Bacillus subtilis, polluted water body remediation agent and application of polluted water body remediation agent

Abstract

The invention relates to bacillus subtilis, a polluted water body remediation agent and application thereof, and belongs to the technical field of microorganisms for sewage treatment. The technical problem to be solved by the invention is to provide bacillus subtilis with strong adaptability, high activity and good pollution control effect. The bacillus subtilis QHCD001 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation date is May 24, 2024, the preservation number is CGMCC NO.30754, and the preservation address is Institute of Microbiology, Chinese Academy of Sciences, No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The bacillus subtilis QHCD001 has a Latin name of Bacillus subtilis, and is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation date is May 24, 2024, the preservation number is CGMCC NO.30754, and the preservation address is Institute of Microbiology, Chinese Academy of Sciences. The bacillus subtilis QHCD001 disclosed by the invention is applied to laboratory simulated sewage purification and also has a better treatment effect than other similar strains, and the treatment time is shorter, the pollution index digestion is lower, and the treatment effect stability is stronger. Meanwhile, the strain is good in preservation stability, and the survival rate after freeze-drying preservation for one year is still higher than 97%; the culture propagation speed is high, and the CFU (colony-forming unit) of a culture solution at 37 DEG C for 16 hours can reach 1010 pieces / mL.

Description

Technical Field

[0001] The invention relates to bacillus subtilis, a polluted water body repair agent and application thereof, and belongs to the technical field of microorganisms for sewage treatment. Background Art

[0002] In recent years, with the continuous acceleration of urbanization, the scale of cities has been expanding, the population density has been increasing, and the amount of municipal wastewater and low-pollution water has been increasing. There is an urgent need for water pollution control methods.

[0003] Microorganisms play a very important role as decomposers in water bodies, thus participating in the material cycle, energy cycle and information transmission network of water bodies. Microorganisms can degrade and transform pollutants such as organic matter, heavy metals, toxic and harmful substances through metabolism. Organic matter can be decomposed into harmless substances such as water, carbon dioxide and small molecules; heavy metals can be converted into a stable state, or separated from water bodies by absorption, adsorption and flocculation by microorganisms to reduce harm to the environment; toxic and harmful substances can be decomposed into non-toxic or low-toxic substances. Microorganisms are of various types and widely distributed, reproduce rapidly and in large numbers, have simple structures and are easy to mutate, so they have a very strong ability to adapt to the environment, and are gradually attracting people's attention in the prevention and control of water pollution.

[0004] In the process of using microorganisms to treat water pollution, species such as Bacillus, nitrifying bacteria, yeast, and Pseudomonas are used more frequently. However, it is not easy for these species to survive and reproduce in nature to form dominant populations. The effects of different species in the same water body or the same species in different water bodies are very unstable, and the strains are easily inactivated after preservation. Therefore, it is necessary to select strains with strong adaptability, high vitality, and good pollution control effects. Summary of the invention

[0005] In view of the above defects, the technical problem solved by the present invention is to provide a Bacillus subtilis with strong adaptability, high activity and good pollution control effect.

[0006] The Bacillus subtilis QHCD001 of the present invention, Latin name: Bacillus subtilis, is deposited in the General Microbiology Center (CGMCC) of the China Microorganism Culture Collection Administration, the deposit date is May 24, 2024, the deposit number is CGMCC NO.30754, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] The second technical problem solved by the present invention is to provide a polluted water body repair agent.

[0008] The polluted water body repairing agent of the present invention contains the above-mentioned Bacillus subtilis or its fermented culture.

[0009] In one embodiment of the present invention, the polluted water body remediation agent is a liquid bacterial agent or a solid bacterial agent.

[0010] The present invention also provides the use of the Bacillus subtilis QHCD001 or the polluted water body repair agent of the present invention in polluted water body treatment and ecological restoration.

[0011] The Bacillus subtilis QHCD001 of the present invention can be used for the treatment of polluted water bodies.

[0012] In one embodiment of the present invention, the polluted water treatment is to reduce the ammonia nitrogen and nitrite content in the water.

[0013] In one embodiment of the present invention, the concentration of Bacillus subtilis QHCD001 in the polluted water is ensured to be 1×10 7 CFU / ml and above.

[0014] The Bacillus subtilis QHCD001 of the present invention can also be used in ecological restoration. The Bacillus subtilis QHCD001 of the present invention can be put into polluted water to effectively reduce the COD, ammonia nitrogen and nitrite content in the water, and the bacteria attach to solid objects (such as stones, river walls, aquatic plants, etc.) to form a micro-ecological system.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The Bacillus subtilis QHCD001 of the present invention has achieved better treatment effects than other similar strains in the purification of laboratory simulated sewage, which is manifested in shorter treatment time, lower pollution index elimination, and stronger treatment effect stability. At the same time, the strain has good storage stability, and the survival rate of freeze-dried storage for one year is still higher than 97%; the culture and reproduction speed is fast, and the CFU of the culture solution at 37°C for 16 hours can reach 10 10 Pieces / mL. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a colony diagram of Bacillus subtilis QHCD001 of the present invention.

[0017] Figure 2 This is a microscopic image of the Bacillus subtilis QHCD001 of the present invention. DETAILED DESCRIPTION

[0018] The Bacillus subtilis QHCD001 of the present invention, Latin name: Bacillus subtilis, is deposited in the General Microbiology Center (CGMCC) of the China Microorganism Culture Collection Administration, the deposit date is May 24, 2024, the deposit number is CGMCC NO.30754, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0019] The Bacillus subtilis QHCD001 of the present invention is isolated and screened from water samples of polluted rivers and lakes. The protease activity and amylase activity of the strain are very high in laboratory tests. It is applied to the purification of laboratory simulated sewage and has achieved better treatment effects than other similar strains, which are manifested in shorter treatment time, lower pollution index elimination, and stronger treatment effect stability. At the same time, the strain has good storage stability, and the survival rate of freeze-dried storage for one year is still higher than 97%; the culture and reproduction speed is fast, and the CFU of the culture solution at 37°C for 16 hours can reach 10 10 Pieces / mL.

[0020] The 16s rDNA gene sequence of Bacillus subtilis QHCD001 of the present invention is shown in SEQ ID No.1.

[0021] The second technical problem solved by the present invention is to provide a polluted water body repair agent.

[0022] The polluted water body repairing agent of the present invention contains the above-mentioned Bacillus subtilis or its fermented culture.

[0023] In one embodiment of the present invention, the polluted water body remediation agent is a liquid bacterial agent or a solid bacterial agent.

[0024] In one embodiment of the present invention, the polluted water body repair agent further includes an auxiliary material, and the auxiliary material is at least one of corn starch, maltodextrin, corn cob powder, wheat bran powder and bagasse powder.

[0025] The present invention also provides the use of the Bacillus subtilis QHCD001 or the polluted water body repair agent of the present invention in polluted water body treatment and ecological restoration.

[0026] The Bacillus subtilis QHCD001 of the present invention can be used for the treatment of polluted water bodies.

[0027] In one embodiment of the present invention, the polluted water treatment is to reduce the ammonia nitrogen and nitrite content in the water.

[0028] The Bacillus subtilis QHCD001 of the present invention can be directly put into the polluted water body, or it can be prepared into a preparation together with various auxiliary materials and put into the polluted water body. In one embodiment of the present invention, the concentration of Bacillus subtilis QHCD001 in the polluted water body is ensured to be 1×10 7 CFU / ml and above.

[0029] The Bacillus subtilis QHCD001 of the present invention can also be used in ecological restoration. The Bacillus subtilis QHCD001 of the present invention can be put into polluted water to effectively reduce the COD, ammonia nitrogen and nitrite content in the water, and the bacteria attach to solid objects (such as stones, river walls, aquatic plants, etc.) to form a micro-ecological system.

[0030] The specific implementation modes of the present invention are further described below in conjunction with embodiments, but the present invention is not limited to the scope of the embodiments.

[0031] Example 1 Isolation, screening and identification of Bacillus subtilis QHCD001 1. Isolation and screening of Bacillus subtilis QHCD001 Take the algae root zone sediment sample from the 15cm depth of the dense black algae in the shallow area of ​​Yueyang River in Anyue County, Sichuan Province, weigh 5g of the sediment and inject it into a 200mL triangular flask containing 95mL of sterilized enrichment medium, and mix it thoroughly. Take 10mL of the mixture into a sterilized 18×180mm test tube with a stopper, pasteurize it in a water bath at 80℃ for 15min, take it out and cool it, and then dilute it in a gradient under sterile conditions.

[0032] Take 1 mL of pasteurized solution and make gradient dilutions. -2 , 10 -3 , 10 -4 Pipette 0.5 mL of the dilution onto the surface of the LB plate, spread it with sterilized glass beads, and then culture it in a constant temperature incubator at 37°C for about 24 h.

[0033] When white wrinkled colonies appear on the plate, select single colonies with sparse colonies and no pollution for Gram staining. For colonies that meet the morphological characteristics of Bacillus subtilis, LB plate streaking purification is performed, and streaking is repeated more than 3 times. After at least three single colony selections, it can be determined that the strain has been purified. The purified strain is preserved in glycerol, and physiological, biochemical and molecular biological identifications are performed simultaneously. After confirming that the isolated and purified colonies are the target strains, freeze-dried powder is prepared and preserved. The freeze-dried protective agent formula is selected as: 8% sucrose, 6% milk powder, 1% maltodextrin, and 0.05% ascorbic acid.

[0034] A strain of Bacillus subtilis was screened by this method and named QHCD001. It was deposited in the General Microbiology Center of China Microbiological Culture Collection (CGMCC) with the deposit number CGMCC NO.30754 and the deposit date May 24, 2024. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. 。

[0035] 2. Identification of Bacillus subtilis (1) Morphological identification: Through culture observation, the colonies of this strain are irregular, with uneven edges, off-white, and spread flat on the culture agar. The center is convex, the surface is relatively dry, dull, and the edges are opaque. For details, see Figure 1The strain was positive for Gram staining microscopy, with rod-shaped cells, spores, elliptical spores, mesogenic or submesogenic, and spore capsules that were not obviously swollen. Figure 2 .

[0036] (2) Molecular biological identification: PCR amplification was performed on the 16S rDNA of the strain, and the primers used for amplification were upstream primer 27F and downstream primer 1492R, wherein the sequence of 27F was AGAGTTTGATCCTGGCTCAG, as shown in SEQ ID No.2; the sequence of 1492R was ACGGCTACCTTGTTACGACTT, as shown in SEQ ID No.3. The amplified product was recovered and sequenced to obtain the 16s rDNA gene sequence of the strain, as shown in SEQ ID No.1.

[0037] The sequence was compared with the sequences registered in the GenBank database for homology. The 16S rDNA sequence of this strain was 100% homologous to that of Bacillus subtilis.

[0038] The strain QHCD001 was fermented and cultured in the culture medium: 1.5 g / L malt extract powder, 5 g / L glucose, 5 g / L soybean meal powder, 10 g / L soybean powder, 0.5 g / L manganese sulfate, 1.5 g / L magnesium sulfate, 1.5 g / L potassium dihydrogen phosphate, pH 7.2. Culture was carried out in a 300 L fermenter with a filling ratio of 60%, 37°C, aeration of 40 L / min, stirring at 300 rpm, and fermentation time of 48 h.

[0039] The number of strains at different times was determined, and the results are shown in Table 1.

[0040] Table 1 Unit: CFU / ml The strain QHCD001 was spray dried and stored, and its stability was determined. The results are shown in Table 2.

[0041] Table 2 Unit: CFU / ml The protease activity of the Bacillus subtilis QHCD001 strain was determined using the Folin method, and the amylase activity was determined using the α-amylase activity determination method according to GB / T9826-88 "Determination of damaged starch in wheat flour - α-amylase method". The results are shown in Table 3.

[0042] Table 3 Among them, strain A is another Bacillus subtilis isolated and selected according to the method of Example 1 of the present invention, and strain B is a Bacillus subtilis isolated and selected from the rhizosphere of aquatic plants in Gaopan River, Wuhou District, Chengdu according to the method of Example 1 of the present invention.

[0043] Example 2: Wastewater Purification by Bacillus subtilis QHCD001 A 5 L cylindrical glass cylinder with a diameter of 20 cm was used, filled with 3 L of simulated wastewater, and the suspension of Bacillus subtilis QHCD001 was added to the cylinder to ensure that the concentration of Bacillus subtilis QHCD001 in the cylinder was 1×10 7 CFU / mL, cultured at room temperature of 25-30℃ for 21 days, starting from the addition of bacterial suspension (0 h), sampling was performed once at intervals to determine the concentrations of ammonia nitrogen, nitrite and COD. The results are shown in Table 4. Ammonia nitrogen was determined by Nessler's reagent colorimetric method, nitrite was determined by α-naphthylamine colorimetric method, and COD was determined by dichromate method HJ 828-2017.

[0044] Table 4 It can be seen that the strain of the present invention can better digest wastewater and reduce the concentration of ammonia nitrogen and nitrite and COD content in the wastewater.

[0045] Example 3 Application of Bacillus subtilis QHCD001 in ecological restoration The porous materials such as volcanic rocks were used as carriers to attach QHCD001 bacteria for testing, as follows: The high temperature sintered porous stone material - "bacteria house" is used, and QHCD001 bacterial suspension 2.35×10 10 CFU / ml was soaked and attached to obtain the immobilized bacteria-carrying stone, which was used as the bacteria-carrying stone group. The strain A was soaked and attached to obtain the immobilized bacteria-carrying stone, which was used as the positive control group.

[0046] In a 20cm diameter cylindrical glass tank, 4L of simulated wastewater was placed inside. Two bacteria-carrying stones (2.5×2.5×9.5cm) were placed in the tank, and 500g of water grass (hydrilla) and three 3~4cm zebrafish were placed in the glass fiber reinforced plastic. A porous stone without bacteria was placed as a blank control CK. The cells were cultured at room temperature of 24-28℃, and samples were taken once a day to determine the concentrations of ammonia nitrogen, nitrite and COD. The results are shown in Table 5. The determination of ammonia nitrogen was carried out by Nessler's reagent colorimetry, and the determination of nitrite was carried out by α-naphthylamine colorimetry.

[0047] Table 5 It can be seen that the strain of the present invention can attach to solid objects to form a micro-ecosystem, which can be used in ecological restoration to better reduce the concentrations of COD, ammonia nitrogen and nitrite in wastewater.

Claims

1. Bacillus subtilis QHCD001, characterized in that: It is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC), the deposit date is May 24, 2024, and the deposit number is CGMCC NO.30754.

2. A contaminated water restoration agent containing the Bacillus subtilis according to claim 1.

3. The polluted water restoration agent according to claim 2, characterized in that: The polluted water body repair agent is a liquid bacterial agent or a solid bacterial agent.

4. Use of the Bacillus subtilis QHCD001 described in claim 1 or the polluted water body repair agent described in claim 2 or 3 in the treatment of polluted water bodies.

5. The use according to claim 4, characterized in that: Bacillus subtilis QHCD001 is added to polluted water bodies to reduce the COD, ammonia nitrogen and nitrite contents in the polluted water bodies.

6. The use according to claim 5, characterized in that: The concentration of Bacillus subtilis QHCD001 in polluted water was controlled to be 1×10 7 CFU / mL and above.

7. Use of the Bacillus subtilis QHCD001 according to claim 1 or the polluted water restoration agent according to claim 2 or 3 in ecological restoration.

Images