 gene cDNA sequence: According to the restriction site of pcDNA3.1, 5'-3': AAACGGGCCCTCTAGACATGGATCCCGGGCAGCAGC was used as the upstream primer, and 5'-3': TAACCATGTAAGAAAGCCTATAACCATGTAAGAAAGC was used as the downstream primer; Step 4, homologous recombination of the cDNA sequence of the human YAP1 gene and the pcDNA3.1 vector: according to the primer PCR in the above step 3, obtain the YAP1 gene sequence with homologous arms, and use endonuclease to digest pcDNA3.1 to obtain a linearized pcDNA3.1 vector; then use a homologous recombination enzyme to connect the cDNA sequence of the human YAP1 gene and the pcDNA3.1 vector to obtain a connection product; transform the connection product into competent Escherichia coli, evenly spread it on an LB solid culture medium plate containing antibiotics, pick a single clone strain for identification, and obtain a pcDNA3.1-hYAP1 plasmid; Step 5, obtaining pcDNA3.1-YAP1 plasmid: design YAP1 cetacean mutation primers, 5'-3': CCAGATGAACGTCACATCCCCCACCAGTCCAC as the upstream primer, 5'-3': ATGTGACGTTCATCTGGGACAGCATGGCCTTCC as the downstream primer, use DNA polymerase and the upstream and downstream primers to mutate the plasmid in step 4 into pcDNA3.1-YAP1 plasmid.

[0014] The fifth technical solution adopted by the present invention is: a recombinant plasmid pLV-zsGreen-Puro-CMV-YAP1 plasmid, which can stably express the above-mentioned YAP1 cetacean mutant recombinant protein in cells.

[0015] The sixth technical solution adopted by the present invention is: a method for constructing a recombinant plasmid pLV-zsGreen-Puro-CMV-YAP1 plasmid, which is specifically implemented according to the following steps: Step 1. Design of primers for homology arms of YAP1 gene cDNA sequence: According to the restriction site of pLV-zsGreen-Puro-CMV, 5'-3': TAGCGCTACCGGACTCAGATCTCGAGATGGATCCCGGGCAGCAGC was used as the upstream primer, and 5'-3': CCGCACGCGTGTCGACTGCAGAATTCCTATAACCATGTAAGAAAGC was used as the downstream primer; Step 2. Obtaining the recombinant plasmid pLV-zsGreen-Puro-CMV-YAP1 plasmid: Obtain the YAP1 gene sequence with homology arms by primer PCR according to step 1, and use endonuclease to cut the pLV-zsGreen-Puro-CMV vector to obtain a linearized pLV-zsGreen-Puro-CMV vector; then use a homologous recombinase to connect the cDNA sequence of the YAP1 gene with the pLV-zsGreen-Puro-CMV vector to obtain a connection product; transform the connection product into competent Escherichia coli, evenly spread it on an LB solid culture medium plate containing antibiotics, pick a single clone strain for identification, and obtain the pLV-zsGreen-Puro-CMV-YAP1 plasmid.

[0016] The seventh technical solution adopted by the present invention is: a recombinant plasmid pLV-luci-YAP1 plasmid, which can stably express the above-mentioned YAP1 cetacean mutant recombinant protein in cells.

[0017] The eighth technical solution adopted by the present invention is: a method for constructing a recombinant plasmid pLV-luci-YAP1 plasmid, which is specifically implemented according to the following steps: Step 1. Design of primers for homology arms of YAP1 gene cDNA sequence: According to the restriction site of pLV-luci, 5'-3': TCTAGAAACTGTACAAGGAATTCATGGATCCCGGGCAGCAGC was used as the upstream primer, and 5'-3': TCCGGGCCCGGGTTCGAACTCGAGCTATAACCATGTAAGAAAGC was used as the downstream primer; Step 2, obtaining the recombinant plasmid pLV-luci-YAP1 plasmid: according to the primer PCR in step 1, obtain the YAP1 gene sequence with homology arms, and use endonuclease to cut the pLV-luci vector to obtain a linearized pLV-luci vector; then use a homologous recombinase to connect the cDNA sequence of the YAP1 gene with the pLV-luci vector to obtain a connection product; transform the connection product into competent Escherichia coli, evenly spread it on an LB solid culture medium plate containing antibiotics, pick a single clone strain for identification, and obtain the pLV-luci-YAP1 plasmid.

[0018] The ninth technical solution adopted by the present invention is: a recombinant CT26 cell line expressing YAP1 cetacean mutant protein, the above-mentioned plasmid is transfected into CT26 colorectal cancer cells, and then puromycin is used with a screening concentration of 2ug to identify and screen the recombinant CT26 cell line, and the recombinant CT26 cell line can stably express the YAP1 cetacean mutant recombinant protein.

[0019] The tenth technical solution adopted by the present invention is: application of the above YAP1 cetacean mutant protein in the field of inhibiting cancer.

[0020] The beneficial effects of the present invention are: The present invention discloses a cetacean mutant protein of a human cancer-related gene YAP1, and also discloses the application of the above protein in inhibiting cancer. The present invention identifies a cetacean mutant human cancer-related gene YAP1 through gene comparative genomics research, uses lentivirus to construct a stable cell line expressing a YAP1 cetacean mutant protein in colorectal cancer cells, and determines the effect of the mutant protein on inhibiting cancer cell migration and invasion, as well as the effect of inhibiting tumor growth and migration in mice. The YAP1 cetacean mutant protein can be further developed as a potential new anti-tumor drug. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the cetacean-specific locus map of the YAP1 gene; Figure 2AThis is the result of Transwell assay for cell migration ability; Figure 2B This is the result of cell scratch experiment; Figure 2C Schematic diagram of Transwell assay for cell invasion ability; Figure 3A Schematic diagram of YAP1 gene function; Figure 3B Schematic diagram of YAP1 cetacean mutant protein enhancing the phosphorylation modification level of YAP1 protein; Figure 4 showed that YAP1 cetacean mutant protein inhibited subcutaneous tumor growth in mice; Figure 5 Schematic diagram of YAP1 cetacean mutant protein inhibiting lung tumor metastasis; Figure 6 This is the immunohistochemistry image of mTOR protein; Figure 7 Schematic diagram of differentially expressed genes caused by YAP1 cetacean mutant protein; Figure 8 This is the RT-qPCR diagram of the five genes in Example 7. DETAILED DESCRIPTION

[0022] The technical solution of the present invention will be clearly and completely described below in conjunction with the accompanying drawings.

[0023] The present invention identified a cetacean mutated human cancer-related gene YAP1 through comparative gene genomics research. Figure 1 As shown, the following technical solutions are provided.

[0024] The present invention provides a YAP1 cetacean mutant protein, which is specifically a human YAP1 protein carrying a cetacean mutation site A214S. Compared with the human YAP1 protein, the amino acid 214 position of the protein is mutated from alanine to serine, and the amino acid sequence is shown in SEQ ID NO: 2.

[0025] The present invention also provides a gene encoding the YAP1 cetacean mutant protein. The nucleotide sequence of the YAP1 cetacean mutant protein is shown in SEQ ID NO:1.

[0026] The present invention also provides a recombinant plasmid pcDNA3.1-YAP1 plasmid, which can transiently express the above-mentioned YAP1 cetacean mutant recombinant protein in cells.

[0027] The present invention also provides a method for constructing the above-mentioned recombinant plasmid pcDNA3.1-YAP1 plasmid, which is specifically implemented according to the following steps: Step 1. Human YAP1 gene primer design: According to the coding sequence of human YAP1 gene, 5'-3': ATGGATCCCGGGCAGCAGC was used as the upstream primer, and 5'-3': CTATAACCATGTAAGAAAGC was used as the downstream primer; Step 2, obtaining the human YAP1 gene cDNA sequence: using the upstream primer and the downstream primer mentioned above to perform PCR amplification to obtain a large amount of YAP1 gene coding sequence; Step 3. Design of primers for homology arms of human YAP1 gene cDNA sequence: According to the restriction site of pcDNA3.1, 5'-3': AAACGGGCCCTCTAGACATGGATCCCGGGCAGCAGC was used as the upstream primer, and 5'-3': TAACCATGTAAGAAAGCCTATAACCATGTAAGAAAGC was used as the downstream primer; Step 4, homologous recombination of the cDNA sequence of the human YAP1 gene and the pcDNA3.1 vector: according to the primer PCR in the above step 3, obtain the YAP1 gene sequence with homologous arms, and use endonuclease to digest pcDNA3.1 to obtain a linearized pcDNA3.1 vector; then use a homologous recombination enzyme to connect the cDNA sequence of the human YAP1 gene and the pcDNA3.1 vector to obtain a connection product; transform the connection product into competent Escherichia coli, evenly spread it on an LB solid culture medium plate containing antibiotics, pick a single clone strain for identification, and obtain a pcDNA3.1-hYAP1 plasmid; Step 5, obtaining pcDNA3.1-YAP1 plasmid: design YAP1 cetacean mutation primers, 5'-3': CCAGATGAACGTCACATCCCCCACCAGTCCAC as the upstream primer, 5'-3': ATGTGACGTTCATCTGGGACAGCATGGCCTTCC as the downstream primer, use DNA polymerase and the upstream and downstream primers to mutate the plasmid in step 4 into pcDNA3.1-YAP1 plasmid.

[0028] The present invention also provides the above-mentioned recombinant plasmid pLV-zsGreen-Puro-CMV-YAP1 plasmid, and the pLV-zsGreen-Puro-CMV-YAP1 plasmid can stably express the above-mentioned YAP1 cetacean mutant recombinant protein in cells.

[0029] The present invention also provides a method for constructing the above-mentioned recombinant plasmid pLV-zsGreen-Puro-CMV-YAP1 plasmid, which is specifically implemented according to the following steps: Step 1. Design of primers for homology arms of YAP1 gene cDNA sequence: According to the restriction site of pLV-zsGreen-Puro-CMV, 5'-3': TAGCGCTACCGGACTCAGATCTCGAGATGGATCCCGGGCAGCAGC was used as the upstream primer, and 5'-3': CCGCACGCGTGTCGACTGCAGAATTCCTATAACCATGTAAGAAAGC was used as the downstream primer; Step 2. Obtaining the recombinant plasmid pLV-zsGreen-Puro-CMV-YAP1 plasmid: Obtain the YAP1 gene sequence with homology arms by primer PCR according to step 1, and use endonuclease to cut the pLV-zsGreen-Puro-CMV vector to obtain a linearized pLV-zsGreen-Puro-CMV vector; then use a homologous recombinase to connect the cDNA sequence of the YAP1 gene with the pLV-zsGreen-Puro-CMV vector to obtain a connection product; transform the connection product into competent Escherichia coli, evenly spread it on an LB solid culture medium plate containing antibiotics, pick a single clone strain for identification, and obtain the pLV-zsGreen-Puro-CMV-YAP1 plasmid.

[0030] The present invention also provides the above-mentioned recombinant plasmid pLV-luci-YAP1 plasmid, and the pLV-luci-YAP1 plasmid can stably express the above-mentioned YAP1 cetacean mutant recombinant protein in cells.

[0031] The present invention also provides a method for constructing the above-mentioned recombinant plasmid pLV-luci-YAP1 plasmid, which is specifically implemented according to the following steps: Step 1. Design of primers for homology arms of YAP1 gene cDNA sequence: According to the restriction site of pLV-luci, 5'-3': TCTAGAAACTGTACAAGGAATTCATGGATCCCGGGCAGCAGC was used as the upstream primer, and 5'-3': TCCGGGCCCGGGTTCGAACTCGAGCTATAACCATGTAAGAAAGC was used as the downstream primer; Step 2, obtaining the recombinant plasmid pLV-luci-YAP1 plasmid: according to the primer PCR in step 1, obtain the YAP1 gene sequence with homology arms, and use endonuclease to cut the pLV-luci vector to obtain a linearized pLV-luci vector; then use a homologous recombinase to connect the cDNA sequence of the YAP1 gene with the pLV-luci vector to obtain a connection product; transform the connection product into competent Escherichia coli, evenly spread it on an LB solid culture medium plate containing antibiotics, pick a single clone strain for identification, and obtain the pLV-luci-YAP1 plasmid.

[0032] The present invention also provides the above-mentioned recombinant CT26 cell line expressing YAP1 cetacean mutant protein. The above-mentioned plasmid is transfected into CT26 colorectal cancer cells, and then puromycin is used with a screening concentration of 2ug to identify and screen the recombinant CT26 cell line. The recombinant CT26 cell line can stably express the YAP1 cetacean mutant recombinant protein.

[0033] The present invention also provides application of the YAP1 cetacean mutant protein in the field of inhibiting cancer.

[0034] The present invention will be further described below by way of examples and drawings: Example 1: Identification of cetacean-specific amino acid changes: The sequences of 108 mammalian YAP1 genes were downloaded from the OrthoMaM (http: / / www.orthomam.univ-montp2.fr / orthomam / html / ) database, the NCBI database (https: / / www.ncbi.nlm.nih.gov) and the bowhead whale database (http: / / www.bowhead-whale.org), including 25 whale species and 83 other mammals. The retrieved coding sequences were codon aligned by the Prank program in Fasparser (https: / / github.com / Sun-Yanbo / FasParser), and non-homologous fragments were deleted by Gblocks with the parameters ("-t = codons -b5 = half"), and finally the YAP1 gene sequences of 108 mammals were obtained. Using the Fasparser software, it was found that there was a cetacean-specific amino acid mutation A214S at position 214 of the YAP1 gene, and this site was located near the WW domain, such as Figure 1 As shown, the 214th position of the YAP1 gene is serine Ser in cetaceans and alanine Ala in other mammals. The nucleotide sequence of the identified cetacean YAP1-specific amino acid mutation is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2.

[0035] Example 2: Construction of a plasmid expressing YAP1 cetacean mutant protein First, in 1×10 7 Add 1 ml Trizol to a certain number of HeLa cells, make sure that the cells are fully covered, then blow the cells off and transfer the lysate to a 1.5 ml centrifuge tube. Use a pipette to blow repeatedly until the cells are fully lysed. Place the tube on ice for 30 minutes and perform the following steps: (1) Add 200 μl of chloroform to the above lysate. Shake vigorously for 15 seconds until it becomes an emulsion, and let stand at 4°C for 5 minutes.

[0036] (2) Centrifuge at 12,000 rpm, 4°C for 15 min.

[0037] (3) Carefully remove the centrifuge tube. The solution is now divided into three layers: a colorless aqueous phase (upper layer), a white middle layer, and a red organic layer (lower layer). Carefully pipette the upper aqueous phase into a new centrifuge tube.

[0038] (4) Add an equal volume of pre-cooled isopropanol, mix by inverting, and let stand at 4°C for 10 min.

[0039] (5) Centrifuge at 12,000 rpm, 4°C for 10 min. A white precipitate can usually be seen.

[0040] (6) Carefully discard the supernatant and add 1 ml of 75% ethanol (RNase-Free ddH2O). Gently tap the bottom of the tube to suspend the precipitate, invert it several times, and let it stand at room temperature for 3-5 minutes.

[0041] (7) Centrifuge at 12,000 rpm, 4°C for 5 min and discard the supernatant.

[0042] (8) Dry the precipitate in an open air at room temperature in a clean environment for 2-5 minutes. Be careful not to over-dry it, otherwise it will make the RNA difficult to dissolve.

[0043] (9) Add 40 μl of RNase-Free ddH2O to dissolve the precipitate. After it is completely dissolved, take 2 μl to test the purity of the RNA and store the rest at -80°C.

[0044] Next, the above RNA was reverse transcribed using a reverse transcription kit. The reverse transcription system is as follows: (1) Prepare the mixture shown in Table 1 in an RNase-Free centrifuge tube: Table 1

[0045] (2) Mix by gently pipetting and incubate at 42°C for 2 min.

[0046] (3) Add 4 μl of 5×HiScript II qRT SuperMix II to the above centrifuge tube and mix gently by pipetting.

[0047] (4) Perform reverse transcription according to the conditions in Table 2.

[0048] Table 2

[0049] The cDNA template obtained above was used to amplify the human YAP1 gene, and the amplification primers used were: F (5'-3'): ATGGATCCCGGGCAGCAGC R (5'-3'): CTATAACCATGTAAGAAAGC The reaction system is shown in Table 3: Table 3

[0050] Use a vortex shaker to mix and centrifuge briefly before PCR amplification. The reaction procedure is shown in Table 4: Table 4

[0051] After the reaction is completed, 2 μL is required for electrophoresis detection, and an appropriate amount of PCR product is taken for sequencing.

[0052] In this experiment, pcDNA3.1 vector was used to construct plasmid. 2 μg of plasmid was digested with enzymes to linearize the plasmid. The enzymes were digested at 37°C for 5 h and purified using a DNA kit. The purified vector was homologously recombined with the YAP1 gene sequence. The homology arm primers of the YAP1 gene are: F (5'-3'): AAACGGGCCCTCTAGACATGGATCCCGGGCAGCAGC R (5'-3'): TAACCATGTAAGAAAGCCTATAACCATGTAAGAAAGC The enzyme digestion system is shown in Table 5: Table 5

[0053] Gel excision and purification were performed using the AXYGEN gel recovery kit according to the kit instructions.

[0054] The system of homologous recombination is as follows: Table 6

[0055] The above ligation product was transformed as follows: (1) Take out the competent cells from the -80℃ freezer and place them on ice to thaw for about 3 minutes. Add the ligation product according to the ratio (ligation product: competent cells = 1:100) and place on ice for 30 minutes.

[0056] (2) Heat shock at 42°C in a water bath for 90 seconds. Immediately place on ice for 3 minutes.

[0057] (3) Add 1 mL of LB liquid culture medium without antibiotics and place in a shaker at 37°C and 200 rpm for 1 h. At the same time, place the solid culture medium plate in an oven.

[0058] (4) Take out the bacterial solution, centrifuge at 1000 rpm for 3 min, aspirate the bacterial solution, and keep 200 µL. Mix it with a pipette and use a clean ball to spread it on an LB solid culture medium plate with ampicillin.

[0059] (5) Invert and place in a 37°C incubator for 12-16 hours.

[0060] (6) Extract the plasmid. The method for plasmid extraction was carried out according to the instructions of Tiangen's Endotoxin-Free Small-Prep Medium-Scale Plasmid Extraction Kit (DP118). After extraction, the plasmid was sent to the company for sequencing. After the sequence alignment was correct, the pcDNA3.1-hYAP1 plasmid was finally obtained.

[0061] (7) To obtain the pcDNA3.1 plasmid expressing the YAP1 cetacean mutant protein, the following primers were designed: F (5'-3'): CCAGATGAACGTCACATCCCCCACCAGTCCAC R (5'-3'): ATGTGACGTTCATCTGGGACAGCATGGCCTTCC The Tiangen Rapid Point Mutagenesis Kit (KM101) was further used according to the instructions to finally obtain the pcDNA3.1 plasmid expressing the YAP1 cetacean mutant protein, which was named: pcDNA3.1-YAP1.

[0062] Example 3: Verification of the inhibition of HeLa cell migration and invasion by YAP1 cetacean mutant protein: In order to detect whether the cetacean mutant protein of YAP1, which carries the cetacean-specific site A214S, has a stronger ability to suppress tumors, the HeLa cells used in this study were derived from the Institute of Molecular Cell Biology, School of Life Sciences, Nanjing Normal University, and were subcultured in this laboratory. First, HeLa cells were plated in a 6 cm dish 12 hours in advance and transfected when they grew to a concentration of 60%. PEI was used for transfection in this experiment. After transfection of 1.5 μg of plasmid into the cells, they were re-plated in a 24-well plate with an 8𝜇m pore size polycarbonate membrane chamber for 36 hours, and the cell density was 1.0×10 5. The serum concentration in the chamber was 2%, and the serum concentration in the lower chamber was 20%. After 48 hours, 4% paraformaldehyde was used to fix the cells in the upper chamber and the lower chamber of the chamber respectively. Finally, crystal violet was used to stain the fixed cells. After the cells were treated, they were photographed using an optical microscope. The number of positive cells was counted to evaluate the ability of YAP1 cetacean mutant protein to inhibit cell migration. In this experiment, the NC group was used as a negative control, the human YAP1 gene (hYAP1 group) was used as a positive control, and the YAP1 cetacean mutant protein (hYAP1 A214S The experimental group was the control group. The experimental results were analyzed using GraphPad Prism software, and the significance of the data was tested using Student's t-test. The results showed that the number of cell migration in the NC group (control) was 418.2±21.903; the number of cell migration in the hYAP1 group was 444.6±14.427, P=0.3227, which was not statistically significant compared with the NC group (control); hYAP1 A214S The number of cell migration in the hYAP1 group was 354.6±16.285, P=0.0003, which was statistically significant compared with the hYAP1 group. A214S The group significantly inhibited the migration of HeLa cells. Figure 2A As shown, Figure 2A The results of Transwell assay for cell migration ability show that compared with the hYAP1 group, hYAP1 carrying the cetacean-specific amino acid change A214S site A214S The group reduced cancer cell migration by about 12%, indicating that the YAP1 cetacean mutant protein inhibits cancer cell migration.

[0063] After repeating the transfection steps, the cells were re-seeded in a 6-well plate to detect the healing ability of the cells after scratching. Before plating, 5 parallel black lines were drawn on the back of the 6-well plate with a maker pen. The purpose of the black lines was to locate the position for later photography. After drawing, the treated cells were plated in the 6-well plate, and the cell number was preferably 80%. After attachment, the serum-containing culture medium was removed, and the cells were starved with DMEM for 12 hours. After the cells were fully grown, they were scratched with a gun tip. After scratching, the cells were washed twice with 1 ml of PBS buffer. Finally, the scratches at the same position were photographed using an inverted microscope at 0 and 48 hours. The experimental results were analyzed using GraphPad Prism software, and the significance of the data was detected using Student's t-test. The results showed that the healing rate of cells in the NC group (control) was 22.302±0.795; the healing rate of cells in the hYAP1 group was 28.460±0.521, P<0.0001, which was statistically significant compared with the NC group (control); hYAP1 A214SThe healing rate of the cells in the YAP1 group was 22.408±0.754, P<0.0001, which was statistically significant compared with the hYAP1 group. A214S The YAP1 cetacean mutant protein can inhibit the migration of tumor cells, indicating that the YAP1 cetacean mutant protein can inhibit the migration of tumor cells. Figure 2B As shown, Figure 2B The results of cell scratch assay show that hYAP1 A214S Compared with the hYAP1 group, the group reduced cancer cell migration by about 8%.

[0064] Matrigel is a three-dimensional matrix that can act as a biologically active matrix. Its main components include laminin, type IV collagen, entactin, heparin sulfate glycoprotein, growth factors and matrix metalloproteinases, etc. It can be used to simulate the invasion of tumor cells in vivo. In this study, after paving 7% concentration of Matrigel in a polycarbonate membrane chamber with an 8μm pore size, cells transfected with YAP1 cetacean mutant protein were inoculated in the chamber at a cell density of 1.0×10 5 . The serum concentration in the chamber was 2%, and the serum concentration in the lower chamber was 20%. After 48 hours, the chamber was carefully washed with PBS, and the cells in the upper chamber and the lower chamber of the chamber were fixed with 4% paraformaldehyde. Finally, the fixed cells were stained with crystal violet. After the cells were treated, they were photographed using an optical microscope. The number of positive cells was counted to evaluate the ability of the YAP1 cetacean mutant protein to inhibit cell invasion. The experimental results were analyzed using GraphPad Prism software, and the significance of the data was detected using Student's t-test. The results showed that the number of invading cells in the NC group (control) was 197.867±7.922; the number of invading cells in the hYAP1 group was 225.267±11.052, P=0.3996, which was not statistically significant compared with the NC group (control); hYAP1 A214S The number of cells invading in the hYAP1 group was 111.733±7.328, P=0.203, which was significantly different from that in the hYAP1 group. A214S The group significantly inhibited cell invasion, such as Figure 2C As shown, Figure 2C For Transwell assay of cell invasion ability, hYAP1 A214S The group reduced cancer cell invasion by 50%.

[0065] Example 4: Verification of enhanced phosphorylation levels of YAP1 cetacean mutant protein: 1. Three groups of cell lines stably expressing YAP1 gene were constructed by lentiviral system, including negative control group (NC group) and two experimental groups including human YAP1 gene stably overexpressed (hYAP1 group) and human YAP1 gene carrying cetacean-specific amino acid site A214S (hYAP1 group). A214S Group). First, three vectors were constructed: pLV-zsGreen-Puro-CMV, pMD2.G and psPAX2. Among them, pLV-zsGreen-Puro-CMV is a plasmid expressing the target gene. The primers used to construct the pLV-zsGreen-Puro-CMV-YAP1 plasmid are: F (5'-3'): TAGCGCTACCGGACTCAGATCTCGAGATGGATCCGGGCAGCAGC R (5'-3'): CCGCACGCGTGTCGACTGCAGAATTCCTATAACCATGTAAGAAAGC pMD2.G and psPAX2 are viral membrane protein and viral capsid plasmids, respectively, purchased from Nanjing Koris Biotech Co., Ltd. The three plasmids were co-transfected into 293T cells through PEI liposomes, and the cell supernatant was taken after 48 hours; after centrifugation, the supernatant was taken and co-cultured with CT26 colorectal cancer cells, of which CT26 cells were purchased from Nanjing Runyan Biotech Co., Ltd.; 293T cell supernatants were taken after 72 and 96 hours, respectively, and the supernatants after centrifugation were continued to be added to CT26 cells for culture. To ensure higher transfection efficiency, the above steps were repeated. The cells that have been infected with the virus were re-passaged and plated, and after the cells adhered to the wall, 2μg of puromycin was used to screen the positive clones.

[0066] 2. The present invention uses Wuhan Dian Company to prepare an antibody for detecting phosphorylation of the A214S site of the YAP1 gene to detect the phosphorylation level of A214S in cetaceans. A214S The phosphorylation level of the group cells was determined by Western blot experiment. First, 1×10 7 After a stable cell line stably expressing YAP1 cetacean mutant protein was generated, the cells were lysed using Biotech's WI LysisBuffer reagent, protease inhibitors, and BioSharp's phosphatase inhibitors. After half an hour of low-temperature lysis, the cells were centrifuged to obtain the cell supernatant; 2 microliters of the supernatant was taken for protein concentration detection; the detection was performed using the Biotech BCA detection kit, and the specific method is as follows: (1) Take 1.2 ml of protein standard preparation solution and add it to a tube of protein standard (30 mg BSA). After fully dissolving, prepare a 25 mg / ml protein standard solution.

[0067] (2) Take an appropriate amount of 25 mg / ml protein standard and dilute it to a final concentration of 0.5 mg / ml. Add 0, 1, 2, 4, 8, 12, 16, and 20 μl of the standard to the standard wells of a 96-well plate. Add standard diluent to make up to 20 μl, which is equivalent to a standard concentration of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / ml, respectively.

[0068] (3) Add an appropriate volume of sample to the sample wells of the 96-well plate. If the sample volume is less than 20 μl, add standard diluent to make it up to 20 μl. Please remember to record the sample volume.

[0069] (4) Add 200 μl of BCA working solution to each well (prepare an appropriate amount of BCA working solution by adding 50 volumes of BCA reagent A to 1 volume of BCA reagent B (50:1) and mix thoroughly). Incubate at 37°C for 20-30 minutes.

[0070] (5) Use an ELISA reader to measure the absorbance at wavelength A562.

[0071] (6) Calculate the protein concentration of the sample based on the standard curve and the sample volume used.

[0072] The remaining protein was added to the loading buffer at a ratio of 1:4, where the main components of the loading buffer were SDS, glycerol, bromophenol blue and Tris. The above equal amounts of protein samples were subjected to discontinuous electrophoresis in an 8% SDS-PAGE gel, and the electrophoresis conditions were 90v for 30 minutes, and the voltage was adjusted to 120v until the end of the electrophoresis. When the protein Maker was completely separated, the electrophoresis was stopped, and then the protein on the PAGE gel was transferred to the PVDF membrane, and the electrotransfer conditions were 260mA for 90 minutes. After obtaining the PVDF membrane containing protein, it was blocked with TBST buffer containing 5% BSA at room temperature for 2 hours, washed three times with TBST buffer and incubated with the primary antibody at 4°C overnight. The next day, the PVDF membrane was washed three times with TBST buffer, and the PVDF membrane was incubated with a chemical secondary antibody labeled with horseradish peroxidase at room temperature for 2 hours, and the PVDF membrane was washed three times with TBST buffer. Finally, the PVDF membrane was developed using ECL luminescent liquid and images were collected. The experimental results were analyzed using GraphPad Prism software, and Student's t-test was used to detect the significance of the data. The results showed that the relative phosphorylation level of the protein in the NC group (control) was 0.460±0.065; the relative phosphorylation level of the hYAP1 group protein was 0.618±0.036, P=0.0994, which was not statistically significant compared with the NC group (control); hYAP1 A214S The relative phosphorylation level of histones was 1.073±0.048, P=0.0016, which was statistically significant compared with the hYAP1 group. A214S The phosphorylation level of the group was significantly increased, as shown in Figure 3. Figure 3A This is a schematic diagram of the function of the YAP1 gene. The YAP1 gene is degraded after phosphorylation modification, but the unphosphorylated YAP1 gene will bind to the TEAD protein to promote the expression of downstream genes, such as some cancer-related genes. Figure 3B Compared with the hYAP1 group, hYAP1 A214S The phosphorylation level of the group doubled, that is, the phosphorylation level of YAP1 cetacean mutant protein was significantly enhanced.

[0073] Example 5: YAP1 cetacean mutant protein inhibits tumor growth and migration in mice: Four-week-old BABL / c male mice were purchased from Nanjing Jicui Pharmaceutical Co., Ltd., with a weight range of 14-16g, and were divided into cages of 6 mice per cage. After the mice were divided into cages, a subcutaneous tumor formation experiment was conducted after one week of adaptation to the new environment of the animal barrier. The subcutaneous tumor transplantation experiment in mice was conducted in accordance with the paper "Study on the Effect of MHC Class I Molecules on the Tumor Formation of Mouse Transplanted Tumors" published in Volume 30, Issue 3 of the "Chinese Journal of Immunology". First, a cell line stably expressing YAP1 cetacean mutant protein in the logarithmic growth phase was taken, and the cell concentration was 1.2×10 6 / mouse, injected subcutaneously into the mouse. The mouse status and tumor growth were observed and recorded every two days after injection. According to animal ethics, when the maximum tumor grew to 1.5 cubic centimeters, the tumor growth was terminated and the mouse was terminally treated. After peeling off the subcutaneous tumor of the mouse, the mouse tumor was weighed, photographed, and the volume was measured. The experimental results were analyzed using GraphPad Prism software, and the significance of the data was tested using Student's t-test. The results of mouse tumor weight showed that the weight of the transplanted tumor in the NC group (control) was 0.947±0.224; the weight of the transplanted tumor in the hYAP1 group was 0.808±0.069, P=0.8826, and there was no statistically significant difference with the NC group (control); hYAP1 A214S The transplanted tumor weight of the NC group was 0.280±0.081, P=0.0006, which was statistically significant compared with the hYAP1 group. The mouse volume results showed that the transplanted tumor volume of the NC group (control) was 1207.827±159.451; the transplanted tumor volume of the hYAP1 group was 975.834±85.983, P=0.3991, which was not statistically significant compared with the NC group (control); A214S The transplanted tumor volume of the group was 294.326±76.727, P=0.0004, which was statistically significant compared with the hYAP1 group. A214S The tumor volume and weight of mice in the hYAP1 group were significantly smaller than those in the hYAP1 group, indicating that the YAP1 cetacean mutant protein significantly inhibited the growth of tumors in mice. Figure 4 As shown, compared with human YAP1 protein, YAP1 cetacean mutant protein reduced tumor weight and volume by about 50% on average, showing that the group carrying cetacean YAP1 gene-specific mutations (hYAP1 A214S The tumors of mice in the hYAP1 group were significantly smaller than those in the hYAP1 group.

[0074] In order to further detect whether tumor cells have the ability to migrate in vivo, three groups of stable cell lines that can simultaneously express firefly luciferase (Luciferase) were constructed, namely, NC (Negative control) group, hYAP1 group and hYAP1A214S First, the sequences of the human YAP1 gene and the YAP1 cetacean mutant gene were reconnected into the pLV-luci vector using the following primers: F (5'-3'): TCTAGAAACTGTACAAGGAATTCATGGATCCCGGGCAGCAGC R (5'-3'): TCCGGGCCCGGGTTCGAACTCGAGCTATAACCATGTAAGAAAGC The expression vector of YAP1 cetacean mutant protein was named pLV-luci-YAP1, and the vector expressing human YAP1 gene was named pLV-luci-hYAP1. The vector was transfected into 293T cells simultaneously with pMD2.G and psPAX2, and the cell supernatant was taken after 48 hours; after centrifugation, the supernatant was taken and co-cultured with CT26 cells; after 72 and 96 hours, the 293T cell supernatant was taken again, and the supernatant after centrifugation was added to CT26 cells for culture. To ensure higher transfection efficiency, continue to repeat the above steps. The cells that have been infected with the virus were re-passaged and plated, and after the cells adhered, 2μg of puromycin was used to select the positive clones. Cells in the logarithmic growth phase were taken, and the cell concentration was 1.2×10 6 / injected into the tail vein of BABL / c mice, a total of three groups, namely NC (Negative control) group, hYAP1 group and hYAP1 A214S Groups, 6 mice in each group. The mouse lung migration experiment was conducted according to the paper "The ability of demethylcantharidin to inhibit the invasion and metastasis of colorectal adenocarcinoma cells" published in the Journal of Chinese and Western Integrative Medicine, Volume 7, Issue 1. After the mice were injected with luciferin substrate every week, the luciferase activity was detected by mouse in vivo imaging to locate the location of tumor cell growth. Four weeks later, the mice were dissected to detect the lung tumor conditions. The experimental results were analyzed using GraphPad Prism software, and the Student's t-test was used to detect the significance of the data. The results showed that there were no tumor nodules in the lungs of the NC group mice, but there were no tumor nodules in the hYAP1 group and hYAP1 A214S All groups had tumor nodules. The number of lung tumors in the hYAP1 group was 19.167±3.553, P=0.0001, which was statistically significant compared with the NC group (control). A214S The weight of the transplanted tumor in the hYAP1 group was 9.333±2.390, P=0.0445, which was statistically significant compared with the hYAP1 group. A214SThe expression of hYAP1 in the tumor tissue was significantly increased in the control group. A214S The number of tumor cells in the hYAP1 group was significantly higher than that in the hYAP1 group. Figure 5 As shown, there were no tumor nodules in the NC group, but there were no tumor nodules in the hYAP1 and hYAP1 groups. A214S The number of tumor nodules in the hYAP1 group was higher than that in the group carrying the cetacean-specific mutation (hYAP1 A214S HE staining of tumor tissue also showed that hYAP1 A214S The number of tumor cells in the group was significantly reduced.

[0075] Example 6: Verification of YAP1 cetacean mutant protein inhibiting oncogene expression: In order to further explore the molecular mechanism by which YAP1 cetacean mutant protein inhibits cancer growth and migration, this study used immunohistochemistry to detect the expression of cancer-related protein mTOR protein in the above tumor tissues. First, the tumor tissue was peeled off from the mouse and placed in 4% paraformaldehyde. The tissue was dehydrated by low to high concentration ethanol to make it transparent. The tissue transparency time should not be too long, and the transparent tissue was embedded in paraffin. Next, the paraffin block containing the tissue was sliced, and the time for water evaporation and paraffin melting was noted during the slicing process. The obtained tissue slices were placed in a citric acid buffer and placed in a 100°C water bath for 15 minutes for antigen retrieval; after 3% hydrogen peroxide treatment for 15 minutes, serum blocking was used to remove non-specific adsorption. After washing, the serum was added with primary antibody protein. Finally, 3,3-diaminobenzidine tetrahydrochloride (DAB) stain was used to color the target protein. Hematoxylin was used for counterstaining to observe the nuclear morphology. All the above experimental parts were repeated three times independently and analyzed using GraphPad Prism software, and Student's t-test was used to detect the significance of the data. The results are as follows: the mTOR positive rate in the NC group (control) was 0.024±0.006; the mTOR positive rate in the hYAP1 group was 0.053±0.014, P=0.0792, with no significant difference from the NC group (control); A214S The mTOR positive rate of the hYAP1 group was 0.017±0.004, P=0.0248, which was statistically significant compared with the hYAP1 group. A214S The expression level of mTOR protein in the group was significantly decreased. Figure 6 As shown, compared with the hYAP1 group, hYAP1 A214S The mTOR protein expression level in the group was reduced to about 0.02%.

[0076] Example 7: Verification of the effect of YAP1 cetacean mutant protein on the expression of genes in cancer-related pathways: To further explore the effects of YAP1 cetacean mutant protein on downstream gene expression, we performed transcriptome sequencing on cell lines stably expressing human YAP1 gene, YAP1 cetacean mutant gene, and negative control group. A214S The results showed that there were 171 differentially expressed genes between the two groups, including 63 up-regulated genes and 108 down-regulated genes. These differentially expressed genes were mainly enriched in signaling pathways such as TGF-beta, protein degradation and absorption, and Rap1. For example, 8 differentially expressed genes (ID2, ID1, THBS1, ID3, THSD4, CHRD, MYC, and DCN) were significantly enriched in the TGF-beta signaling pathway (padj < 0.05). Figure 7 As shown, the left picture is hYAP1 A214S The right figure shows the TGF-beta signaling pathway enriched with 171 differentially expressed genes. It can be seen from the figure that the expression pattern of these 5 genes is the same as the transcriptome data.

[0077] Finally, in order to verify the expression of genes in transcriptome data, this study randomly selected 5 genes (DPPA4, SOGA, IGF2R, MYC and CASP3) for RT-qPCR experiments. First, primers were designed for the target genes using the primer design software in NCBI, and mRNA in the cells was extracted using Trizol, chloroform and isopropanol, and gel electrophoresis and nuclear concentration detection were performed. In the process of reverse transcription of the obtained mRNA into cDNA, it is necessary to pay attention to transcribing the same amount of mRNA. In order to ensure that the CT value of quantitative detection is within 16-33, all cDNA products need to be diluted with DEPC water at a ratio of 1:3 before quantitative PCR. DEPC water, template, upstream and downstream primers and Hieff® qPCR SYBR Green Master Mix reagents were added in sequence, and the PCR plate was placed in the Roche quantitative PCR instrument after mixing the reagents. The program was performed under the two-step PCR conditions recommended in the reagent manual. The relative expression level of the target gene was calculated using the 2-ΔΔCT method: ΔCT(test) = CT(target, test) – CT(ref, test); ΔCT(calibrator) = CT(target, calibrator) – CT(ref, calibrator); ΔΔCT = ΔCT(test) – ΔCT(calibrator). The experimental results were analyzed using GraphPad Prism software, and the significance of the data was tested using Student's t-test. The experimental results showed that the expression patterns of these five genes were the same as the transcriptome data, such as Figure 8 The results showed that hYAP1 A214S Compared with the hYAP1 group, the MYC gene expression level in the hYAP1 group was 0.335±0.062, P=0.0004, and the difference from the control was statistically significant; the IGF2R gene expression level was 0.195±0.162, P=0.0077, and the difference from the control was statistically significant; the SOGA gene expression level was 0.467±0.242, P=0.0923, and the difference from the control was not statistically significant; the CAPASE3 gene expression level was 8.643±0.666, P=0.0002, and the difference from the control was statistically significant; A214S Compared with the NC group, the IGF2R1 gene expression level in the WT group was 0.014±0.008, P<0.0001, and the difference with the control was statistically significant; the DPPa4 gene expression level was 0.004±0.001, P<0.0001, and the difference with the control was statistically significant.

[0078] Table 7

[0079] Sequence Listing Sequence Listing <110> Nanjing Normal University <120> YAP1 cetacean mutant protein and its encoding gene, recombinant vector and application <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1515 <212> DNA <213> Artificial sequence <400> 1 atggatcccg ggcagcagcc gccgcctcaa ccggcccccc agggccaagg gcagccgcct60 tcgcagcccc cgcaggggca gggcccgccg tccggacccg ggcaaccggc acccgcggcg120 acccaggcgg cgccgcaggc accccccgcc gggcatcaga tcgtgcacgt ccgcggggac180 tcggagaccg acctggaggc gctcttcaac gccgtcatga accccaagac ggccaacgtg240 ccccagaccg tgcccatgag gctccggaag ctgcccgact ccttcttcaa gccgccggag300 cccaaatccc actcccgaca ggccagtact gatgcaggca ctgcaggagc cctgactcca360 cagcatgttc gagctcattc ctctccagct tctctgcagt tgggagctgt ttctcctggg420 acactgaccc ccactggagt agtctctggc ccagcagcta cacccacagc tcagcatctt480 cgacagtctt cttttgagat acctgatgat gtacctctgc cagcaggttg ggagatggca540 aagacatctt ctggtcagag atacttctta aatcacatcg atcagacaac aacatggcag600 gaccccagga aggccatgct gtcccagatg aacgtcacat cccccaccag tccaccagtg660 cagcagaata tgatgaactc ggcttcaggt cctcttcctg atggatggga acaagccatg720 actcaggatg gagaaattta ctatataaac cataagaaca agaccacctc ttggctagac780 ccaaggcttg accctcgttt tgccatgaac cagagaatca gtcagagtgc tccagtgaaa 840 cagccaccac ccctggctcc ccagagccca cagggaggcg tcatgggtgg cagcaactcc 900 aaccagcagc aacagatgcg actgcagcaa ctgcagatgg agaaggagag gctgcggctg 960 aaacagcaag aactgcttcg gcaggcaatg cggaatatca atcccagcac agcaaattct1020 ccaaaatgtc aggagttagc cctgcgtagc cagttaccaa cactggagca ggatggtggg1080 actcaaaatc cagtgtcttc tcccgggatg tctcaggaat tgagaacaat gacgaccaat1140 agctcagatc ctttccttaa cagtggcacc tatcactctc gagatgagag tacagacagt1200 ggactaagca tgagcagcta cagtgtccct cgaaccccag atgacttcct gaacagtgtg1260 gatgagatgg atacaggtga tactatcaac caaagcaccc tgccctcaca gcagaaccgt1320 ttcccagact accttgaagc cattcctggg acaaatgtgg accttggaac actggaagga1380 gatggaatga acatagaagg agaggagctg atgccaagtc tgcaggaagc tttgagttct1440 gacatcctta atgacatgga gtctgttttg gctgccacca agctagataa agaaagcttt1500 cttacatggt tatag1515 <210>2 <211>504 <212>PRT <213>Artificial Sequence <400>2 Met Asp Pro Gly Gln Gln Pro Pro Pro Gln Pro Ala Pro Gln Gly Gln 151015 Gly Gln Pro Pro Ser Gln Pro Pro Gln Gly Gln Gly Pro Pro Ser Gly 202530 Pro Gly Gln Pro Ala Pro Ala Ala Thr Gln Ala Ala Pro Gln Ala Pro 354045 Pro Ala Gly His Gln Ile Val His Val Arg Gly Asp Ser Glu Thr Asp 505560 Leu Glu Ala Leu Phe Asn Ala Val Met Asn Pro Lys Thr Ala Asn Val 65707580 Pro Gln Thr Val Pro Met Arg Leu Arg Lys Leu Pro Asp Ser Phe Phe 859095 Lys Pro Pro Glu Pro Lys Ser His Ser Arg Gln Ala Ser Thr Asp Ala 100105110 Gly Thr Ala Gly Ala Leu Thr Pro Gln His Val Arg Ala His Ser Ser 115120125 Pro Ala Ser Leu Gln Leu Gly Ala Val Ser Pro Gly Thr Leu Thr Pro 130135140 Thr Gly Val Val Ser Gly Pro Ala Ala Thr Pro Thr Ala Gln His Leu 145150155160 Arg Gln Ser Ser Phe Glu Ile Pro Asp Asp Val Pro Leu Pro Ala Gly 165170175 Trp Glu Met Ala Lys Thr Ser Ser Gly Gln Arg Tyr Phe Leu Asn His 180185190 Ile Asp Gln Thr Thr Thr Trp Gln Asp Pro Arg Lys Ala Met Leu Ser 195200205 Gln Met Asn Val Thr Ser Pro Thr Ser Pro Pro Val Gln Gln Asn Met 210215220 Met Asn Ser Ala Ser Gly Pro Leu Pro Asp Gly Trp Glu Gln Ala Met 225230235240 Thr Gln Asp Gly Glu Ile Tyr Tyr Ile Asn His Lys Asn Lys Thr Thr 245250255 Ser Trp Leu Asp Pro Arg Leu Asp Pro Arg Phe Ala Met Asn Gln Arg 260265270 Ile Ser Gln Ser Ala Pro Val Lys Gln Pro Pro Pro Leu Ala Pro Gln 275280285 Ser Pro Gln Gly Gly Val Met Gly Gly Ser Asn Ser Asn Gln Gln Gln 290295300 Gln Met Arg Leu Gln Gln Leu Gln Met Glu Lys Glu Arg Leu Arg Leu 305310315320 Lys Gln Gln Glu Leu Leu Arg Gln Ala Met Arg Asn Ile Asn Pro Ser 325330335 Thr Ala Asn Ser Pro Lys Cys Gln Glu Leu Ala Leu Arg Ser Gln Leu 340345350 Pro Thr Leu Glu Gln Asp Gly Gly Thr Gln Asn Pro Val Ser Ser Pro 355360365 Gly Met Ser Gln Glu Leu Arg Thr Met Thr Thr Asn Ser Ser Asp Pro 370375380 Phe Leu Asn Ser Gly Thr Tyr His Ser Arg Asp Glu Ser Thr Asp Ser 385390395400 Gly Leu Ser Met Ser Ser Tyr Ser Val Pro Arg Thr Pro Asp Asp Phe 405410415 Leu Asn Ser Val Asp Glu Met Asp Thr Gly Asp Thr Ile Asn Gln Ser 420425430 Thr Leu Pro Ser Gln Gln Asn Arg Phe Pro Asp Tyr Leu Glu Ala Ile 435440445 Pro Gly Thr Asn Val Asp Leu Gly Thr Leu Glu Gly Asp Gly Met Asn 450455460 Ile Glu Gly Glu Glu Leu Met Pro Ser Leu Gln Glu Ala Leu Ser Ser 465470475480 Asp Ile Leu Asn Asp Met Glu Ser Val Leu Ala Ala Thr Lys Leu Asp 485490495 Lys Glu Ser Phe Leu Thr Trp Leu 500。

Claims

1. A YAP1 cetacean mutant protein, characterized in that The YAP1 cetacean mutant protein is specifically a human YAP1 protein carrying the cetacean mutation site A214S. Compared with the human YAP1 protein, the amino acid 214 position of the protein is mutated from alanine to serine, and its amino acid sequence is shown in SEQ ID NO:

2.

2. The gene encoding the YAP1 cetacean mutant protein according to claim 1, characterized in that: The nucleotide sequence of the YAP1 cetacean mutant protein is shown in SEQ ID NO:

1.

3. The recombinant plasmid pcDNA3.1-YAP1 plasmid is characterized by: The pcDNA3.1-YAP1 plasmid can transiently express the YAP1 cetacean mutant recombinant protein as claimed in claim 1 or 2 in cells.

4. The method for constructing the recombinant plasmid pcDNA3.1-YAP1 plasmid according to claim 3, characterized in that: Please follow the steps below to implement: Step 1. Human YAP1 gene primer design: According to the coding sequence of human YAP1 gene, 5'-3': ATGGATCCCGGGCAGCAGC was used as the upstream primer, and 5'-3': CTATAACCATGTAAGAAAGC was used as the downstream primer; Step 2, obtaining the human YAP1 gene cDNA sequence: using the upstream primer and the downstream primer mentioned above to perform PCR amplification to obtain a large amount of YAP1 gene coding sequence; Step 3. Design of primers for homology arms of human YAP1 gene cDNA sequence: According to the restriction site of pcDNA3.1, 5'-3': AAACGGGCCCTCTAGACATGGATCCCGGGCAGCAGC was used as the upstream primer, and 5'-3': TAACCATGTAAGAAAGCCTATAACCATGTAAGAAAGC was used as the downstream primer; Step 4, homologous recombination of the cDNA sequence of the human YAP1 gene and the pcDNA3.1 vector: according to the primer PCR in the above step 3, obtain the YAP1 gene sequence with homology arms, and use endonuclease to digest pcDNA3.1 to obtain a linearized pcDNA3.1 vector; then use a homologous recombination enzyme to connect the cDNA sequence of the human YAP1 gene and the pcDNA3.1 vector to obtain a connection product; transform the connection product into competent Escherichia coli, evenly spread it on an LB solid culture medium plate containing antibiotics, pick a single clone strain for identification, and obtain a pcDNA3.1-hYAP1 plasmid; Step 5, obtaining pcDNA3.1-YAP1 plasmid: design YAP1 cetacean mutation primers, 5'-3': CCAGATGAACGTCACATCCCCCACCAGTCCAC as the upstream primer, 5'-3': ATGTGACGTTCATCTGGGACAGCATGGCCTTCC as the downstream primer, use DNA polymerase and the upstream and downstream primers to mutate the plasmid in step 4 into pcDNA3.1-YAP1 plasmid.

5. The recombinant plasmid pLV-zsGreen-Puro-CMV-YAP1 plasmid is characterized by: The pLV-zsGreen-Puro-CMV-YAP1 plasmid can stably express the YAP1 cetacean mutant recombinant protein as claimed in claim 1 or 2 in cells.

6. The method for constructing the recombinant plasmid pLV-zsGreen-Puro-CMV-YAP1 plasmid according to claim 5, characterized in that: Please follow the steps below to implement: Step 1. Design of primers for homology arms of YAP1 gene cDNA sequence: According to the restriction site of pLV-zsGreen-Puro-CMV, 5'-3': TAGCGCTACCGGACTCAGATCTCGAGATGGATCCCGGGCAGCAGC was used as the upstream primer; 5′-3′: CCGCACGCGTGTCGACTGCAGAATTCCTATAACCATGTAAGAAAGC as downstream primer; Step 2. Obtaining the recombinant plasmid pLV-zsGreen-Puro-CMV-YAP1 plasmid: Obtain the YAP1 gene sequence with homology arms by primer PCR according to step 1, and use endonuclease to cut the pLV-zsGreen-Puro-CMV vector to obtain a linearized pLV-zsGreen-Puro-CMV vector; then use a homologous recombinase to connect the cDNA sequence of the YAP1 gene with the pLV-zsGreen-Puro-CMV vector to obtain a connection product; transform the connection product into competent Escherichia coli, evenly spread it on an LB solid culture medium plate containing antibiotics, pick a single clone strain for identification, and obtain the pLV-zsGreen-Puro-CMV-YAP1 plasmid.

7. The recombinant plasmid pLV-luci-YAP1 plasmid is characterized by: The pLV-luci-YAP1 plasmid can stably express the YAP1 cetacean mutant recombinant protein as claimed in claim 1 or 2 in cells.

8. The method for constructing the recombinant plasmid pLV-luci-YAP1 plasmid according to claim 7, characterized in that: Please follow the steps below to implement: Step 1. Design of primers for homology arms of YAP1 gene cDNA sequence: According to the restriction site of pLV-luci, 5'-3': TCTAGAAACTGTACAAGGAATTCATGGATCCCGGGCAGCAGC was used as the upstream primer; 5′-3′: TCCGGGCCCGGGTTCGAACTCGAGCTATAACCATGTAAGAAAGC as downstream primer; Step 2, obtaining the recombinant plasmid pLV-luci-YAP1 plasmid: according to the primer PCR in step 1, obtain the YAP1 gene sequence with homology arms, and use endonuclease to cut the pLV-luci vector to obtain a linearized pLV-luci vector; then use a homologous recombinase to connect the cDNA sequence of the YAP1 gene with the pLV-luci vector to obtain a connection product; transform the connection product into competent Escherichia coli, evenly spread it on an LB solid culture medium plate containing antibiotics, pick a single clone strain for identification, and obtain the pLV-luci-YAP1 plasmid.

9. A recombinant CT26 cell line expressing a YAP1 cetacean mutant protein, characterized in that: The plasmid described in claim 3, 5 or 7 is transfected into CT26 colorectal cancer cells, and then puromycin is used with a screening concentration of 2ug to identify and screen the recombinant CT26 cell line, wherein the recombinant CT26 cell line can stably express the YAP1 cetacean mutant recombinant protein.

10. Use of the YAP1 cetacean mutant protein according to claim 1 or 2 in the field of inhibiting cancer.

Images