Kit for realizing human B lymphocyte counting based on gene methylation detection

Abstract

The invention provides a kit for realizing human B lymphocyte counting based on gene methylation detection. The kit is used for detecting poly ADP-ribose polymerase 1 (PARP1) gene methylation in a sample. The invention proposes that an unmethylated gene region of the PARP1 gene can be used as a biomarker for B lymphocyte identification for the first time. The copy number of the PARP1 target gene and the copy number of the reference gene are quantified through the PCR technology, and the B lymphocytes in a small amount of blood or dried blood spots can be conveniently and rapidly subjected to relative quantitative analysis. The detection target is the methylation level of the leukocyte DNA in the sample, the kit can be suitable for various types of samples, including fresh or frozen blood, separated PBMC cells, dried blood spots and the like, and the requirements on the samples are greatly reduced.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a kit for realizing human B lymphocyte counting based on gene methylation detection. Background Art

[0002] Lymphocytes are important cellular components that help the human body resist diseases and stimulate immune responses. They express differentiation antigens, namely CD molecules, during the process of differentiation and maturation. Depending on the expression of CD molecules, lymphocyte subsets mainly include T lymphocytes, B lymphocytes, and NK cells. B lymphocytes are traditionally defined as "cell populations that express clonal diversity of cell surface immunoglobulin (Ig) receptors and recognize specific antigen epitopes." They originate from hematopoietic stem cells in the bone marrow, and their characteristic markers include CD19, CD20, and B lymphocyte antigen receptors (BCR). B lymphocytes can be divided into two lineages, T cell-independent B1 cells and T cell-dependent B2 cells. B lymphocytes that mature in the bone marrow migrate to peripheral lymphoid organs through the blood. After being stimulated by antigens, they differentiate and proliferate into plasma cells, synthesize antibodies, exert humoral immunity, and play an important role in the pathogenesis of many human diseases.

[0003] The proportion, number and function of different lymphocyte subsets will directly affect the body's immune status. "Lymphocyte subset" detection is an important indicator for evaluating the body's current immune function and balance state, especially for patients with immunodeficiency. It is an indispensable diagnostic item. Under normal circumstances, each lymphocyte subset maintains a certain proportion and number, and works together to maintain the body's homeostasis. During the course of the disease, the proportion and number of immune cells will undergo pathological changes, leading to immune dysfunction. The application scenarios of lymphocyte counting are wide-ranging, mainly including early screening of abnormal total lymphocyte subsets in patients with infection and malignant tumors, verification after screening for primary immunodeficiency, auxiliary diagnosis of chronic lymphocytic leukemia (CLL), post-treatment detection and monitoring of HIV-positive patients, and immune and immune reconstruction monitoring, such as transplantation, autoimmunity and other immune conditions after immunosuppressive treatment, and evaluation of immune reconstruction after hematopoietic stem cell transplantation.

[0004] Currently, flow cytometry (FCM) is the standard method for counting lymphocyte subsets or B lymphocytes. It uses different monoclonal antibodies to bind to CD antigens on the surface of lymphocytes, and then uses multi-color fluorescent dyes to simultaneously detect surface antigens of several lymphocytes, separate B lymphocytes from white blood cells, and thus obtain the number and relative proportion of B lymphocytes. There are several limitations in the use of flow cytometry for B lymphocyte counting: First, the sample requirements are high. The cells to be tested must be intact, and the blood sample must be "fresh", and generally the test is required to be performed within 8 hours; second, due to the high sample requirements for flow cytometry B lymphocytes, blood collection is more problematic for certain application scenarios such as infants and young children; third, flow cytometry detects the fluorescent signal of the complex after the fluorescent-labeled antibody binds to the antigen on the cell surface, and it is necessary to determine the threshold between the positive and negative complexes. However, for the surface antigens of different cell subpopulations, their expression is not a process of presence or absence, but different expression levels of low, medium, and high. Therefore, B lymphocyte subpopulations may be counted inaccurately due to inaccurate threshold determination; fourth, due to differences in samples, immunological detection techniques, and operating procedures, the test results of each laboratory vary greatly. Standardization of flow cytometry B lymphocyte counting remains a challenge, and a standardized scheme needs to be established.

[0005] DNA methylation modification plays an important role in the differentiation and development of B lymphocytes. It regulates the expression and shutdown of genes, thereby providing specific methylation markers for B lymphocytes. For example, the promoter regions of some genes involved in the differentiation and development of B lymphocytes are completely unmethylated in B lymphocytes, but highly methylated in other cell subsets outside of B lymphocytes, such as T lymphocytes, NK cells, and non-lymphocytes such as granulocytes and monocytes. These unmethylated CpG sites can be used as specific differentially methylated regions (DMRs), that is, as biomarkers, to identify B lymphocytes and to quantify B lymphocytes in peripheral blood. This type of B lymphocyte is characterized not by cell morphology or surface markers, but by epigenetic means, which is expected to overcome the limitations of the above-mentioned flow cytometry method.

[0006] At present, there are few reports on epigenetic DNA methylation biomarkers as a method for lymphocyte counting. Patent CN 108026578 A reported that B lymphocytes were identified and quantified based on the demethylation or lack of methylation status of at least one CpG position in the gene region of low-density lipoprotein receptor-related protein 5 (LRP5), and distinguished from all other cells in complex samples (such as other blood cells or immune cells). However, the validation of LRP5 as a B lymphocyte-specific marker in this patent is not sufficient, and cell type specificity is only demonstrated by plasmid DNA. In addition, the description and data of the method implemented in whole blood and / or tissues without trypsin digestion are unclear. Summary of the invention

[0007] In order to overcome the above problems, the present invention provides a kit for realizing human B lymphocyte counting based on gene methylation detection, wherein the kit is a kit for detecting PARP1 gene methylation in a sample.

[0008] In one embodiment, the kit is a kit for detecting fragments in the differentially methylated region hg38chr1: 226372321-226371196 on the PARP1 gene.

[0009] In one embodiment, the kit is a kit for detecting the differentially methylated region hg38chr1: 226371363-226371254 on the PARP1 gene.

[0010] In one embodiment, the kit is a kit for detecting a gene region comprising at least one of the differentially methylated sites hg38 chr1: 226371196, hg38 chr1: 226371228, hg38 chr1: 226371279 and hg38 chr1: 226371333 on the PARP1 gene.

[0011] In one embodiment, the kit calculates the ratio of human B lymphocytes to human leukocytes by detecting the copy numbers of the internal reference gene and the PARP1 gene.

[0012] In one embodiment, the internal reference gene is the RPP30 gene.

[0013] In one embodiment, the kit is a sequencing kit, a quantitative PCR kit, or a digital PCR kit.

[0014] In one embodiment, the kit includes: primers and probes for detecting the methylation status of CpG sites in the region of hg38 chr1: 226371363-226371254 and primers and probes for detecting the copy number of an internal reference gene.

[0015] In one embodiment, the kit comprises: an upstream primer SEQ ID No. 13GGAAGTGTTGGATATGTAGAAATGG, a downstream primer SEQ ID No. 14: CCCACACTCTATATCCTAAAACATCA, and a probe SEQ ID No. 15: AGGTGTAGTTATGGGTT.

[0016] In one embodiment, the sample is selected from a peripheral blood sample, a capillary blood sample or a venous blood.

[0017] Based on the above situation, in order to overcome the current technical limitations of cytological B lymphocyte counting and expand its applicability, the present invention first proposed that the unmethylated gene region of the PARP1 gene can be used as a biomarker for B lymphocyte identification.

[0018] The β value of the CpG site in the methylation chip represents the degree of methylation. Comparing the β difference (Δβ value) of the corresponding CpG points between each group of samples can screen the differential methylation sites. The larger the absolute value of the Δβ value, the greater the difference in the degree of methylation of the site, and the stronger the specificity of the site. When screening the differential CpG sites of B lymphocytes based on the above principle, the present invention creatively sets another screening condition: the Δβ values ​​of the adjacent 4-5 CpG sites in the methylation chip are as large as possible, and these sites are continuous and as dense as possible, so as to ensure that the gene fragment composed of these 4-5 methylation sites has the greatest specificity, thereby meeting the needs of potential biological markers. According to this screening condition, the present invention finally identified four differentially methylated sites on the PARP1 gene with large Δβ values ​​and relatively dense distribution: cg08247449 (hg38 chr1: 226371196), cg00278472 (hg38 chr1: 226371228), cg09201889 (hg38 chr1: 226371279) and cg06184361 (hg38 chr1: 226371333).

[0019] In view of the fact that a gene sequence is used for regulating the gene or for methylation detection, a differential methylation region must be determined from the differential methylation sites screened above, which is used as a specific marker for distinguishing B lymphocytes. At the same time, the CpG sites covered by the probe in the methylation chip are also non-continuous. The present invention uses the four screened differential methylation sites as the base point, and verifies the methylation status of the 22 CpG sites contained in the sequence of about 1130bp upstream and downstream of the gene through Sanger sequencing after bisulfite conversion and PCR amplification. In B lymphocytes, these sites are all unmethylated, while in other subgroups, these CpG sites are all methylated, which is completely consistent with the methylation status of the four screened differential methylation sites, thereby determining a differential methylation region of about 1130bp consisting of 22 methylation sites (hg38chr1: 226372321-226371196) as a specific unmethylated region of B lymphocytes.

[0020] In the approximately 1130 bp differentially methylated region verified above, multiple amplicon detection fragments with relatively concentrated CpG sites and covering different methylation sites were selected, such as AMP2269, AMP2110, AMP1948, AMP1787 and AMP1333. Primers and probes for the corresponding methylation conversion fragments were designed, and the ΔCt values ​​(Ct 阴性 -Ct 阳性 ), the higher the ΔCt value, the better the specificity for B lymphocytes, thus selecting a 110bp differentially methylated region (hg38 chr1: 226371363-226371254) corresponding to the amplicon AMP1333 on the PARP1 gene, which has good specificity and sensitivity and can be used as a biomarker for the identification of B lymphocytes.

[0021] The technical solution adopted by the present invention is: first, the gDNA of the sample to be tested is extracted, and the extracted gDNA is used as a DNA template after bisulfite conversion. Then, double qPCR amplification is performed using primer probes specific to the amplicon of the PARP1 target gene and primer probes specific to the internal reference gene RPP30. The amplification reaction is run on a qPCR instrument, and the amplification result is given in the form of a fluorescence curve. Purified B lymphocytes are selected as the reference system, and the fluorescence curve and 2 -ΔΔCtThe method can be used to calculate the relative content of B lymphocytes in leukocytes. In addition, a digital PCR detection platform can also be used to directly detect the copy number of the PARP1 target gene and the RPP30 reference gene. According to the corresponding relationship between the copy number of the reference gene and the number of cells (the copy number of RPP30: the number of cells = 2:1), the formula: the relative content of B lymphocytes (%) = the copy number of the PARP1 target gene / the copy number of the reference gene × 100 can be used to calculate the relative content of B lymphocytes in leukocytes. The RPP30 reference gene detection fragment selected by the present invention is stably expressed in all leukocytes, and the cytosines in the sequence are all in an unmethylated state.

[0022] The target of the present invention is the methylation level of leukocyte DNA in the sample, which can be applied to various types of samples, including fresh or frozen blood, isolated PBMC cells, dried blood spots, etc. The requirements for samples are greatly reduced, and there is no requirement for the storage state of the samples; secondly, DNA amplification detection requires a small amount of samples, and trace DNA can meet the detection requirements; thirdly, the detection signals obtained by PCR are digital, which represent a positive or negative value for each cell, rather than an arbitrarily defined "positive" threshold like the flow cytometry method; finally, based on epigenetic qPCR, it can be performed in an automated, operator-independent manner, and reduce sensitivity to reagent variability. The kit of the present invention is not only a beneficial supplement to traditional flow cytometry detection, but the method provided by the present invention can significantly distinguish between children with X-linked agammaglobulinemia (XLA) and normal newborns, and can serve the screening of primary immunodeficiency diseases in newborns. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0024] Figure 1 It is a DMR sequence used to identify the PARP1 gene of B lymphocytes; Figure 2 It is a bisulfite-converted DMR sequence used to identify the PARP1 gene in B lymphocytes; Figure 3 This is the PCR amplification curve result of plasmid DNA to verify TPG specificity; Figure 4 This is the PCR amplification curve result of plasmid DNA to verify CPG specificity; Figure 5This is the PCR amplification curve of the methylation standard to verify the TPG specificity; Figure 6 This is the PCR amplification curve of the methylation standard to verify the CPG specificity; Figure 7 It is a bar graph of gradient methylation standards to verify the specificity of the PCR system; Figure 8 It is a linear plot of gradient methylation standards to verify the specificity of the PCR system; Fig. 9 This is a graph showing the digital PCR results of purified cells to verify the marker specificity. DETAILED DESCRIPTION

[0025] In order to enable those skilled in the art to better understand the technical solutions in the present application, the present invention will be further described below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present application. In the following embodiments, unless otherwise specified, all are conventional methods.

[0026] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or conditions recommended by the manufacturers. The various chemical reagents used in the examples are all commercially available products.

[0027] Example 1 Discovery of differentially expressed genes and differentially methylated regions In order to find the DNA methylation region specific to B lymphocytes, the present invention first analyzed the 450K and 850K methylation chip data from Illumina, and obtained the methylation β value through operations such as probe filtering. Then the β threshold was set to 0.2 and 0.8. After processing and analysis in the confirmation data set and the validation data set, the differential sites were obtained by comparing the overall methylation levels of different lymphocyte subset samples and performing data quality control and standardization operations. The differences in the sites were measured by the Δβ value. The larger the absolute value of the Δβ value, the more obvious the difference between the groups. According to the absolute value of the Δβ value being greater than 0.5 and the Q value being less than 0.01 (Q<0.01 represents a significant difference). Based on this, the present invention preferably selected the differential gene PARP1 with more differential sites (the results are shown in Table 1). ‌PARP1 (poly ADP-ribose polymerase 1)‌ is mainly involved in a variety of biological processes in cells, including DNA damage repair, gene transcription regulation, cell differentiation, proliferation and tumor transformation. On the basis of obtaining the differential genes, the present invention sets another screening condition: the Δβ values ​​of the adjacent 4-5 CpG sites in the methylation chip are as large as possible, and these sites are continuous and as dense as possible, so as to ensure that the gene fragment composed of these 4-5 methylation sites has the greatest specificity, thereby meeting the needs of potential biological markers. The present invention screened 4 differential methylation sites with large Δβ values ​​and relatively dense distribution on the differential gene PARP1: cg08247449, cg00278472, cg09201889 and cg06184361, that is, the specific positions corresponding to the PARP1 gene are hg38 chr1: 226371196, hg38 chr1: 226371228, hg38 chr1: 226371279 and hg38 chr1: 226371333.

[0028] Table 1 Screened differential loci and differential genes

[0029] Next, the present invention confirms the differential sites by experimental methods. Using gDNA of purified B lymphocytes from fresh peripheral blood converted by bisulfite as a positive template and gDNA of non-B lymphocytes from the same source converted by bisulfite as a negative template, Sanger sequencing and pyrosequencing were performed after qPCR amplification. As shown in the verification results in Table 2, the four differentially methylated sites on the PARP1 gene (cg08247449, cg00278472, cg09201889 and cg06184361) are indeed differentially methylated sites.

[0030] In view of the fact that a gene sequence is used for regulating genes or for methylation detection, a DMR must be determined from the above-screened differential methylation sites to be used as a specific marker for distinguishing B lymphocytes. At the same time, the CpG sites covered by the probes in the methylation chip are also non-continuous. The present invention uses the above-determined 4 differential methylation sites as the base point, expands the possible range of differential sites in the sequence of about 900bp upstream of the gene (the downstream gene sequence of the 4 differential sites is about 200bp without CG points), and then searches for possible differential methylation region DMR. The gDNA derived from purified B lymphocytes is converted by bisulfite, and multiple pairs of universal primers are designed to amplify the target gene fragments where multiple possible differential methylation sites are located, and then Sanger sequencing is performed. It can be seen from the sequencing results shown in Table 3 that the sequencing results of each site to be tested are "T" (unmethylated state) when the positive template is amplified, and the sequencing results are "C" (methylated state) when the negative template is amplified, which is completely consistent with the methylation state of the 4 differential methylation sites screened. Based on this, the present invention determined the DMR composed of the above 22 differential methylation sites (hg38 chr1: 226372321-226371196), and the DMR is distributed in the promoter region of the PARP1 gene.

[0031] Table 2 Sanger sequencing and pyrosequencing validation results of the four differentially methylated sites on the PARP1 gene.

[0032]

[0033] Table 3 Sanger sequencing results of each tested site

[0034] In particular, Figure 1 The DNA sequence, CpG site analysis, and specific gene localization of four differentially methylated sites for the identification of DMRs of the PARP1 gene in B lymphocytes are shown. Figure 1 The four differentially methylated sites are bold and underlined.

[0035] Example 2 Determined Amplicon and Specific Primer Probe Figure 2 Bisulfite-converted DNA sequences of the identified DMR regions are shown. Figure 2The horizontal boxes in the figure correspond to (CPG1, 2, ..., 22) in the analyzed PARP1 gene, and the positions indicated (hg38 chr1: 226372321, hg38chr1: 226372269 ..., hg38 chr1: 226371196) correspond to CPG1, 2, ..., CPG22. To further determine the optimal target gene amplicon sequence, five candidate amplicons AMP2269 (CpG2-CpG5, specific genomic location is hg38 chr1: 226372287-226372167), AMP2110 (CpG6-CpG8, specific genomic location is hg38 chr1:226372134-226372009), AMP1948 (CpG9-CpG11, specific genomic location is hg38 chr1: 226371978-226371882), AMP1787 (CpG13-CpG16, specific genomic location is hg38 chr1: 226371814-226371711), and AMP1333 (CpG18-CpG20, specific genomic location is hg38 chr1: 226371363-226371254), 5 sets of primers and probes were designed according to the MethyLight rules, and the primers and probes were optimized to achieve the best specificity and sensitivity. As shown in Table 4, SEQ ID No. 1-21 shows the specific primers and probe sequences used according to the present invention. The present invention uses positive samples (gDNA extracted and transformed from B lymphocytes) and negative samples (gDNA extracted and transformed from non-B lymphocytes) as templates for the qPCR detection platform TPG system, and uses ΔCt (Ct 阴性 -Ct 阳性 )) The specificity of the amplicon for identifying B lymphocytes was evaluated. The higher the ΔCt value, the better the specificity for B lymphocytes. The results of qPCR are shown in Table 5. The primer probe corresponding to AMP1333 showed the largest ΔCt, indicating that this amplicon has good specificity and sensitivity and can be used as a biomarker for the identification of B lymphocytes.

[0036] Preferably, Figure 2 The underlined positions (genomic mapping hg38 chr1: 226371363-226371254) show the CPG sites analyzed on the amplicons identified for the identification of PARP1 target genes in B lymphocytes. The horizontal boxes correspond to the CPG positions (CPG18, 19, 20) in the analyzed amplicons, and the positions indicated (hg38 chr1: 226371333, hg38 chr1: 226371325, hg38 chr1: 226371279) correspond to CPG18, 19, 20.

[0037] SEQ ID No. 22 and SEQ ID No. 23 show the DNA sequences of the target gene amplicons converted by bisulfite according to the qPCR and digital PCR detection systems of the present invention. The methylated "CG" sites still maintain the differential methylation sites of "CG" and the specific primers and probes for detecting the sites. The TPG system refers to the conversion of the unmethylated "CG" sites of the target gene amplicons into differential methylation sites of "TG" and the specific primers and probes for detecting the sites after the DNA sequences of the target gene amplicons are converted by sulfate.

[0038] Preferably, the CPG (methylation site detection) system-specific amplicon (SEQ ID No. 22): GGAAGTGTTGGATATGTAGAAATGGAAAGGCGTAGTTACGGTTTTTAGGGAGTTTAGAAGGGTTTTATTGGTAAAGTTTTAGAGACGATGTTTTAGGATATAGAGTGTGG Preferably, the TPG (detection of unmethylated sites) system-specific amplicon (SEQ ID No. 23): GGAAGTGTTGGATATGTAGAAATGGAAAGGTGTAGTTATGGTTTTTAGGGAGTTTAGAAGGGTTTTATTGGTAAAGTTTTAGAGATGATGTTTTAGGATATAGAGTGTGGG Table 4 Sequences of primers and probes specific for target gene PARP1

[0039] Table 5 qPCR amplification results of 5 sets of primer probes

[0040] Example 3 Validation of TPG and CPG specific PCR systems The specificity of the PCR system was verified using a test template (plasmid DNA). Two templates with different concentration gradients were set up. The sequence of the C plasmid was the same as SEQ ID No. 22, and the sequence of the T plasmid was the same as SEQ ID No. 23. The TPG and CPG systems were tested by PCR amplification. The results were as follows: Figure 3 and Figure 4 shown.

[0041] Depend on Figure 3It can be seen that when the added template is a high-concentration T plasmid or a high-concentration T plasmid diluted 100 times, the qPCR amplification curve is a typical S amplification curve, but when the template is a high or low-concentration C plasmid, the amplification curve does not appear, which is consistent with the amplification of NTC. The above results prove that the primer probe of the TPG system has good specificity.

[0042] Depend on Figure 4 It can be seen that when the added template is a high-concentration T plasmid or a high-concentration C plasmid diluted 100 times, the qPCR amplification curve is a typical S amplification curve, but when the template is a high or low-concentration T plasmid, the amplification curve does not appear, which is consistent with the amplification of NTC. The above results prove that the primer probe of the CPG system has good specificity.

[0043] In addition, methylation standards with a methylation rate of 0% and 100% were used to verify the specificity of the TPG and CPG systems. The methylation standards were from QIAGEN. Figure 5 and 6 It is known that when the 0% methylation standard is used as a template, the TPG system produces a typical amplification curve, while the CPG system does not. Similarly, when the 100% methylation standard is used as a template, the CPG system produces a typical amplification curve, while the TPG system does not. The above results show that the primer probe specificity of the TPG and CPG systems is good.

[0044] Considering the differences in methylation levels in actual samples, the specificity of the PCR system was further verified using gradient methylation standards. To this end, a methylation standard with a methylation rate of 0% was mixed with a methylation standard with a methylation rate of 100% to simulate methylation values ​​in the range of 0%-100%. Then, the ratio (%) of TPG templates in these mixtures was detected using the assay of the present invention. The results are shown in FIG. Figure 7 and Figure 8 As shown in Figure 2, when the methylation ratio changes from 0% to 100%, the ratio calculated by the digital PCR test also changes in the same way, showing a good linear relationship (R 2 = 0.9982). The test results of the gradient methylation standard fully demonstrate that the TPG and CPG systems have good specificity and can distinguish different methylation levels.

[0045] Example 4 Validation of PARP1 target gene as a B lymphocyte-specific marker Purified cells were used to verify the specificity of PARP1 as a B lymphocyte marker. To this end, the DNA extracted and transformed from lymphocytes (T lymphocytes, CD4+ T lymphocytes, CD8+ T lymphocytes, B lymphocytes and NK cells) purified by magnetic bead sorting was used as a template, and the copy number of the target gene PARP1 and the internal reference gene RPP30 were directly obtained using a digital PCR platform. The relative content of each cell subset can be directly calculated using the formula: relative content of cell subsets (%) = number of copies of the PARP1 target gene / number of copies of the internal reference gene × 100. Fig. 9 It is known that the proportion of B lymphocytes detected by the TPG system is very high, while the proportion of T lymphocytes, CD4+T lymphocytes, CD8+T lymphocytes and NK cells is <1.7%, and the results of the test are very consistent with those of flow cytometry. The above results also show that PARP target genes can be used as B lymphocyte-specific markers.

[0046] Example 5 Determination of B lymphocyte content in actual samples The PARP1 primer probe of the present invention is used to quantify the B lymphocyte content (%) in the neonatal dry blood spot sample. XLA is the most serious disease among B lymphocyte immunodeficiency diseases. XLA patients cannot produce mature B lymphocytes, which affects humoral immunity and increases the chance of severe and fatal bacterial infections. Digital PCR detection obtains the copy number of the PARP1 gene and the internal reference gene. The relative content of B lymphocytes in white blood cells can be calculated using the formula: B lymphocyte proportion (%) = PARP1 target gene copy number / reference gene copy number × 100. As shown in Table 6, the target gene copy number of XLA samples is 3-13 copies / µL, accounting for 0.2-1.6% in white blood cells, while the target gene copy number of normal newborn samples is 40-288 copies / µL, accounting for 3.9-8.8% in white blood cells. The above results show that the method provided by the present invention can significantly distinguish XLA children from normal newborns, and can serve the screening of primary immunodeficiency diseases in newborns.

[0047] Table 6 Quantification of PARP1 gene and proportion of B lymphocytes in dried blood spot samples

[0048] It should be understood that the disclosed invention is not limited only to the specific method, scheme and material of description, because these all can change.It should also be understood that the terminology used herein is only for the purpose of describing specific embodiment scheme, rather than being intended to limit the scope of the present invention, and the scope of the present invention is only limited to the appended claims.

[0049] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.

Claims

1. A kit for realizing human B lymphocyte counting based on gene methylation detection, characterized in that: The kit is a kit for detecting PARP1 gene methylation in a sample.

2. The kit according to claim 1, characterized in that The kit is used to detect the differentially methylated region hg38 chr1: 226372321-226371196 on the PARP1 gene.

3. The kit according to claim 2, characterized in that The kit is a kit for detecting the differentially methylated region hg38 chr1: 226371254-226371363 on the PARP1 gene.

4. The kit according to claim 1, characterized in that The kit is a kit for detecting a gene region comprising at least one of the differentially methylated sites hg38 chr1: 226371196, hg38 chr1: 226371228, hg38 chr1: 226371279 and hg38 chr1: 226371333 on the PARP1 gene.

5. The kit according to claim 1, characterized in that The kit calculates the proportion of human B lymphocytes to human leukocytes by detecting the copy numbers of the internal reference gene and the PARP1 gene.

6. The kit according to claim 5, characterized in that The internal reference gene is the RPP30 gene.

7. The kit according to claim 5, characterized in that The kit is a sequencing kit, a quantitative PCR kit or a digital PCR kit.

8. The kit according to claim 7, characterized in that The kit comprises: primers and probes for detecting the methylation status of CpG sites in the region of hg38 chr1:226371254-226371363 and primers and probes for detecting the copy number of an internal reference gene.

9. The kit according to claim 8, characterized in that The kit includes: an upstream primer SEQ ID No. 13 GGAAGTGTTGGATATGTAGAAATGG, a downstream primer SEQ ID No. 14: CCCACACTCTATATCCTAAAACATCA, and a probe SEQ ID No. 15: AGGTGTAGTTATGGGTT.

10. The kit according to claim 1, characterized in that The sample is selected from a peripheral blood sample, a capillary blood sample or a venous blood.

Images