Engineered escherichia coli as well as construction method and application thereof

Abstract

The invention discloses an escherichia coli engineering bacterium as well as a construction method and application thereof, and the escherichia coli engineering bacterium is obtained by taking escherichia coli as a host cell and transferring a recombinant plasmid carrying a target gene into the host cell, the nucleotide sequence of the target gene is as shown in any one of SEQ ID NO.1-3; the recombinant plasmid carrying the target gene is obtained after the target gene is inserted into a vector, the vector is a cytoplasm plasmid of escherichia coli, the escherichia coli engineering bacterium is used for expressing a target protein with a self-service number of Lac-05, Lac-06 or Lac-07, and the target protein is used for preparing medicines for preventing or treating bone related diseases. Protein drugs prepared from the target protein can increase bone mass, improve sclerotin and promote bone regeneration. Therefore, the compound can be used for preparing medicines for preventing and treating bone-related diseases, and a novel safe and effective biological treatment means is provided for preventing and treating the bone-related diseases.

Description

Technical Field

[0001] The present invention relates to the field of bone-related medical technology, and in particular to an engineered Escherichia coli capable of expressing a specific protein that can be used to prepare drugs for preventing and treating bone-related diseases, and a construction method and application thereof. Background Art

[0002] Metabolic bone disease is a systemic bone disease in which a variety of factors interfere with or destroy normal bone metabolism and biochemical state, leading to disorders in bone mineral metabolism, abnormal bone remodeling and (or) bone mineralization disorders. This abnormality is mainly caused by metabolic disorders of important minerals such as calcium, phosphorus, magnesium and (or) vitamin D. The key mechanism of the onset of metabolic bone disease is the dynamic imbalance between bone formation and bone resorption, in which osteoblasts are responsible for forming new bones and osteoclasts are responsible for destroying and absorbing old bones. Any factor that causes the imbalance of these two cells will cause abnormal bone remodeling, bone micro-damage, and then accumulate and develop into metabolic bone disease. The "bone-related disease" in the present invention is a broader definition of metabolic bone disease, and also includes metabolic bone disease caused by other factors such as fractures, cancer, burns, etc.

[0003] Osteoporosis is the most common and typical metabolic bone disease, characterized by a decrease in bone mass and destruction of bone microstructure, and is very likely to lead to brittle fractures. Among them, primary osteoporosis is mainly related to physiological bone loss, such as senile and postmenopausal osteoporosis; secondary osteoporosis is caused by other diseases or drugs, such as excessive and (or) improper use of glucocorticoids, endocrine diseases, kidney diseases, etc. Osteoporosis is clinically manifested by pain, hunchback, fractures, decreased respiratory function, etc., which seriously affect patients' daily activities and health.

[0004] At present, the drugs used clinically for metabolic bone diseases in bone-related diseases mainly include basic supplements (such as vitamin D), anti-bone resorption drugs (such as bisphosphonates, denosumab, etc.), osteosynthesis-promoting drugs (such as teriparatide) and selective estrogen receptor modulators (such as raloxifene). However, there are problems such as long-term use of these drugs and the high price of some drugs. Therefore, there is an urgent need to find a new, safe, effective and affordable drug to combat abnormal bone metabolism. Summary of the invention

[0005] The present invention provides an engineered Escherichia coli bacteria and a construction method and application thereof, which are used to solve the technical problems mentioned in the background technology, such as poor effect and high cost of existing bone drugs.

[0006] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0007] An engineered Escherichia coli bacterium is obtained by taking Escherichia coli as a host cell and transferring a recombinant plasmid carrying a target gene into the host cell; the nucleotide sequence of the target gene is shown in any one of SEQ ID NO.1-3; the recombinant plasmid carrying the target gene is obtained by inserting the target gene into a vector, and the vector is a cytoplasmic plasmid of Escherichia coli.

[0008] Based on the same technical concept, the present invention also provides a method for constructing the above-mentioned Escherichia coli engineering bacteria, comprising the following steps:

[0009] (1) Synthesize the corresponding target gene through the target protein sequence;

[0010] (2) Using cell engineering to culture E. coli and extract plasmids from the cytoplasm of E. coli;

[0011] (3) using the same restriction endonuclease to cut the plasmid to form an incision, and connecting the cut plasmid and the target gene to obtain a recombinant plasmid capable of expressing the target protein;

[0012] (4) Using culture medium to culture Escherichia coli, and adding the recombinant plasmid thereto, so that the Escherichia coli absorbs the recombinant plasmid, thereby obtaining the engineered Escherichia coli.

[0013] Based on the same technical concept, the present invention also provides an application of the above-mentioned Escherichia coli engineered bacteria, which is used to express the target protein with Uniprot number A0A062WZA5, A0A062X712 or A0A062XBZ4, and the target protein is used to prepare a drug for preventing or treating bone-related diseases, and is self-named with number Lac-05, Lac-06 or Lac-07.

[0014] As a further preferred embodiment of the above technical solution, the engineered E. coli bacteria are propagated, and the plasmid therein is transcribed and translated to obtain a supernatant containing the target protein, which is then washed and purified to obtain a purified target protein.

[0015] As a further preferred embodiment of the above technical solution, the bone-related diseases include metabolic bone diseases, such as primary and secondary osteoporosis and fractures thereof, osteomalacia, rickets, osteitis fibrosa, osteosclerosis, osteogenesis imperfecta, fibrous dysplasia of bone, hyperparathyroidism, hypoparathyroidism, etc.

[0016] As a further preferred embodiment of the above technical solution, the metabolic bone disease is osteoporosis or a metabolic bone disease caused by other factors, and the other factors include fractures, cancer or burns.

[0017] The present invention has the following beneficial effects:

[0018] The present invention provides an engineered Escherichia coli bacterium, and discloses the use of a target protein expressed and purified by the engineered Escherichia coli bacterium in a conventional manner in the prevention and treatment of bone-related diseases. The protein medicine prepared from the target protein can increase bone mass, improve bone quality, and promote bone regeneration. Therefore, it can be used to prepare a drug for the prevention and treatment of bone-related diseases, providing a new safe and effective biological treatment method for the prevention and treatment of bone-related diseases.

[0019] The present invention will be further described in detail below with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The drawings constituting a part of this application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings: Figure 1 ARS staining of BMSCs treated with three target proteins (white scale is 50µm); Figure 2 TRAP staining of RAW264.7 for the intervention of three target proteins (the white scale in the figure is 50µm); Figure 3 The three-dimensional imaging and bone microstructure comparison of the distal femur of each group of hormone-induced osteoporosis mouse models (the white scale in the figure is 1 mm); Figure 4 The expression result of the target protein in Example 1; Figure 5 The expression result of the target protein in Example 2; Figure 6 This is the expression result of the target protein in Example 3. DETAILED DESCRIPTION

[0024] The following is a detailed description of embodiments of the present invention, but the present invention can be implemented in many different ways as defined and covered by the claims.

[0025] Embodiment 1:

[0026] The engineered Escherichia coli bacteria of this embodiment are obtained by taking Escherichia coli as a host cell and transferring a recombinant plasmid carrying a target gene into the host cell; the nucleotide sequence of the target gene is shown in SEQ ID NO.1.

[0027] The engineered Escherichia coli of this embodiment is constructed by the following method:

[0028] (1) Isolating and purifying the desired target gene, and then using restriction endonucleases (NdeI and Hind3) to separate the target gene from the original DNA (using existing conventional techniques);

[0029] (2) Using cell engineering to culture E. coli and extract plasmids from the cytoplasm of E. coli;

[0030] (3) using the same restriction endonuclease to cut the plasmid to form an incision, and using DNA ligase to connect the cut plasmid and the target gene to obtain a recombinant plasmid capable of expressing the target protein;

[0031] (4) Competent cells BL21(DE3) and Rosetta TM 2(DE3) was taken out from -80℃ and thawed;

[0032] (5) Place 100 ng of the recombinant plasmid containing the target gene and the two cells in step (4) into the same test tube and mix well;

[0033] (6) Incubate the test tube in step (5) on ice for 30 min, then place at 42°C for 90 s, then replace the test tube and place on ice for 3 min;

[0034] (7) Add 100 μl of LB culture medium to the test tube replaced in step (6), and then mix in a shaker at 37°C and 200 rpm for 60 min;

[0035] (8) Spread on LB agar plates containing 50 μg / ml kanamycin;

[0036] (9) Invert the culture dish and incubate at 37°C overnight;

[0037] (10) Select three well-isolated single colonies and inoculate them into 4 ml LB medium containing 50 μg / ml kanamycin, and shake them in a shaker at 37°C and 200 rpm;

[0038] (11) When the OD value reached 0.6-0.8, 0.5 mM IPTG was added to two tubes and induced at 15°C for 16 h and 37°C for 4 h, respectively. The last tube was used as a negative control.

[0039] (12) Sample preparation: harvest cell pellets from 450 μl of culture medium, add 300 μl of lysis buffer (50 mM Tris, 150 mM sodium chloride, 5% glycerol pH 8.0) and use an ultrasonicator to lyse for 1 min: Preparation of whole cell lysate: mix 50 μl of 5x loading buffer into 100 μl of cell lysate to prepare a sample of whole cell lysate. Heat the sample at 100°C for 10 min and centrifuge at 15,000 rpm for 5 min. Centrifuge the remaining 200 μl of cell lysate at 15,000 rpm for 10 min, and collect the supernatant and pellet of the cell lysate. 90 μl of 5x loading buffer was added to 180 μl of supernatant as the sample of cell lysate supernatant; 150 μl of 5x loading buffer was used as the sample of cell lysate pellet to resuspend all the precipitates, the samples were heated at 100°C for 10 min, centrifuged at 15,000 rpm for 5 min, and then loaded into the gel;

[0040] (13) SDS-PAGE and western blot were used to detect the expression of the target protein (Uniprot number A0A062WZA5, self-named number Lac-05) in the whole cell lysate, supernatant of the cell lysate, and pellet. The results are shown in Tables 1 and Figure 4 shown.

[0041] Embodiment 2:

[0042] The E. coli engineered bacteria of this embodiment are obtained by taking E. coli as a host cell and transferring a recombinant plasmid carrying a target gene into the host cell; the nucleotide sequence of the target gene is shown in SEQ ID NO.21.

[0043] The construction method of the E. coli engineering bacteria in this example is consistent with that in Example 1. The expression of the target protein (Uniprot number is A0A062X712, self-named number is Lac-06) in the whole cell lysate, the supernatant of the cell lysate and the pellet is shown in Tables 1 and Figure 5 shown.

[0044] Embodiment 3:

[0045] The E. coli engineered bacteria of this embodiment are obtained by taking E. coli as a host cell and transferring a recombinant plasmid carrying a target gene into the host cell; the nucleotide sequence of the target gene is shown in SEQ ID NO.3.

[0046] The construction method of the E. coli engineering bacteria in this example is consistent with that in Example 1. The expression of the target protein (Uniprot number is A0A062XBZ4, self-named number is Lac-07) in the whole cell lysate, the supernatant of the cell lysate and the granules is shown in Tables 1 and Figure 6 shown.

[0047] Table 1. Expression test results of target proteins in Examples 1-3

[0048]

[0049]

[0050] The target protein of Examples 1-3 can be used to prepare drugs for preventing and / or treating bone-related diseases. The target protein can be modified by functional enhancement, phosphorylation, acetylation, methylation, glycosylation, lipidation, polyethanolation (PEGylation) or other appropriate chemical modifications to enhance its stability, enhance efficacy, increase oral bioavailability or achieve targeted release in specific tissues or cells, especially targeting bones; the target protein can be combined with at least one pharmaceutically acceptable excipient, and the excipient is selected from excipients, stabilizers, fillers, adhesives, wetting agents, sustained-release agents, absorption promoters, emulsifiers, dispersants, dissolution aids, preservatives, antioxidants or lubricants; the drug for preventing and / or treating bone-related diseases can be in the form of tablets, pills, capsules or injections.

[0051] SEQ ID NO.1:

[0052] ATGCATCACCACCACCACCATGTAAAAAATTCGAGCAGCAGCGCCAAGTCGGACAAGAAGGTTACTCTGAATATTGGCACCATGCCGGCCCCTGATAGCCTGCCACTGTACGTGGCACAGAAAGAGGGCTACTTCAAAGACCAGGGTCTTGATGTTAAATTGACCAACTTCAAATCCCCGAAGGAGCGCGATGCTGCTATCAGCGGTGGTCAGTTAGACGCGGCTGTGACCGATGTCGTGGCGCTGGCAAGCTATGTAAATGGCGACCTCGGCTGGAAATCTGCTACGGGTCTGACAGGTTATTTCGGCATTGTTACCAGCGACGATTCCGTGAAAAACGTGGCGGATCTGAAGGGTAAATCCGTCGCCACCCTGCCACGTCAGACCCCGACCTTTTATCTGTACCAGCAGCTTAAGCAAAACGGCCTGTCCACCAGCGACGTGACGATCAAAGAGGTGCCGGCGATCCCGGCGCGTCTGCAGTTGGTTGAACAGAAACAGGCAGATGCTACCATTCTGCCGGATCCGTTTCTGAGCATGGCAAAGGCTAGCGGTTTGAAGGAGATCGCGAAGTCCGACCCGAAGACCTATCAAACCACTATCCTTGGCGTTGACAAAAAGCTGGGTGATGACAAAGCGACGCTGGCGAAGCTGACCACCGCATATAACAAGGCGGTGGCCCAAATTAACAAACACAAAGCGTCTGACTATCAAGCGATTCTCACGAAAGATCTGGGTTTTCCGGAAGCAGTTGCGAAAAATTACACCCTGCCGCATTACGAAAAAGCCGGTCGTGTTCCGGCGAAGATGCTGCAAGCGGCGTTCAACTACGCAAAGGAGGAAGGCATCTTGAAGTCTGACATCGACGCGAGCCACTACCAATTGCCGGTTGCCAAGTAA;

[0053] SEQ ID NO.2:

[0054]

[0055] SEQ ID NO.3:

[0056]

[0057] Embodiment 4:

[0058] This example is a related experimental verification that the target protein of Examples 1-3 can promote osteogenic differentiation and inhibit osteoclast differentiation in vitro.

[0059] like Figure 1 As shown in the figure, mouse bone marrow mesenchymal stem cells (BMSCs) were induced to osteogenic, and Lac-05, Lac-06, and Lac-07 (at a concentration of 1 μg / mL) were used for intervention. After the intervention, ARS staining was performed to mark the osteogenic area. It can be seen that after the intervention of the target protein, the ARS staining area increased significantly, indicating that the target protein can promote osteogenic differentiation in vitro. Figure 2 As shown, RAW264.7 cell line (mononuclear macrophages) was induced to osteoclasts, and Lac-05, Lac-06, and Lac-07 interventions were respectively applied (concentration of 1 μg / mL). After the intervention, TRAP staining was performed to mark osteoclasts. It can be seen that after the intervention of the target protein, the number of TRAP+ osteoclasts was significantly reduced, indicating that the target protein can inhibit osteoclast differentiation in vitro.

[0060] Embodiment 5:

[0061] This example is a related experimental verification that the target protein of Examples 1-3 can prevent bone loss in hormone-induced osteoporosis model mice.

[0062] Mouse model: 3-month-old C57BL / 6 male SPF mice were selected, with body weight, 11-12 mice in each group, free access to food and water, and circadian rhythm was maintained.

[0063] Grouping experiment: C57BL / 6 male SPF mice were randomly divided into 5 groups, including Veh group, MPS group, MPS+Lac-05 group, MPS+Lac-06 group, and MPS+Lac-07 group; there were 11-12 mice in each group.

[0064] Modeling: Each group of mice was injected with hormones or solvents and intervention began at the same time.

[0065] Dosage:

[0066] Veh group: The mice were injected with the solvent into the left muscle and phosphate buffered saline was injected intravenously at the same time. The injection volume was 100 μL once a week, and samples were collected after six weeks of intervention.

[0067] MPS group: At the same time as the injection of MPS, mice were injected with phosphate buffer via the tail vein. The volume of the tail vein injection was 100 μL, twice a week, and samples were collected after six weeks of intervention.

[0068] MPS+Lac-05 group: Mice were injected with MPS and Lac-05 recombinant protein solution through the tail vein at the same time. The intervention concentration was 200μg / kg and the injection volume was 100μL. The injection was done twice a week and samples were collected after six weeks of intervention.

[0069] MPS+Lac-06 group: Mice were injected with MPS and Lac-06 recombinant protein solution through the tail vein at the same time. The intervention concentration was 200 μg / kg and the injection volume was 100 μL. The injection was done twice a week and samples were collected after six weeks of intervention.

[0070] MPS+Lac-07 group: Mice were injected with MPS and Lac-07 recombinant protein solution through the tail vein at the same time. The intervention concentration was 200 μg / kg and the injection volume was 100 μL. The injection was done twice a week and samples were collected after six weeks of intervention.

[0071] like Figure 2 As shown in the figure, after intravenous injection of the target protein, the cancellous bone volume fraction (Tb.BV / TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), and cortical bone thickness (Cb.Th) of the distal femur of mice were significantly higher than those of the model group (P<0.05), while the trabecular separation (Tb.Sp) and cortical bone inner diameter (Es.Pm) were significantly lower than those of the model group (P<0.05), indicating that tail vein injection of the target protein can alleviate the bone loss phenotype of the postmenopausal osteoporosis mouse model. Biomechanical tests showed that after intervention with the target protein, the mechanical strength of the mouse bones was significantly improved (P<0.05).

[0072] The above are only preferred embodiments of the present invention, and the protection scope of the present invention is not limited to the above embodiments. For those skilled in the art, improvements and changes obtained without departing from the technical concept of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. An engineered Escherichia coli, characterized in that: Escherichia coli is used as a host cell, and a recombinant plasmid carrying a target gene is transferred into the host cell to obtain the target gene; the nucleotide sequence of the target gene is shown in any one of SEQ ID NO.1-3; the recombinant plasmid carrying the target gene is obtained by inserting the target gene into a vector, and the vector is a cytoplasmic plasmid of Escherichia coli.

2. A method for constructing the Escherichia coli engineered bacteria according to claim 1, characterized in that: The following steps are involved: (1) synthesizing or extracting the target gene; (2) Using cell engineering to culture E. coli and extract plasmids from the cytoplasm of E. coli; (3) using the same restriction endonuclease to cut the plasmid to form an incision, and connecting the cut plasmid and the target gene to obtain a recombinant plasmid capable of expressing the target protein; (4) Using culture medium to culture Escherichia coli, and adding the recombinant plasmid thereto, so that the Escherichia coli absorbs the recombinant plasmid, thereby obtaining the engineered Escherichia coli.

3. Use of the Escherichia coli engineered bacteria according to claim 1 or the Escherichia coli engineered bacteria constructed by the construction method according to claim 2, characterized in that: The engineered Escherichia coli bacteria are used to express a target protein with a Uniprot number of A0A062WZA5, A0A062X712 or A0A062XBZ4, and the target protein is used to prepare a drug for preventing or treating bone-related diseases.

4. The use of the Escherichia coli engineering bacteria according to claim 3, characterized in that: The engineered E. coli bacteria are propagated, and the plasmid therein is transcribed and translated to obtain a supernatant containing the target protein, which is then washed and purified to obtain a purified target protein.

5. The use of the Escherichia coli engineering bacteria according to claim 3, characterized in that: The bone-related diseases include metabolic bone diseases.

6. The use of the Escherichia coli engineering bacteria according to claim 5, characterized in that: The metabolic bone disease is osteoporosis or a metabolic bone disease caused by other factors, including bone fractures, cancer or burns.

Images