RPA (recombinase polymerase amplification) isothermal amplification freeze-dried microspheres for detecting campylobacter jejuni, micro-fluidic chip sensor and application of RPA isothermal amplification freeze-dried microspheres and micro-fluidic chip sensor

Abstract

The invention provides an RPA (recombinase polymerase amplification) isothermal amplification freeze-dried microsphere for detecting campylobacter jejuni, a micro-fluidic chip sensor and application of the RPA isothermal amplification freeze-dried microsphere. According to the RPA isothermal amplification freeze-dried microsphere, an RPA isothermal amplification reagent for detecting campylobacter jejuni is prepared into the freeze-dried microsphere through a freeze-drying process, and a matched micro-fluidic chip and a sensor detector are designed; based on the micro-fluidic chip and the sensor detector, campylobacter jejuni can be rapidly detected on site, accurate quantification is achieved, and the method for detecting campylobacter jejuni has the advantages of being convenient, rapid and capable of saving cost and is particularly suitable for rapid detection of campylobacter jejuni in livestock and poultry meat.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an RPA isothermal amplification freeze-dried microsphere for detecting Campylobacter jejuni, a microfluidic chip sensor and applications thereof. Background Art

[0002] Campylobacter jejuni is an important foodborne pathogen that is widely found in animal intestines, water sources, soil and other environments. Poultry, livestock and other animals are its main storage hosts, especially chickens, ducks, geese, cattle and other poultry. In addition, Campylobacter jejuni can also be found in wild animals, pets and other animals. Campylobacter jejuni is mainly transmitted through food and water. Contaminated food, such as undercooked chicken, beef, milk, etc., is the main source of Campylobacter jejuni infection in humans. Drinking contaminated water may also lead to infection.

[0003] In addition, there is also a risk of infection from contact with infected animals and their excrement. In recent years, the incidence of Campylobacter jejuni infection has continued to rise, posing a serious threat to human health.

[0004] Infection with Campylobacter jejuni often causes acute enteritis, which manifests as abdominal pain, diarrhea, fever, nausea, vomiting and other symptoms. Severe cases may cause complications such as blood in the stool, dehydration, and electrolyte imbalance. Campylobacter jejuni enteritis is usually self-limiting, but for people with low immunity, such as infants, the elderly, and pregnant women, the condition may be more serious and even life-threatening.

[0005] In addition, some studies have shown that Campylobacter jejuni infection may be associated with the occurrence of neurological diseases such as Guillain-Barré syndrome (GBS). GBS is an acute immune-mediated peripheral neuropathy that can lead to serious consequences such as limb paralysis and respiratory muscle paralysis. In addition, Campylobacter jejuni infection may also cause reactive arthritis, myocarditis and other diseases.

[0006] Currently, the main detection methods for Campylobacter jejuni include traditional culture method, enzyme-linked immunosorbent assay, and fluorescent quantitative PCR method.

[0007] The traditional culture method is to inoculate the sample on a specific culture medium, culture it under microaerobic conditions, and identify it based on colony morphology, biochemical characteristics, etc. The advantages of this method are mainly the following two aspects: First, this method is currently the gold standard for detecting Campylobacter jejuni, and the results are accurate and reliable. Second, pure culture can be isolated for further research and analysis. The disadvantages are also obvious: the culture cycle is long, usually taking 3-5 days, and cannot meet the needs of rapid testing. Moreover, the operation is cumbersome and requires professional technicians and equipment. At the same time, the pre-treatment requirements of the sample are high, and false negative results are prone to occur.

[0008] The immunological method is mainly enzyme-linked immunosorbent assay (ELISA), which uses the specific binding of antigen and antibody to detect Campylobacter jejuni antigen or antibody in the sample through enzyme-labeled antibody. Its advantages are simple and fast operation, and results can be obtained within a few hours. A large number of samples can be tested at the same time, which is suitable for large-scale screening. The cost is low. The disadvantage is that there may be false positive or false negative results, and the sensitivity and specificity are relatively low. A dedicated microplate reader is required and the quality requirements of the antibody are high. The performance of the kits from different manufacturers varies greatly.

[0009] The most widely used molecular biological method is real-time fluorescence quantitative PCR, which is based on adding fluorescent probes to the PCR reaction system, monitoring the PCR reaction process in real time, and quantitatively detecting Campylobacter jejuni through changes in fluorescent signals. The advantages of this method are high sensitivity and strong specificity, and it can quantitatively detect the number of Campylobacter jejuni. The detection speed is fast, and the results are accurate and reliable. Multiple samples can be detected at the same time to improve the detection efficiency. The disadvantage is that it requires professional equipment and reagents, which are expensive and have high technical requirements for operators. It is easy to be contaminated, affecting the accuracy of the test results.

[0010] Campylobacter jejuni, as an important foodborne pathogen, poses a serious threat to human health. Understanding its biological characteristics, pathogenic hazards, and the advantages and disadvantages of existing detection methods is of great significance for the prevention and control of Campylobacter jejuni infection. Although the traditional culture method is the gold standard for detecting Campylobacter jejuni, it has disadvantages such as long culture cycle and cumbersome operation. Immunological methods and molecular biology methods have the advantages of rapidity and sensitivity, but they also have certain limitations. Therefore, in practical work, there is an urgent need for a rapid detection method for Campylobacter jejuni that is simple to operate, has a short detection time, and can be used on-site. Summary of the invention

[0011] In view of the shortcomings of the prior art, the object of the present invention is to provide a RPA isothermal amplification freeze-dried microsphere, a microfluidic chip sensor and its application for detecting Campylobacter jejuni. The RPA isothermal amplification freeze-dried microsphere of the present invention can be quickly dissolved in a microfluidic chip and undergo RPA isothermal amplification, which can achieve rapid and highly sensitive detection of Campylobacter jejuni. The microfluidic chip sensor is easy to use, does not require expensive large-scale detection equipment, has a simple sample pretreatment process, has low requirements on the ability of detection personnel, has the advantages of fast, simple and low cost detection, and is suitable for on-site detection of large quantities of samples in grassroots laboratories.

[0012] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0013] In a first aspect, the present invention provides an RPA isothermal amplification freeze-dried microsphere for detecting Campylobacter jejuni, wherein the freeze-dried microsphere is prepared by a freeze-drying process using an RPA isothermal amplification reagent for detecting Campylobacter jejuni;

[0014] The RPA isothermal amplification reagent comprises: an isothermal amplification enzyme, an upstream primer, a downstream primer, a fluorescent probe, DNTP, MgCl, mannitol and BSA;

[0015] The upstream primer includes that shown in SEQ ID NO: 1;

[0016] CTATGACGCTTAACTGGTCTGAGAGGATGATC.

[0017] The downstream primer includes that shown in SEQ ID NO: 2;

[0018] TGACACTTTTCGGAGCGTAAACTCCTTTTCTTA.

[0019] The structure of the fluorescent probe is as follows: GGTCCAGACTCCTACGGGAGGCAGC-FAM-THF-C-BHQ1-AGTAGGGAATATTGC-spacer C3.

[0020] GGTCCAGACTCCTACGGGAGGCAGC (SEQ ID NO: 3).

[0021] AGTAGGGAATATTGC (SEQ ID NO: 4)

[0022] In the present invention, recombinase polymerase amplification (RPA) is a novel isothermal nucleic acid amplification technology that can achieve rapid detection of the target within 10-30 minutes at 37-42°C. The advantages of RPA isothermal amplification enzyme include:

[0023] First, fast and efficient: RPA technology can obtain detectable levels of amplification products within 10-30 minutes, and the amplification efficiency is high. Second, no expensive supporting instruments and equipment are required: RPA reactions are carried out under constant temperature conditions, no thermal cycler is required, and the equipment requirements are low. Third, high sample tolerance: suitable for amplification detection of complex samples, such as blood or nasal swabs that have not been purified by nucleic acid. Fourth, the detection methods are diversified: including electrophoresis detection, fluorescent probe detection, lateral flow chromatography test strip detection, etc.

[0024] In the present invention, the nucleic acid sequence of the probe primer is relatively more, and the specificity is stronger. The probe is added with 4 modifications, namely, a fluorescent group, a THF modification, a quenching group and a 3' end blocking group. The enzyme will specifically recognize the THF (tetrahydrofuran: a nucleotide analog without bases, which can be added when synthesizing the probe) site, and cut THF. After the cutting probe is broken, the distance between the fluorescent group (FAM) and the quenching group (BHQ1) becomes farther, the quenching effect is weakened, and the fluorescent group emits fluorescence, and then the change of the fluorescence value is monitored in real time by the detection instrument. The 3' end of the fluorescent probe is protected to prevent subsequent unnecessary disordered amplification, and a reaction can be terminated in time. Conventional probes generally mark the fluorescent group at the 5' end of the nucleic acid sequence, and then mark the quenching group at the 3' end of the nucleic acid sequence, and do not need to be protected at the 3' end, but this probe primer needs to be at a higher repeated temperature to amplify the product and release a signal. It is sensitive to temperature changes, the required detection time is relatively long, and the requirements for instruments and equipment are relatively high.

[0025] Preferably, the RPA isothermal amplification reagent for detecting Campylobacter jejuni comprises, by concentration, isothermal amplification enzyme 0.3-3U, upstream primer 0.1-1μM, downstream primer 0.1-1μM, fluorescent probe 0.1-1μM, DNTP 0.05-1μM, MgCl 0.5-5mM, mannitol 0.01-1% and BSA 0.05-1%.

[0026] Among them, the isothermal amplification enzyme 0.3-3U can be, for example, 0.3U, 0.5U, 1U, 1.5U, 2U, 2.5U or 3U; the primer 0.1-1μM can be, for example, 0.1μM, 0.3μM, 0.5μM, 0.7μM, 0.9μM or 1μM; the fluorescent probe 0.1-1μM can be, for example, 0.1μM, 0.3μM, 0.5μM, 0.7μM, 0.9μM or 1μM; the DNTP 0.05-1μM can be, for example, 0.05μM, 0.1μM, 0.3μM, 0.5μM, 0.7μM, 0.9μM or 1μM; the MgCl 0.5-5mM can be, for example, 0.5mM, 1mM, 2mM, 3mM, 4mM, 5mM, etc.; mannitol 0.01-1% can be, for example, 0.01%, 0.05%, 0.1%, 0.2%, 0.4%, 0.5%, 0.6%, 0.8% or 1%, etc.; BSA 0.05-1% can be, for example, 0.05%, 0.1%, 0.2%, 0.4%, 0.5%, 0.6%, 0.8% or 1%, etc.

[0027] In the present invention, enzymes, primers, and primer probes are core components in the freeze-dried microspheres. It is necessary to consider that their concentrations should be appropriately excessive without increasing costs. DNTP provides a source of raw materials for nucleic acid sequence amplification, which is generally excessive to ensure that the reaction can be completely completed. Mg ions provide ion concentrations to regulate the activity of the enzyme. Mannitol, as a freeze-dried excipient, is beneficial to the final status of the microspheres and protects the structure of the enzyme. BSA is a protective protein. In the present invention, the concentration is generally 0.1-0.5%. Too high a concentration is not conducive to the subsequent reaction. Too low a concentration cannot protect the activity of the enzyme.

[0028] Preferably, the freeze-drying process is: mix the RPA isothermal amplification reagent for detecting Campylobacter jejuni, centrifuge to remove bubbles, use a continuous micropipette to draw 18-22 μL each time (for example, it can be 18 μL, 19 μL, 20 μL, 21 μL or 22 μL, etc.), drop it into liquid nitrogen and quickly freeze it into microspheres, and then put it into a freeze dryer for vacuum drying.

[0029] In the present invention, each freeze-dried microsphere contains all reagents required for one amplification (except the DNA template of the bacteria to be detected). When the customer uses it later, he only needs to extract the DNA of the sample once and add it directly into the microwell and dissolve the microsphere components to react. It is convenient for the customer's subsequent operation, and the freeze-dried microspheres are also convenient for later production, packaging and storage.

[0030] In the present invention, the particle size of the above-mentioned freeze-dried microspheres is 1.67±0.03mm. The above-mentioned one microsphere and 20-25μL of the reaction to be detected can realize isothermal amplification reaction. The above-mentioned freeze-dried microspheres reduce the detection system, but will not affect the final detection effect. The above-mentioned freeze-dried microspheres combined with the microfluidic chip can realize efficient and trace RPA amplification detection, which has important application value in the detection of Campylobacter jejuni.

[0031] In a second aspect, the present invention provides a microfluidic chip based on RPA amplification, the microfluidic chip comprising: a freeze-dried microsphere storage area 1 and a detection reaction area 2;

[0032] The freeze-dried microsphere storage area 1 includes a sealing cover 1.1 and a freeze-dried microsphere storage area 1.2;

[0033] The freeze-dried microsphere storage area 1.2 is cylindrical and is used to store freeze-dried microspheres of RPA isothermal amplification reagents; the sealing cover 1.1 is sealed and connected to the freeze-dried microsphere storage area 1.2;

[0034] The detection reaction area 2 includes a microfluidic double-hole channel and an RPA amplification reaction area 2.2;

[0035] The detection reaction area 2 is flat with a point, and the microfluidic double-hole channel is used for the amplification reaction liquid to flow to the RPA amplification reaction area 2.2; the RPA amplification reaction area 2.2 is used to provide a place for the reaction to occur;

[0036] The microfluidic double-hole channel includes channel one 2.11 and channel two 2.12, and the channel one 2.11 and channel two 2.12 are designed in a V shape, the opening part of the V shape is connected to the lower part of the freeze-dried microsphere storage area 1.2, and the cross part of the V shape is connected to the RPA amplification reaction area 2.2.

[0037] In the present invention, when designing the microfluidic chip, a V-shaped microfluidic double-hole channel design is adopted, which is more conducive to the liquid entering the reaction chamber, ensuring that small bubbles are not formed in the reaction chamber, and ensuring the reliability and accuracy of the subsequent detection results.

[0038] Preferably, the freeze-dried microsphere storage area 1.2, the microfluidic double-hole channel, and the RPA amplification reaction area 2.2 are made of polymethyl methacrylate.

[0039] In the present invention, when selecting the material, it is necessary to ensure that the material of the RPA amplification reaction area 2.2 has the characteristics of heat resistance, light transmittance and high temperature resistance, and also to ensure the smoothness of the microfluidic double-hole channel. The smoother the channel, the more conducive it is to the flow of liquid, so that the reaction liquid can completely enter the RPA amplification reaction area 2.2, so that the test results of each batch are comparable, ensuring the accuracy of the results.

[0040] The present invention uses polymethyl methacrylate (PMMA) with good light transmittance, high stability and good heat resistance as a material to prepare a microfluidic chip. The material with good light transmittance is conducive to the subsequent detection of the RPA amplification reaction area, and the result is more realistic, which can avoid the misjudgment of the detection result of the low-content sample. At the same time, the channel prepared by the above material is also conducive to the downward flow of liquid.

[0041] Preferably, the sealing cover 1.1 and the freeze-dried microsphere storage area 1.2 are connected by threaded sealing.

[0042] The top of the microfluidic chip of the present invention is threaded and can be sealed with a matching threaded cap. The prepared freeze-dried microspheres are placed in the microfluidic chip sensor, and the threaded cap is opened before use to add the extract, thereby realizing rapid detection.

[0043] Preferably, the pore size of the channel 1 2.11 and the channel 2 2.12 is 45-55 μm, for example, it can be 45 μm, 47 μm, 49 μm, 50 μm, 51 μm, 53 μm or 55 μm.

[0044] In the present invention, if the apertures of channel 1 2.11 and channel 2 2.12 are too large, the incompletely dissolved freeze-dried microspheres will flow into the reaction chamber, resulting in inconsistent concentrations of the reaction solution and affecting the results; if the apertures are too small, it will be difficult to throw the liquid into the reaction chamber, also affecting the accuracy of the test results.

[0045] Preferably, the volume of the RPA amplification reaction zone 2.2 is 20-25 μL, for example, it can be 20 μL, 21 μL, 22 μL, 23 μL, 24 μL or 25 μL.

[0046] In the present invention, the reaction area volume of the microfluidic chip should not be too large. A smaller reaction volume can reduce the reaction time. RPA isothermal amplification is usually completed in about 15 minutes, while a larger volume requires longer time, which affects the reaction efficiency and makes it impossible to quickly complete the detection. At the same time, affected by the activity and stability of the enzyme, the RPA enzyme needs to be under specific temperature and volume conditions to achieve the best effect. Usually, the optimal reaction temperature of RPA is around 37°C. A smaller volume helps maintain this temperature and ensure the activity of the enzyme. A smaller volume helps to improve sensitivity and facilitate subsequent operations.

[0047] As a preferred embodiment of the present invention, the present invention provides a microfluidic chip for detecting Campylobacter jejuni based on RPA amplification, wherein the microfluidic chip comprises: a freeze-dried microsphere storage area 1 and a detection reaction area 2;

[0048] The freeze-dried microsphere storage area 1 includes a sealing cover 1.1 and a freeze-dried microsphere storage area 1.2;

[0049] The freeze-dried microsphere storage area 1.2 is cylindrical and is used to store the freeze-dried microspheres of the RPA isothermal amplification reagent described in the first aspect; the sealing cover 1.1 is sealed and connected to the freeze-dried microsphere storage area 1.2;

[0050] The detection reaction area 2 includes a microfluidic double-hole channel and an RPA amplification reaction area 2.2;

[0051] The detection reaction area 2 is flat with a point, and the microfluidic double-hole channel is used for the amplification reaction liquid to flow to the RPA amplification reaction area 2.2; the RPA amplification reaction area 2.2 is used to provide a place for the reaction to occur;

[0052] The microfluidic double-hole channel includes channel one 2.11 and channel two 2.12, and the channel one 2.11 and channel two 2.12 are designed in a V shape, the opening part of the V shape is connected to the lower part of the freeze-dried microsphere storage area 1.2, and the cross part of the V shape is connected to the RPA amplification reaction area 2.2.

[0053] Preferably, the freeze-dried microsphere storage area 1.2, the microfluidic double-hole channel, and the RPA amplification reaction area 2.2 are made of polymethyl methacrylate.

[0054] Preferably, the sealing cover 1.1 and the freeze-dried microsphere storage area 1.2 are connected by threaded sealing.

[0055] Preferably, the pore diameters of the channel 1 2.11 and the channel 2 2.12 are 45-55 μm.

[0056] Preferably, the volume of the RPA amplification reaction zone 2.2 is 20-25 μL.

[0057] In a third aspect, the present invention provides a microfluidic chip sensor based on RPA amplification, wherein the sensor comprises the microfluidic chip based on RPA amplification described in the second aspect, and a sensor detector;

[0058] The sensor detector comprises: an incident light unit, a detection channel unit, a fluorescence detection unit, a signal processing unit and a result output unit;

[0059] The detection channel unit comprises a detection channel and a channel indicator light which are arranged in sequence, and a touch-type timer switch is also arranged in the detection channel;

[0060] The structure of the detection channel is adapted to the detection reaction area 2 of the microfluidic chip. After the detection reaction area 2 is inserted into the detection channel, the touch timer switch is turned on and the channel indicator light is on.

[0061] In the present invention, the incident light unit is used to perform light treatment on the microfluidic chip; and the fluorescence detection unit is used to detect the amplification reaction in the microfluidic chip.

[0062] In the present invention, the detection reaction area 2 of the microfluidic chip generates fluorescence during the reaction process, and the incident light unit and the fluorescence detection unit detect the fluorescence signal thereof, so that the concentration change of the amplification product can be monitored in real time.

[0063] In a preferred embodiment of the present invention, the FAM fluorescent substance in the detection reaction area 2 of the microfluidic chip is used as a marker to achieve high-sensitivity detection by exciting and receiving fluorescent signals of a specific wavelength.

[0064] Preferably, after the touch timer switch is turned on, the fluorescence detection unit collects the fluorescence signal every 25-30 seconds.

[0065] In the present invention, the sensor detector is designed with at least 4 detection channels, and a touch timer switch is set inside each channel, which can be used for independent timing. When the microfluidic chip is inserted into the detector, the timing will start automatically. The microfluidic chip will generate fluorescence during the reaction process. The fluorescence detection unit of the sensor detector collects the fluorescence signal every 25-30 seconds, so that the concentration change of the amplification product can be monitored in real time.

[0066] Preferably, the signal processing unit compares the collected fluorescence signal with a set threshold value. During the entire detection process, if the fluorescence signal exceeds the set threshold value and presents a typical amplification curve morphology, the sample is judged to be positive; if the fluorescence signal is always lower than the threshold value and no obvious amplification curve appears, the sample is judged to be negative.

[0067] During the detection process of the present invention, if the fluorescence signal growth curve exceeds a set threshold (usually pre-set in the instrument software, and the threshold is a fluorescence intensity value determined based on a large number of experimental verifications and statistical analyses) and presents a typical amplification curve morphology (such as an exponential growth trend), the sample is judged to be positive, that is, the sample contains the target nucleic acid sequence.

[0068] During the detection process of the present invention, if the fluorescence signal is always lower than the threshold value and no obvious amplification curve appears, the sample is judged to be negative, that is, the target nucleic acid sequence is not detected in the sample.

[0069] Preferably, the result output unit outputs the judgment result of the signal processing unit and displays the detection result of the corresponding channel on the result display screen.

[0070] Preferably, the result display screen and the channel indicator light are arranged on the same surface, and when the reaction is finished, the indicator light of the corresponding detection channel will be turned off, and the detection result of the corresponding detection channel will be displayed at the same time.

[0071] Preferably, the housing of the sensor detector is an acrylonitrile-butadiene-styrene copolymer housing.

[0072] In the present invention, the shell of the sensor detector is made of acrylonitrile-butadiene-styrene copolymer (ABS), which has the advantages of high impact strength, good heat resistance, low temperature resistance, chemical resistance and electrical properties, high surface hardness and easy processing and molding; it is suitable for making the shell of the sensor detector.

[0073] In a fourth aspect, the present invention provides a method for detecting Campylobacter jejuni, the method comprising:

[0074] (1) extracting nucleic acid from the sample to be tested, and collecting the supernatant as the test solution;

[0075] (2) using the RPA amplification-based microfluidic chip sensor described in the third aspect to detect the test liquid;

[0076] The test liquid is added into the microfluidic chip, and after the freeze-dried microspheres in the microfluidic chip are completely dissolved, the liquid is allowed to enter the reaction chamber, and the microfluidic chip is inserted into the detection channel of the sensor detector to start the reaction timing;

[0077] The sensor detector collects the fluorescence signal every 25-30 seconds; after the reaction is completed, the result display screen will show the detection results corresponding to each channel.

[0078] In a fifth aspect, the present invention provides the use of the RPA isothermal amplification freeze-dried microspheres for detecting Campylobacter jejuni described in the first aspect, the microfluidic chip based on RPA amplification described in the second aspect, or the microfluidic chip sensor based on RPA amplification described in the third aspect in isothermal amplification detection.

[0079] The numerical range described in the present invention not only includes the point values ​​listed above, but also includes any point values ​​between the above numerical ranges that are not listed. Due to space limitations and for the sake of simplicity, the present invention no longer exhaustively lists the specific point values ​​included in the range.

[0080] Compared with the prior art, the present invention has the following beneficial effects:

[0081] The detection limit of Campylobacter jejuni in the microfluidic chip and the detection method thereof of the present invention reached 5×10 1 -1×10 2 cfu / g. At the same time, the detection time of Campylobacter jejuni is significantly shortened. Compared with the traditional culture medium method, it is not only simple to operate but also greatly shortens the detection time, which can improve the detection efficiency; compared with the instrumental analysis technology, it does not require expensive large-scale detection equipment, the sample pretreatment process is simple, the requirements for the ability of the detection personnel are low, the detection is fast, simple, low cost, etc., and it is suitable for the on-site detection of large quantities of samples in grassroots laboratories; the present invention has the advantages of high sensitivity and accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 This is the front view of the microfluidic chip, 1, freeze-dried microsphere storage area; 2, detection reaction area; 1.1, sealing cover; 1.2, freeze-dried microsphere storage area; 2.2, RPA amplification reaction area; 2.11, channel one; 2.12, channel two.

[0083] Figure 2 This is a side view of the microfluidic chip.

[0084] Figure 3 This is the front view of the sensor detector.

[0085] Figure 4 It is a top view of the sensor detector.

[0086] Figure 5 This is the internal structure diagram of the sensor detector.

[0087] Figure 6 This is the internal optical path diagram of the sensor detector. DETAILED DESCRIPTION

[0088] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0089] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0090] Example 1

[0091] This embodiment provides an RPA isothermal amplification freeze-dried microsphere for detecting Campylobacter jejuni. The freeze-dried microsphere is prepared by a RPA isothermal amplification reagent for detecting Campylobacter jejuni through a freeze-drying process.

[0092] The RPA isothermal amplification reagent comprises: UvsX recombinase, upstream primer, downstream primer, fluorescent probe, DNTP, MgCl, mannitol and BSA.

[0093] The upstream primer includes that shown in SEQ ID NO: 1;

[0094] CTATGACGCTTAACTGGTCTGAGAGGATGATC.

[0095] The downstream primer includes that shown in SEQ ID NO: 2;

[0096] TGACACTTTTCGGAGCGTAAACTCCTTTTCTTA.

[0097] The structure of the fluorescent probe is shown below:

[0098] GGTCCAGACTCCTACGGGAGGCAGC-FAM-THF-C-BHQ1-AGTAGGGAATATTGC-spacer C3.

[0099] The preparation method of the freeze-dried microspheres comprises:

[0100] (1) Freeze-dried microspheres were added in equal proportions according to production requirements: 1.0 U of UvsX recombinase, 0.3 μM of upstream and downstream primers, 0.15 μM of fluorescent probe, 0.2 μM of DNTP, 3 mM of MgCl, 0.1% of mannitol, and 0.5% of BSA. The above ingredients were mixed evenly.

[0101] (2) Place the mixed liquid into a 50 mL centrifuge tube and centrifuge at 4000 rpm for 3-5 min to remove bubbles.

[0102] (3) Use a continuous micropipette to draw 20 μL each time and drop it drop by drop into liquid nitrogen to quickly freeze into microspheres.

[0103] (4) The frozen microspheres are then placed in a freeze dryer for vacuum drying.

[0104] Example 2

[0105] This embodiment provides a microfluidic chip based on RPA amplification, such as Figure 1 and Figure 2 As shown, the microfluidic chip includes: a freeze-dried microsphere storage area 1 and a detection reaction area 2; the freeze-dried microsphere storage area 1 includes a sealing cover 1.1 and a freeze-dried microsphere storage area 1.2; the freeze-dried microsphere storage area 1.2 is cylindrical and is used to place freeze-dried microspheres of RPA isothermal amplification reagents; the sealing cover 1.1 and the freeze-dried microsphere storage area 1.2 are connected by threaded sealing; the detection reaction area 2 includes a microfluidic double-hole channel and an RPA amplification reaction area 2.2; the detection reaction area 2 It is a flat shape with a tip, and the microfluidic double-hole channel is used for the amplification reaction liquid to flow to the RPA amplification reaction area 2.2; the RPA amplification reaction area 2.2 is used to provide a place for the reaction to occur; the microfluidic double-hole channel includes channel 1 2.11 and channel 2 2.12, and the channel 1 2.11 and channel 2 2.12 are designed in a V shape, the opening part of the V shape is connected to the lower part of the freeze-dried microsphere storage area 1.2, and the cross part of the V shape is connected to the RPA amplification reaction area 2.2.

[0106] The freeze-dried microsphere storage area 1.2, the microfluidic double-hole channel, and the RPA amplification reaction area 2.2 are made of polymethyl methacrylate; the pore diameters of the channel 1 2.11 and the channel 2 2.12 are 50 μm; and the volume of the RPA amplification reaction area 2.2 is 20 μL.

[0107] Example 3

[0108] This embodiment provides a microfluidic chip for detecting Campylobacter jejuni based on RPA amplification. The structure of the microfluidic chip is the same as that of Embodiment 2, wherein the RPA isothermal amplification freeze-dried microspheres for detecting Campylobacter jejuni prepared in Embodiment 1 are placed in the freeze-dried microsphere storage area 1.2.

[0109] The above-mentioned microfluidic chip adopts polymethyl methacrylate (PMMA) with good light transmittance, high stability and good heat resistance as the material, and designs the microfluidic chip sensor. Its microfluidic double-hole channel design is more conducive to the liquid entering the reaction chamber, ensuring that no small bubbles are formed in the reaction chamber, and ensuring the reliability and accuracy of the later detection results. The appearance shape of the microfluidic chip sensor is cylindrical on the top and flat with a point on the bottom. There is a thread at the top, which can be sealed with a matching threaded cap. Put the prepared freeze-dried microspheres into the microfluidic chip sensor, open the threaded cap before use and add the extract to achieve rapid detection.

[0110] Example 4

[0111] This embodiment provides a microfluidic chip sensor based on RPA amplification, wherein the sensor comprises the microfluidic chip based on RPA amplification described in Example 3, and a sensor detector, wherein the sensor detector is as follows: Figure 3 , Figure 4 , Figure 5 and Figure 6 shown.

[0112] The sensor detector comprises: an incident light unit, a detection channel unit, a fluorescence detection unit, a signal processing unit and a result output unit. The housing of the sensor detector is an acrylonitrile-butadiene-styrene copolymer housing.

[0113] The detection channel unit includes four detection channels and channel indicator lights arranged in sequence, and a touch-type timer switch is also arranged in the detection channel. The result output unit outputs the judgment result of the signal processing unit and displays the detection result of the corresponding channel on the result display screen. The result display screen and the channel indicator lights are arranged on the same surface. When the reaction is finished, the indicator light of the corresponding detection channel will go out, and the detection result of the corresponding detection channel will be displayed at the same time.

[0114] The structure of the detection channel is adapted to the detection reaction area 2 of the microfluidic chip. After the detection reaction area 2 is inserted into the detection channel, the touch timer switch is turned on and the channel indicator light is on.

[0115] After the touch timer switch is turned on, the fluorescence detection unit collects the fluorescence signal every 25-30 seconds. The signal processing unit compares the collected fluorescence signal with the set threshold value. During the entire detection process, if the fluorescence signal exceeds the set threshold value and presents a typical amplification curve, the sample is judged to be positive; if the fluorescence signal is always lower than the threshold value and no obvious amplification curve appears, the sample is judged to be negative.

[0116] The shell of the sensor detector is made of acrylonitrile-butadiene-styrene copolymer (ABS), which has high impact strength, good heat resistance, low temperature resistance, chemical resistance and electrical properties, high surface hardness and easy processing. The sensor detector is designed with 4 detection channels, and a touch timer switch is set inside each channel, which can be used for independent timing. When the microfluidic sensor is inserted into the detector, it will automatically start timing. The microfluidic chip will generate fluorescence during the reaction process, and the sensor detector collects the fluorescence signal every 25-30 seconds, so that the concentration change of the amplified product can be monitored in real time.

[0117] Example 5

[0118] This example detects Campylobacter jejuni in livestock and poultry meat samples. The microfluidic chip sensor based on RPA amplification described in Example 4 is used to detect the nucleic acid extract of the livestock and poultry meat samples. The specific steps are as follows:

[0119] (1) Sample pretreatment

[0120] Weigh 2 g of representative crushed sample and add it into a sterile centrifuge tube, then add 5 mL of extracting solution, shake for 3 min, centrifuge at 3000 rpm for 3 min, take 0.2 mL of supernatant, add 10 μL of magnetic beads, and 500 μL of nucleic acid lysis solution for nucleic acid extraction. After magnetic adsorption, remove the supernatant, wash twice with ultrapure water, and finally add 50 μL of elution solution for elution. Let it stand on the magnetic rack for 1 min. The supernatant is the test solution.

[0121] (2) Detection steps

[0122] Open the threaded cap on the top of the microfluidic chip, add 20μL of the test solution, shake gently, and after the white microspheres are completely dissolved, put them into a handheld centrifuge for instant centrifugation, or shake them down vigorously to allow the liquid to enter the reaction chamber. Then insert the microfluidic sensor into the detector and start the reaction timer.

[0123] (3) Analyze the test results

[0124] The sensor detector collects the fluorescence signal every 30 seconds. After the reaction is completed, each channel will display the corresponding test results.

[0125] Positive: During the detection process, if the fluorescence signal growth curve exceeds the set threshold (RN z value 0.1) and presents a typical amplification curve morphology (such as an exponential growth trend), the sample is judged to be positive, that is, the sample contains the target nucleic acid sequence.

[0126] Negative: If the fluorescence signal is always lower than the threshold during the entire detection process and no obvious amplification curve appears, the sample is judged to be negative, that is, the target nucleic acid sequence is not detected in the sample.

[0127] The test results are as follows:

[0128] The samples in channel one, channel two, and channel three do not contain Campylobacter jejuni, and the test results in the corresponding channels are negative. The samples in channel four contain Campylobacter jejuni, and the test results are positive.

[0129] Comparative Example 1

[0130] This comparative example investigates the preparation method of freeze-dried microspheres and compares the amplification effects of freeze-dried microspheres prepared by different isothermal amplification enzymes.

[0131] Lyophilized microspheres 1: The RPA isothermal amplification reagents include: UvsX recombinase, upstream primers, downstream primers, fluorescent probes, DNTP, MgCl, mannitol and BSA.

[0132] Lyophilized microspheres 2: The RPA isothermal amplification reagents include: ERA, upstream primers, downstream primers, fluorescent probes, DNTP, MgCl, mannitol and BSA.

[0133] Lyophilized microspheres 3: The RPA isothermal amplification reagents include: strand displacement DNA polymerase, upstream primer, downstream primer, fluorescent probe, DNTP, MgCl, mannitol and BSA.

[0134] Lyophilized microspheres 4: The RPA isothermal amplification reagents include: HDA helicase, upstream primer, downstream primer, fluorescent probe, DNTP, MgCl, mannitol and BSA.

[0135] The above-mentioned different freeze-dried microspheres were placed in the freeze-dried microsphere storage area (1.2) of the RPA amplification-based microfluidic chip, and the isothermal amplification test was performed on the Campylobacter jejuni positive sample with a concentration of (100 CFU / g). The results are shown in Table 1.

[0136] Table 1

[0137] Freeze-dried microspheres Sample concentration Detection value Accuracy / or RSD 1 100CFU / g 1.03 precise 2 100CFU / g 0.03 Inaccurate 3 100CFU / g 0.05 Inaccurate 4 100CFU / g 0.02 Inaccurate

[0138] From the results in Table 1, it can be seen that when the concentration of Campylobacter jejuni is 100 CFU / g, only the freeze-dried microspheres prepared with the UvsX recombinase dedicated to RPA can amplify the target fragment, and the other several isothermal enzymes cannot be used in this microsphere.

[0139] Comparative Example 2

[0140] This comparative example investigates the preparation method of freeze-dried microspheres and compares the amplification effects of freeze-dried microspheres prepared using different types of fluorescent probes.

[0141] Lyophilized microsphere 5: The fluorescent probe is: GGTCCAGACTCCTACGGGAGGCAGC-FAM-THF-C-BHQ1-AGTAGGGAATATTGC.

[0142] Lyophilized microsphere 6: The fluorescent probe is: FAM-GGTCCAGACTCCTACGGGAGGCAGC-THF-C-BHQ1-AGTAGGGAATATTGC-spacer C3.

[0143] Lyophilized microspheres 7: Fluorescent probes:

[0144] FAM-GGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATATTGCC-BHQ1-spacer C3.

[0145] The above-mentioned different freeze-dried microspheres were placed in the freeze-dried microsphere storage area (1.2) of the RPA amplification-based microfluidic chip, and the isothermal amplification test was performed on the Campylobacter jejuni positive sample with a concentration of (100 CFU / g). The results are shown in Table 2.

[0146] Table 2

[0147] Freeze-dried microspheres Sample concentration Detection value Accuracy / or RSD 1 100CFU / g 1.05 precise 5 100CFU / g 0.06 Inaccurate 6 100CFU / g 0.03 Inaccurate 7 100CFU / g 0.03 Inaccurate

[0148] Conventional probes (probes in freeze-dried microspheres 7) generally label the fluorescent group at the 5' end of the nucleic acid sequence, and then label the quenching group at the 3' end of the nucleic acid sequence, and no protection is required at the 3' end. However, this type of probe primer requires a high and repeated temperature change to amplify the product and release a signal. It is sensitive to temperature changes, the detection time required is relatively long, and the requirements for instruments and equipment are relatively high; from the results in the above table, it can be seen that the detection effect in freeze-dried microspheres 7 is not ideal.

[0149] From the results in Table 2, it can be seen that only the primer in freeze-dried microsphere 1 can produce the target signal value, and the other three primers do not show obvious signals. The results show that only the primer probe in the freeze-dried microsphere is the most ideal probe.

[0150] Comparative Example 3

[0151] This comparative example investigates the structure of a microfluidic chip based on RPA amplification and compares the use effects of microfluidic chips with different microfluidic double-hole channels.

[0152] Microfluidic chip 1: The microfluidic double-hole channel includes channel one 2.11 and channel two 2.12, and the channel one 2.11 and channel two 2.12 are designed in a V shape, the opening part of the V shape is connected to the lower part of the freeze-dried microsphere storage area 1.2, and the cross part of the V shape is connected to the RPA amplification reaction area 2.2.

[0153] Microfluidic chip 2: The microfluidic double-hole channel includes channel one 2.11 and channel two 2.12. The channel one 2.11 and channel two 2.12 are designed in parallel and connect the freeze-dried microsphere storage area 1 and the RPA amplification reaction area 2.2.

[0154] Microfluidic chip 3: The microfluidic double-hole channel contains only one channel connecting the freeze-dried microsphere storage area 1 and the RPA amplification reaction area 2.2.

[0155] The above microfluidic chips 1-3 were respectively used to perform isothermal amplification detection on Campylobacter jejuni positive samples with a concentration of (100 CFU / g). The results are shown in Table 3.

[0156] Table 3

[0157] Microfluidic Chip Sample concentration Detection value Accuracy / or RSD 1 100CFU / g 1.04 precise 2 100CFU / g 0.38 Inaccurate 3 100CFU / g 0.15 Inaccurate

[0158] From the results in Table 3, it can be seen that only the design mode of microfluidic chip 1 can allow a small amount of liquid to enter the reaction area completely, and the detection value is completely consistent with the expected result. The other two designs will more or less cause bubbles to appear in the reaction area, resulting in smaller detection values ​​or even errors, affecting the accuracy of the detection results.

[0159] In summary, the present invention provides a method for rapid on-site detection of Campylobacter jejuni with short detection time, low cost, simple operation, and the like. The RPA isothermal amplification reagent for detecting Campylobacter jejuni is prepared into freeze-dried microspheres through a freeze-drying process, and a matching microfluidic chip and sensor detector are designed to achieve rapid and accurate detection of Campylobacter jejuni.

[0160] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. An RPA isothermal amplification freeze-dried microsphere for detecting Campylobacter jejuni, characterized in that: The freeze-dried microspheres are prepared by freeze-drying the RPA isothermal amplification reagent for detecting Campylobacter jejuni; The RPA isothermal amplification reagent comprises: an isothermal amplification enzyme, an upstream primer, a downstream primer, a fluorescent probe, DNTP, MgCl, mannitol and BSA; The upstream primer includes that shown in SEQ ID NO: 1; the downstream primer includes that shown in SEQ ID NO: 2; the structure of the fluorescent probe is as follows: GGTCCAGACTCCTACGGGAGGCAGC-FAM-THF-C-BHQ1-AGTAGGGAATATTGC-spacer C3.

2. The RPA isothermal amplification freeze-dried microspheres for detecting Campylobacter jejuni according to claim 1, characterized in that: The RPA isothermal amplification reagent for detecting Campylobacter jejuni comprises, by concentration, 0.3-3U of isothermal amplification enzyme, 0.1-1μM of upstream primer, 0.1-1μM of downstream primer, 0.1-1μM of fluorescent probe, 0.1-1μM of DNTP, 0.05-1μM of MgCl, 0.5-5mM of mannitol, 0.01-1% of mannitol and 0.05-1% of BSA.

3. The RPA isothermal amplification freeze-dried microspheres for detecting Campylobacter jejuni according to claim 1 or 2, characterized in that: The freeze-drying process is as follows: the RPA isothermal amplification reagent for detecting Campylobacter jejuni is mixed, centrifuged to remove bubbles, 18-22 μL is drawn each time with a continuous micropipette, and dropped into liquid nitrogen to quickly freeze into microspheres, and then placed in a freeze dryer for vacuum drying.

4. A microfluidic chip based on RPA amplification, characterized in that: The microfluidic chip comprises: a freeze-dried microsphere storage area (1) and a detection reaction area (2); The freeze-dried microsphere storage area (1) comprises a sealing cover (1.1) and a freeze-dried microsphere storage area (1.2); The freeze-dried microsphere storage area (1.2) is cylindrical and is used to store freeze-dried microspheres of RPA isothermal amplification reagents; the sealing cover (1.1) and the freeze-dried microsphere storage area (1.2) are sealed and connected; The detection reaction area (2) includes a microfluidic double-hole channel and an RPA amplification reaction area (2.2); The detection reaction area (2) is flat with a point, and the microfluidic double-hole channel is used for the amplification reaction liquid to flow to the RPA amplification reaction area (2.2); the RPA amplification reaction area (2.2) is used to provide a place for the reaction to occur; The microfluidic double-hole channel comprises channel one (2.11) and channel two (2.12), wherein channel one (2.11) and channel two (2.12) are designed in a V shape, wherein the opening portion of the V shape is connected to the lower portion of the freeze-dried microsphere storage area (1.2), and the cross portion of the V shape is connected to the RPA amplification reaction area (2.2).

5. The microfluidic chip based on RPA amplification according to claim 4, characterized in that: The freeze-dried microsphere storage area (1.2), the microfluidic double-hole channel, and the RPA amplification reaction area (2.2) are made of polymethyl methacrylate; Preferably, the sealing cover (1.1) and the freeze-dried microsphere storage area (1.2) are connected by a threaded seal.

6. The microfluidic chip based on RPA amplification according to claim 4 or 5, characterized in that: The pore size of the channel 1 (2.11) and the channel 2 (2.12) is 45-55 μm; Preferably, the volume of the RPA amplification reaction zone (2.2) is 20-25 μL.

7. A microfluidic chip sensor based on RPA amplification, characterized in that: The sensor comprises a microfluidic chip based on RPA amplification according to any one of claims 4 to 6, and a sensor detector; The sensor detector comprises: an incident light unit, a detection channel unit, a fluorescence detection unit, a signal processing unit and a result output unit; The detection channel unit comprises a detection channel and a channel indicator light which are arranged in sequence, and a touch-type timer switch is also arranged in the detection channel; The structure of the detection channel is compatible with the detection reaction area (2) of the microfluidic chip. After the detection reaction area (2) is inserted into the detection channel, the touch-type timer switch is turned on and the channel indicator light is on.

8. The microfluidic chip sensor based on RPA amplification according to claim 7, characterized in that: After the touch timer switch is turned on, the fluorescence detection unit collects the fluorescence signal every 25-30 seconds; Preferably, the signal processing unit compares the collected fluorescence signal with a set threshold value. During the entire detection process, if the fluorescence signal exceeds the set threshold value and presents a typical amplification curve, the sample is judged to be positive; if the fluorescence signal is always lower than the threshold value and no obvious amplification curve appears, the sample is judged to be negative. Preferably, the result output unit outputs the judgment result of the signal processing unit and displays the detection result of the corresponding channel on the result display screen; Preferably, the result display screen and the channel indicator light are arranged on the same surface, and when the reaction is finished, the indicator light of the corresponding detection channel is turned off, and the detection result of the corresponding detection channel is displayed at the same time; Preferably, the housing of the sensor detector is an acrylonitrile-butadiene-styrene copolymer housing.

9. A method for detecting Campylobacter jejuni content, characterized in that: The method comprises: (1) extracting nucleic acid from the sample to be tested, and collecting the supernatant as the test solution; (2) using the RPA amplification-based microfluidic chip sensor of claim 7 or 8 to detect the test liquid; The test liquid is added into the microfluidic chip, and after the freeze-dried microspheres in the microfluidic chip are completely dissolved, the liquid is allowed to enter the reaction chamber, and the microfluidic chip is inserted into the detection channel of the sensor detector to start the reaction timing; The sensor detector collects the fluorescence signal every 25-30 seconds; after the reaction is completed, the result display screen will show the detection results corresponding to each channel.

10. Use of the RPA isothermal amplification freeze-dried microspheres for detecting Campylobacter jejuni according to any one of claims 1 to 3, the RPA amplification-based microfluidic chip according to any one of claims 4 to 6, or the RPA amplification-based microfluidic chip sensor according to claim 7 or 8 in isothermal amplification detection.

Images