Application of TFE3 in regulation and control of SLCO4A1 and treatment of cancer

Abstract

The invention provides an application of TFE3 in regulation and control of SLCO4A1 and treatment of cancers. The invention provides application of an inhibitor of SLCO4A1 and a reagent for inhibiting binding of TFE3 and SLCO4A1 in preparation of drugs for treating cancers, and further provides a compound containing TFE3 and SLCO4A1 and application of the compound in screening of drugs for treating cancers. The invention also provides a method for regulating the expression of the SLCO4A1 in the cells and constructing the cell model for the overexpression of the SLCO4A1 or the low expression of the SLCO4A1, a new thought is provided for the treatment of cervical cancer, and the method has a wide application prospect.

Description

Technical Field

[0001] The present application relates to the field of biomedicine, and specifically to the application of TFE3 in regulating SLCO4A1 and treating cancer. Background Art

[0002] Cervical cancer is a malignant tumor with a morbidity second only to breast cancer for humans, especially women. It ranks second in cancer mortality among women. Its causes include unhealthy sexual life, early childbearing age, contempt, unbalanced nutrients, smoking, viral infection (such as HPV), etc. At present, the examination and diagnosis methods for cervical cancer include cytological diagnosis, virus detection and detection of specific markers. In clinical practice, radiotherapy, chemotherapy, surgery, drugs and other methods are often used for treatment. At present, gene therapy is still on the rise.

[0003] SLCO4A1 is a membrane transporter protein that belongs to the solute carrier organic anion transporter family member 4A1. As a membrane transporter, SLCO4A1 plays a role in the transport of substances inside and outside the cell. In recent years, the role of SLCO4A1 in cancer has gradually attracted attention. Studies have shown that SLCO4A1 may serve as a prognostic biomarker for non-small cell lung cancer and promote cancer cell proliferation and migration. However, there are currently few studies on SLCO4A1 for cervical cancer. Given the important role of SLCO4A1 in substance transport, exploring the role of SLCO4A1 in cervical cancer and clarifying the mechanism of regulating SLCO4A1 are of great significance for exploring new therapeutic targets for cervical cancer. Summary of the invention

[0004] In view of the above problems, the purpose of the present invention is to explore the role of SLCO4A1 in cervical cancer and the role of TFE3 in regulating SLCO4A1.

[0005] In order to achieve the above object, the present invention adopts the following technical solution: The first aspect of the present invention provides any of the following applications: (1) Application of SLCO4A1 inhibitors in the preparation of drugs for treating cancer; (2) Application of SLCO4A1 in screening candidate drugs for cancer treatment; (3) Use of agents that inhibit the binding of TFE3 and SLCO4A1 in the preparation of drugs for treating cancer; (4) Application of the complex formed by the binding of TFE3 and SLCO4A1 in screening drugs for treating cancer; (5) Application of the complex formed by the binding of TFE3 and SLCO4A1 in screening agents that inhibit the binding of TFE3 and SLCO4A1; (6) Application of TFE3 in the preparation of SLCO4A1 expression regulators in cells; (7) Application of TFE3 in preparing cell models of SLCO4A1 overexpression and / or SLCO4A1 underexpression.

[0006] Furthermore, the SLCO4A1 inhibitor reduces the expression level of SLCO4A1.

[0007] Furthermore, the inhibitors include nucleic acid inhibitors, protein inhibitors, and compounds.

[0008] Furthermore, the nucleic acid inhibitors include siRNA, shRNA, ribozymes, and antisense oligonucleotides.

[0009] Preferably, the sequence of the shRNA is shown as SEQ ID No.1.

[0010] In the present invention, an inhibitor refers to an inhibitor that can specifically bind to SLCO4A1, preferably human SLCO4A1, or to a polynucleotide or a fragment thereof that binds to SLCO4A1, and inhibits the activity and / or expression of SLCO4A1 protein or polynucleotide, including nucleic acid inhibitors, protein inhibitors, and compounds.

[0011] Among them, the protein inhibitor includes an antibody, which is a monoclonal, chimeric, human or humanized antibody, or an antibody fragment or a synthetic antibody.

[0012] The nucleic acid inhibitor is unmodified or modified with one or more chemical groups selected from the group consisting of: 2'O-methoxy, phosphorothioate, locked nucleic acid and cholesterol.

[0013] In the present invention, modified refers to the change of the compound, usually chemical, to add or remove functional groups to the chemical structure of the compound. This modification generally relates to the covalent addition of reagents or functional groups to the compound. On the contrary, unmodified refers to the fact that the compound has not been chemically changed from the most common form and / or the form found in nature or under standard conditions. These modifications can be found in proteins, and these modifications include but are not limited to acylation (e.g., myristoylation, palmitoylation), isoprenylation (isoprenylation) or prenylation (prenylation), glycosylphosphatidylinositolization (glypiation), glycosylphosphatidylinositol (GPI) anchor addition, lipoylation, addition of flavin moieties (e.g., FMN or FAD), addition of heme groups, phosphopantetheinylation, retinyl Schiff bases, glycosylation, fucosylation, alkylation, amidation, amide bond formation, hydroxylation, phosphate (O- connection) or phosphoramidate (N- connection) formation, pegylation, biotinylation, carbamylation, oxidation and combinations thereof.

[0014] In the present invention, locked nucleic acid (LNA) refers to a modified RNA nucleotide. The ribose moiety of the LNA nucleotide is modified with an additional bridge connecting the 2' oxygen and the 4' carbon. The bridge "locks" the ribose in a 3'-endo (north) conformation, which is the same conformation often found in A-form duplexes. Whenever necessary, the commonly synthesized locked nucleic acid nucleotides can be mixed with DNA or RNA residues in oligonucleotides and hybridized with DNA or RNA according to the Watson-Crick base pairing rules. The locked ribose conformation enhances base stacking and backbone pre-organization.

[0015] In an embodiment of the present invention, the inhibitor is selected from nucleic acid inhibitors, including siRNA, shRNA, ribozyme, antisense oligonucleotide.

[0016] Among them, siRNA (small interfering RNA) refers to an isolated RNA molecule, preferably greater than 10 nucleotides in length, more preferably greater than 15 nucleotides in length, and most preferably 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, which is used to identify a target gene or mRNA to be degraded. The range of 19 to 25 nucleotides is the most preferred size for siRNA.

[0017] siRNA can include partially purified RNA, substantially pure RNA, synthetic RNA or recombinantly produced RNA and RNA that is modified from natural RNA by addition, deletion, substitution and / or change of one or more nucleotides. The changes may include the addition of non-nucleotide substances, such as addition to the end of the siRNA or one or more internal nucleotides of the siRNA; modifications that make the siRNA resistant to nuclease digestion (e.g., using 2'-substituted ribonucleotides or modifying the sugar-phosphate backbone); or replacing one or more nucleotides in the siRNA with deoxyribonucleotides. In addition, as described above for modified oligonucleotides, the siRNA can be modified to improve its stability, especially by introducing one or more phosphorothioate linkages.

[0018] shRNA (small hairpin RNA) is a non-coding small RNA molecule that can form a hairpin structure. shRNA can inhibit gene expression through the RNA interference pathway.

[0019] Antisense oligonucleotides (antisense nucleic acid sequences) may include a nucleotide sequence that is complementary to a sense nucleic acid encoding a protein (e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to SLCO4A1 mRNA). Antisense oligonucleotides and delivery methods are well known in the art (Goodchild, Curr. Opin. Mol. Ther., 6(2): 120-28 (2004); Clawson et al., Gene Ther., 11(17): 1331-1341 (2004)), which are incorporated herein by reference in their entirety. Antisense oligonucleotides may be complementary to the entire coding strand of the target sequence, or only to a portion thereof. In another embodiment, the antisense oligonucleotide is antisense to a non-coding region of the coding strand of a nucleotide sequence in SLCO4A1 mRNA. An antisense oligonucleotide can be, for example, about 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more nucleotides in length.

[0020] Ribozymes are a class of RNAs that can be engineered to enzymatically cleave and inactivate other RNA targets in a specific, sequence-dependent manner. Ribozymes and methods of delivering them are well known in the art (Hendry et al., BMC Chem. Biol., 4(1): 1 (2004); Grassi et al., Curr. Pharm. Biotechnol., 5(4): 369-386 (2004); Bagheri et al., Curr. Mol. Med., 4(5): 489-506 (2004); Kashani-Sabet M., Expert Opin. Biol. Ther., 4(11): 1749-1755 (2004), each of which is incorporated herein by reference in its entirety. By cleaving the target RNA, ribozymes inhibit translation, thereby preventing expression of the target gene. Ribozymes can be chemically synthesized in the laboratory and structurally modified to increase their stability and catalytic activity using methods known in the art. Alternatively, the ribozyme gene can be introduced into the cell by gene delivery mechanisms known in the art.

[0021] Furthermore, the action site of the agent that inhibits the binding between TFE3 and SLCO4A1 is on the promoter region of SLCO4A1.

[0022] Furthermore, the action site of the agent that inhibits the binding between TFE3 and SLCO4A1 is on the CACGTG sequence in the promoter region of SLCO4A1.

[0023] In the embodiments of the present invention, the applicant uses Jaspar-scan to predict the binding sites of TFE3 and SLCO4A1. Specifically, visit the Jaspar database website, enter the name of the transcription factor TFE3 in the search box, use the "Scan" function, enter the promoter sequence of SLCO4A1, and Jaspar-scan will analyze the sequence and list possible transcription factor binding sites and their corresponding scores.

[0024] Furthermore, the cancer includes gastric cancer, breast cancer, ovarian cancer, bladder cancer, lung cancer, colon cancer, rectal cancer, prostate cancer, blood cancer, lymphoma, cervical cancer, osteosarcoma, glioblastoma, melanoma, pancreatic cancer, liver cancer, kidney cancer, gallbladder cancer, bile duct cancer, esophageal cancer or neuroblastoma.

[0025] Furthermore, the cancer is selected from cervical cancer.

[0026] Furthermore, the cancer cells are selected from cervical cancer cells.

[0027] A second aspect of the present invention provides a pharmaceutical composition for treating cancer.

[0028] Furthermore, the pharmaceutical composition comprises an inhibitor of SLCO4A1 and / or an agent that inhibits the binding between TFE3 and SLCO4A1.

[0029] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable carrier and / or excipient.

[0030] Furthermore, the cancer includes gastric cancer, breast cancer, ovarian cancer, bladder cancer, lung cancer, colon cancer, rectal cancer, prostate cancer, blood cancer, lymphoma, cervical cancer, osteosarcoma, glioblastoma, melanoma, pancreatic cancer, liver cancer, kidney cancer, gallbladder cancer, bile duct cancer, esophageal cancer or neuroblastoma.

[0031] Furthermore, the cancer is selected from cervical cancer.

[0032] In the present invention, pharmaceutically acceptable refers to those compounds, materials, compositions and / or dosage forms that are suitable, within the scope of sound medical judgment, for contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response or other problems commensurate with a reasonable benefit / risk ratio.

[0033] Pharmaceutically acceptable carriers include any and all solvents, diluents, buffers (e.g., neutral buffered saline, or optionally Tris-HCl, acetate or phosphate buffers), solubilizers (e.g., polysorbate 80), colloids, dispersion media, vehicles, fillers, chelating agents (e.g., EDTA or glutathione), amino acids (e.g., glycine), proteins, disintegrants, binders, lubricants, wetting agents, stabilizers, emulsifiers, sweeteners, colorants, flavoring agents, aromatiser, thickeners, substances to obtain a storage effect, coating agents, antifungal agents, preservatives (e.g., Thimerosal™, benzyl alcohol), antioxidants (e.g., ascorbic acid, sodium metabisulfite), tonicity control agents, absorption delaying agents, adjuvants, bulking agents (e.g., lactose, mannitol), etc. The use of such media and agents for formulating pharmaceutical compositions is well known in the art. Unless any conventional media or agents are incompatible with the active ingredient, their use in pharmaceutical compositions is contemplated. Suitable pharmaceutically acceptable carriers are described, inter alia, in Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Co., Easton, PA (1990).

[0034] Pharmaceutical compositions can be prepared in a manner known to those skilled in the art. The exact nature of the carrier or other raw materials depends on the route of administration. Such suitable administration forms, which may be solid, semisolid, or liquid (depending on the mode of administration and the methods and carriers used for its preparation), will be clear to the skilled person; reference is made, for example, to standard manuals such as Remington's Pharmaceutical Sciences (see above).

[0035] The pharmaceutical compositions of the present invention can be administered parenterally (e.g., by intravenous, intracerebral, intracerebroventricular, intramuscular, subcutaneous (intraperitoneal) injection, or intravenous infusion) in the form of a parenterally acceptable aqueous solution that is pyrogen-free and has suitable pH, isotonicity and stability.

[0036] The pharmaceutical compositions according to the invention can be administered orally, for example in the form of pills, tablets, lacquered tablets, sugar-coated tablets, granules, hard and soft gelatin capsules, aqueous, alcoholic or oily solutions, syrups, emulsions or suspensions, or rectally, for example in the form of suppositories, or transdermally or topically, for example in the form of ointments, tinctures, sprays or transdermal therapeutic systems, or by inhalation, for example in the form of nasal sprays or aerosol mixtures, or in the form of microcapsules, implants or rods.

[0037] In the present invention, treatment / prevention may refer to therapeutic treatment or preventive measures, wherein the goal is to prevent or slow down (mitigate) an undesirable physiological condition, disorder or disease, or to obtain a beneficial or desired clinical result. In the present invention, treatment / prevention may refer to both treatment and prevention. Beneficial or desired clinical results include, but are not limited to, relief of symptoms; alleviation of the extent of a disorder, disorder or disease; stabilization (i.e., not worsening) of the state of a disorder, disorder or disease; delaying the occurrence of a disorder, disorder or disease or slowing its progression; improving a disorder, disorder or disease state; and alleviation (whether partial or complete) (whether detectable or undetectable) or improvement or improvement of a disorder, disorder or disease. Treatment may include causing a clinically significant response without excessive side effects. Treatment also includes a prolonged survival period compared to the expected survival period when not receiving treatment.

[0038] In the present invention, including or comprising is inclusive or open-ended and does not exclude additional, unrecited members, elements or method steps. The term also includes consisting of and consisting essentially of.

[0039] According to a third aspect of the present invention, a composite is provided.

[0040] Furthermore, the complex comprises TFE3 and SLCO4A1.

[0041] Furthermore, the TFE3 binds to the promoter region of SLCO4A1.

[0042] A fourth aspect of the present invention provides a method for screening drugs for treating cancer.

[0043] Further, the method comprises: (1) contacting the test substance with a system expressing or containing SLCO4A1; (2) detecting the expression level of SLCO4A1 in the system; (3) Selecting substances that can reduce the expression level of SLCO4A1 as candidate drugs for treating or preventing cancer.

[0044] Or the method comprises: (1) contacting the test substance with a system containing a complex formed by TFE3 and SLCO4A1; (2) detecting the binding level of TFE3 and SLCO4A1 in the system; (3) Select substances that can reduce the binding level of TFE3 and SLCO4A1 as candidate drugs for treating or preventing cancer.

[0045] Furthermore, the system is selected from: a cell system, a subcellular system, a solution system, a tissue system, an organ system or an animal system.

[0046] Furthermore, the cancer includes gastric cancer, breast cancer, ovarian cancer, bladder cancer, lung cancer, colon cancer, rectal cancer, prostate cancer, blood cancer, lymphoma, cervical cancer, osteosarcoma, glioblastoma, melanoma, pancreatic cancer, liver cancer, kidney cancer, gallbladder cancer, bile duct cancer, esophageal cancer or neuroblastoma.

[0047] Furthermore, the cancer is selected from cervical cancer.

[0048] A fifth aspect of the present invention provides a method for regulating the expression of SLCO4A1 in a cell.

[0049] Further, the method comprises altering the expression of TFE3 in the cell.

[0050] Furthermore, the method for promoting the expression of SLCO4A1 in a cell includes promoting the expression of TFE3 in the cell.

[0051] Furthermore, promoting the expression of TFE3 in the cell includes administering a TFE3 promoter to the cell.

[0052] Furthermore, the method of inhibiting the expression of SLCO4A1 in a cell comprises inhibiting the expression of TFE3 in the cell.

[0053] Further, inhibiting the expression of TFE3 in the cell comprises administering a TFE3 inhibitor to the cell.

[0054] Furthermore, the cells are selected from cervical cancer cells.

[0055] In some embodiments, promoting the expression of TFE3 in cells comprises administering a promoter of TFE3 to cells; the promoter promotes the expression level of TFE3. In the present invention, the promoter refers to any substance that can increase the activity of TFE3 protein, improve the stability of TFE3 gene or protein, upregulate the expression of TFE3 protein, increase the effective action time of TFE3 protein, or promote the transcription and translation of TFE3 gene, and these substances can be used in the present invention. For example, the promoter includes a vector for overexpression of TFE3.

[0056] In some embodiments, inhibiting the expression of TFE3 in a cell comprises administering a TFE3 inhibitor to the cell; the inhibitor inhibits the expression level of TFE3. In the present invention, an inhibitor refers to a compound that can specifically bind to TFE3, or bind to a polynucleotide or a fragment thereof that binds to TFE3, and inhibits the activity and / or expression of a TFE3 protein or polynucleotide. It includes nucleic acid inhibitors, protein inhibitors, and compounds.

[0057] A fifth aspect of the present invention provides a method for constructing a cell model of SLCO4A1 overexpression or SLCO4A1 underexpression.

[0058] Further, the method comprises regulating the expression of TFE3 in the cell.

[0059] Furthermore, the method for constructing a cell model of SLCO4A1 overexpression includes promoting the expression of TFE3 in cells.

[0060] Furthermore, the promoting the expression of TFE3 in the cells comprises administering a TFE3 promoter to the cells.

[0061] Furthermore, the method for constructing a cell model with low expression of SLCO4A1 includes inhibiting the expression of TFE3 in cells.

[0062] Further, inhibiting the expression of TFE3 in the cell comprises administering a TFE3 inhibitor to the cell.

[0063] Furthermore, the cells are selected from cervical cancer cells.

[0064] A sixth aspect of the present invention provides a method for constructing a hypoxic cell model.

[0065] Further, the method includes promoting the binding of TFE3 and SLCO4A1 in the cell.

[0066] Furthermore, the cells are selected from cervical cancer cells.

[0067] The seventh aspect of the present invention provides a method for computer-assisted screening of drugs based on TFE3 and SLCO4A1.

[0068] Further, the method comprises: Obtain TFE3 protein data; Screening of TFE3 protein structural analogs based on the spatial structure of TFE3 protein; Perform molecular docking of the TFE3 protein structural analogs with SLCO4A1, calculate affinity / binding energy to obtain scores, and rank them according to the scores to obtain candidate drugs; Or the method comprises: Obtain SLCO4A1 gene data; Screening of SLCO4A1 structural analogs based on the spatial structure of SLCO4A1; Performing molecular docking of the SLCO4A1 structural analogs with the TFE3 protein, calculating affinity / binding energy to obtain scores, and ranking according to the scores to obtain candidate drugs; Or the method comprises: Obtain TFE3 protein data and SLCO4A1 gene data; Determine the binding site of the two according to the TFE3 protein data and the SLCO4A1 gene data; Through computer-assisted screening, candidate drugs that simultaneously target the binding sites of the two are obtained.

[0069] Through computer-assisted screening, candidate drugs that simultaneously target the binding sites of the two are obtained.

[0070] Furthermore, the specific steps of obtaining candidate drugs that simultaneously target the binding sites of the two through computer-assisted screening include: screening compounds that target the binding sites based on the spatial structure of the binding sites; molecularly docking the compounds with TFE3 and SLCO4A1, calculating the affinity / binding energy to obtain scores, and ranking according to the scores to obtain candidate drugs.

[0071] In some embodiments, the molecular libraries used in virtual screening are mainly the following: ZINC: contains more than 250 million commercially available compounds for small molecule virtual screening.

[0072] PubChem: contains bioactive substances for small molecule virtual screening.

[0073] DrugBank: Contains drugs and small molecules for drug design and discovery.

[0074] ChEMBL: Contains small molecules and is used for drug discovery and chemical genomics research.

[0075] ChemDB: Contains a large number of known small molecules for chemical genomics research and drug discovery.

[0076] HMDB: Contains a large number of known small molecules for use in chemical genomics research and drug discovery.

[0077] BindingDB: Contains a large number of known small molecules for chemical genomics research and drug discovery.

[0078] SMPDB: Contains a large number of known small molecules for chemical genomics research and drug discovery.

[0079] In addition, there are some commercial databases such as ChemDiv, Enamine, Lifechemicals, Specs, Chembridge, Maybridge, Microsource, Vitas-M and Interbioscreen, which are also often used for virtual screening.

[0080] In some embodiments, in molecular docking, affinity refers to how tightly a molecule binds to a receptor. A high affinity means that the binding is more stable, while a low affinity means that the binding is less stable. Affinity is usually calculated, for example, by calculating the binding free energy (ΔG) or the binding constant (Kd).

[0081] In the process of molecular docking, affinity depends on the interaction between molecules and receptors, including hydrogen bonds, van der Waals forces, electrostatic interactions, etc. These interactions jointly determine the binding mode between molecules and receptors, thus affecting affinity.

[0082] In order to evaluate affinity, some scoring systems or scoring methods are usually used to quantify the interaction between molecules and receptors. These scoring methods are based on different algorithms and physical models, which can reflect the binding energy, interaction type and affinity between molecules and receptors.

[0083] In some embodiments, the compound comprises a protein analog, an antibody, DNA, or RNA.

[0084] In some embodiments, protein analogs refer to substances that have similar structures and functions to certain proteins in the body. They can mimic the functions of proteins and thus play an important role in the treatment of diseases. For example, insulin is a protein analog used to treat diabetes.

[0085] Antibodies are immunoglobulins produced by plasma cells differentiated from B lymphocytes under antigen stimulation, which can specifically bind to the corresponding antigen. The structure of antibodies is mainly divided into two parts: constant region and variable region. In a given species, the constant regions of different antibody molecules have the same or almost the same amino acid sequence. The variable region is located at the ends of the two arms of the "Y".

[0086] RNA drugs are a class of drugs designed based on the characteristics of RNA and its mechanism of action in cells. RNA can act as messenger RNA (mRNA) to guide protein synthesis in cells, or as microRNA (miRNA) to regulate gene expression.

[0087] Therefore, rationally designed RNA drugs can be used to regulate gene expression in cells to achieve the purpose of treating diseases. For example, many studies are exploring the use of mRNA vaccines to prevent and treat various infectious diseases.

[0088] DNA medicine is a new type of treatment developed based on genetic engineering technology. It aims to achieve therapeutic goals by affecting the structure and function of DNA, interfering with nucleic acid biosynthesis or transcription process.

[0089] In some embodiments, the compound includes but is not limited to oxides, acids, bases, salts, and organic matter. In some embodiments, the oxide is a compound composed of two elements, one of which is oxygen. In some embodiments, the acid is a compound in which all cations generated upon ionization are hydrogen ions. In some embodiments, the base is a compound in which all anions generated upon ionization are hydroxide ions. In some embodiments, the salt is a compound that generates metal cations (or ammonium ions) and acid ions upon ionization. In some embodiments, the organic matter is a general term for carbon-containing compounds (excluding carbon monoxide, carbon dioxide, carbonates, metal carbides, and cyanides) or hydrocarbons and their derivatives.

[0090] In some embodiments, pharmaceutically acceptable salt forms refer to pharmaceutically acceptable salts, including salts prepared from pharmaceutically acceptable bases or acids.

[0091] In some embodiments, examples of pharmaceutically acceptable bases include, but are not limited to, sodium, potassium, ammonium, calcium, magnesium, iron, zinc, copper, magnesium, aluminum, primary amines, secondary amines, tertiary amines, substituted amines (including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins) such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-diethylaminoethanol, trimethylamine, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrazine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, and polyamine resins.

[0092] In some embodiments, examples of pharmaceutically acceptable acids include, but are not limited to, inorganic acids and organic acids such as acetic acid, alginic acid, anthranilic acid, benzenesulfonic acid, benzoic acid, camphorsulfonic acid, citric acid, vinylsulfonic acid, formic acid, fumaric acid, furoic acid, galacturonic acid, gluconic acid, glucuronic acid, glutamic acid, glycolic acid, hydrobromic acid, hydrochloric acid, isethionic acid, lactic acid, maleic acid, malic acid, mandelic acid, methanesulfonic acid, mucic acid, nitric acid, pamoic acid, pantothenic acid, phenylacetic acid, phosphoric acid, propionic acid, salicylic acid, stearic acid, succinic acid, sulfanilic acid, sulfuric acid, tartaric acid, and p-toluenesulfonic acid.

[0093] In some embodiments, the effectiveness of the candidate drug is verified by treating cervical cancer cells or cervical cancer animal models with the screened candidate drug. Specifically, a certain concentration of the screened drug is administered to cervical cancer cells or animal models, and the growth and proliferation of the cancer cells or the size of the cancer tissue in the animal model after the administration of the screened drug is observed.

[0094] The eighth aspect of the present invention provides a computer-aided drug screening system based on TFE3 and SLCO4A1.

[0095] Further, the system comprises: Data acquisition unit: obtain TFE3 protein data; Structural analogue screening unit: Screening TFE3 protein structural analogues based on the spatial structure of TFE3 protein; Candidate drug acquisition unit: molecular docking the TFE3 protein structure analogs with SLCO4A1, calculating affinity / binding energy to obtain scores, and ranking according to the scores to obtain candidate drugs.

[0096] Or the system comprises: Data acquisition unit: acquiring the gene data of SLCO4A1; Structural analog screening unit: Screening SLCO4A1 structural analogs based on the spatial structure of SLCO4A1; Candidate drug acquisition unit: perform molecular docking between structural analogs and TFE3 protein, calculate affinity / binding energy to obtain scores, and sort according to the scores to obtain candidate drugs; Or the system comprises: Data acquisition unit: obtain TFE3 protein data and SLCO4A1 gene data; A site determination unit: determining the binding site of the two genes according to the TFE3 gene data and the SLCO4A1 gene data; Candidate drug acquisition unit: obtains candidate drugs that simultaneously target the binding sites of the two through computer-assisted screening.

[0097] The ninth aspect of the present invention provides a device for computer-assisted screening of drugs based on TFE3 and SLCO4A1.

[0098] Furthermore, the device comprises: A memory and a processor, wherein the memory is used to store program instructions; the processor is used to call the program instructions, and when the program instructions are executed, the computer-assisted drug screening method described in the seventh aspect of the present invention is implemented.

[0099] A tenth aspect of the present invention provides a computer-readable storage medium having a computer program thereon.

[0100] Furthermore, the computer-readable storage medium includes: when the computer program is executed by a processor, the method for computer-assisted drug screening described in the seventh aspect of the present invention is implemented.

[0101] Advantages of the present invention: The present invention discovers for the first time that SLCO4A1 has a carcinogenic effect in cervical cancer cells, and indicates that inhibiting SLCO4A1 can inhibit the growth of cervical cancer cells; and further indicates that TFE3 can regulate the expression of SLCO4A1, thereby providing a cell model with low or overexpression of SLCO4A1, and providing an experimental model for further studying the role of SLCO4A1 in cervical cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0102] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative work.

[0103] Figure 1 The correlation between SLCO4A1 and cervical cancer provided in the embodiment of the present invention; (A) After HeLa cells were cultured under normoxia, hypoxia and Antimycin A (1 μM) conditions for 8 hours, transcriptomic sequencing was used to screen differentially expressed SLCs, and the heat map showed 15 SLCs that were significantly upregulated by both hypoxia and Antimycin A (p<0.05); (B) WB confirmed that HeLa / shScr, HeLa / shSLCO4A1 and HeLa / shSLCO4A1 / SLCO4A1 cell lines were successfully constructed; (C)-(E) Nude mouse transplant tumor models proved that downregulating SLCO4A1 significantly inhibited tumor growth in vivo; Figure 2 The TFE3 provided in the embodiment of the present invention can regulate the mRNA and protein expression of SLCO4A1 in cervical cancer cells; (A) Schematic diagram showing the SLCO4A1 promoter region, marking the region where TFE3 may bind to SLCO4A1; (B) qRT-PCR detection of the expression of TFE3 and SLCO4A1 after transfection of TFE3 (Flag) in tumor cells; (C) WB detection of the expression of TFE3 and SLCO4A1 after transfection of TFE3 (Flag) in tumor cells; Figure 3The TFE3 provided in the embodiment of the present invention can directly bind to SLCO4A1; (A) HeLa cells were cultured under normoxic and hypoxic conditions, and the relative luciferase activity was detected by dual luciferase reporter gene experiment; (B) The SLCO4A1 promoter sequence was co-transfected with the TFE3 overexpression or GFP control plasmid to HeLa cells, and the relative luciferase activity was detected; then the nucleic acid sequence that may bind to the two was mutated, and the relative luciferase activity was detected; (C) HeLa cells were cultured under normoxic and hypoxic conditions, and the chromatin immunoprecipitation technique (CHIP) was used to detect whether TFE3 directly binds to the SLCO4A1 promoter; Figure 4 The results of the results that TFE3's cancer-promoting effect depends on SLCO4A; (A) The effect of knocking down TFE3 on SLCO4A1 expression in the cervical cancer cell line HeLa; (BD) Nude mouse tumor formation experiments showed the effect of downregulating TFE3 on the growth of tumor cells in vivo; Figure 5 A schematic flow chart of a method for computer-aided drug screening based on TFE3 and SLCO4A1 provided in an embodiment of the present invention; Figure 6 A schematic diagram of a computer-aided drug screening system based on TFE3 and SLCO4A1 provided in an embodiment of the present invention; Figure 7 Schematic diagram of a device for computer-assisted screening of drugs based on TFE3 and SLCO4A1 provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0104] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0105] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the reagents, biological materials, etc. used in the following examples are all commercially available unless otherwise specified.

[0106] Example 1 SLCO4A1 inhibits the growth of cervical cancer cells in vivo 1. Experimental methods (1) Transcriptome sequencing: 6 million cervical cancer cells HeLa were inoculated into a 10 cm cell culture dish. After overnight adherence, new DMEM culture medium (10% dialyzed fetal bovine serum, 25 mM glucose, 2 mM glutamine, and no pyruvate) was replaced. Cervical cancer cells HeLa were cultured under different conditions for 8 hours. The culture conditions were set as follows: normoxia, hypoxia (1% O2), and inhibition of the mitochondrial respiratory chain using Antimycin A (1 μM). After the time was up, cell RNA was extracted and sent to Novogene for RNA sequencing. Note: All subsequent culture medium used was DMEM culture medium (10% dialyzed fetal bovine serum, 25 mM glucose, 2 mM glutamine, and no pyruvate).

[0107] (2) Nude mouse tumorigenesis experiment: HeLa cell lines with stable low expression of SLCO4A1, down-expression control, and SLCO4A1 knockdown and complementation (5 million / site) were inoculated into 5-week-old female nude mice (3 groups, 5 mice in each group). After palpable tumors were identified, tumor size was measured every 3 days, and tumor volume was calculated using the formula 1 / 2×L×W 2 Calculate and draw growth curves. Finally, the mice were killed according to the standard, and the tumors were obtained and weighed for statistical analysis. The shRNA sequence used to knock down SLCO4A1 was shSLCO4A1: GCACTTCAACTTGTCAGAGAA (SEQ ID No. 1).

[0108] 2. Experimental results Hypoxia (hypoxia) is a common feature of solid tumors, which has a significant impact on tumor growth, invasion, metastasis and treatment resistance. Tumor cells undergo a series of adaptive changes in the hypoxic microenvironment, including changes in energy metabolism, promotion of angiogenesis, regulation of gene expression, increased secretion of exosomes and suppression of the immune system. The solute carrier (SLC) superfamily is a large class of transporters responsible for the influx and efflux of various endogenous substances in cells, including amino acids, peptides, sugars and nucleotides, such as the common human solute carrier family 16 members 3 (SLC16A3) that transports lactate, also known as monocarboxylate transporter 4 (MCT4). We used transcriptome sequencing to screen for SLCs that were significantly upregulated under both hypoxia and mitochondrial respiratory chain damage. The results showed that compared with normoxia, hypoxia and inhibition of the mitochondrial respiratory chain by Antimycin A led to a significant upregulation of 15 SLCs in cervical cancer cells, including MCT4 and SCL16A13 (MCT1). These transporters can regulate the secretion of lactate and have been shown to play an important role in tumors. We selected the solute carrier organic anion transporter family member 4A1 (SLCO4A1), whose role in cervical cancer and the tumor hypoxic microenvironment has not been studied ( Figure 1 A). We downregulated SLCO4A1 in the cervical cancer cell line HeLa, and the nude mouse xenograft model showed that knocking down SLCO4A1 significantly inhibited the growth of cervical cancer cells in vivo. Importantly, replenishing SLCO4A1 was able to restore this growth inhibition, indicating that SLCO4A1 is a potential target for cervical cancer treatment ( Figure 1 B-1E).

[0109] Example 2 TFE3 can regulate the mRNA and protein expression of SLCO4A1 in cervical cancer cells 1. Experimental methods (1) Prediction of SLCO4A1 and TFE3 binding regions: First, use NCBI to find the SLCO4A1 promoter region, find TFE3 information on the Jaspar website, and use Jaspar-scan to predict binding sites to find the conserved sequence of TFE3 and the region that may bind to SLCO4A1.

[0110] (2) TFE3 regulates SLCO4A1 mRNA and protein expression: Vector and TFE3 (Flag) plasmids were transfected into HeLa cells, respectively. After 48 hours, RNA and protein were extracted and the expression of TFE3 and SLCO4A1 was detected by qRT-PCR and Western Blot.

[0111] 2. Experimental results Transcription Factor E Family (TFE), mainly including TFE3 and TFEB, can regulate lysosomal biogenesis, autophagy, lipid catabolism, energy metabolism and immune response. Through bioinformatics analysis, we found that TFE3 can bind to the promoter region of SLCO4A1 transporter, and predicted that the nucleic acid binding sequence of the two is CACGTG on the SLCO4A1 promoter ( Figure 2 A). To further clarify the regulatory relationship between TFE3 and SLCO4A1, we overexpressed TFE3 in the cervical cancer cell line HeLa and detected the expression of SLCO4A1 using qRT-PCR. We found that TFE3 overexpression can upregulate the expression of SLCO4A1 ( Figure 2 B). Further WB experiments confirmed that overexpression of TFE3 can also promote the upregulation of SLCO4A1 protein expression ( Figure 2 C). These data indicate that there is a molecular mechanism by which TFE3 regulates SLCO4A1 expression in cervical cancer cells. We will continue to use molecular biological methods to verify the regulatory relationship between TFE3 and SLCO4A1.

[0112] The SLCO4A1 promoter sequence is: CGTCTTATCCCCTTTGAGGACGCTCTGTTATCGCCCCCATTTTGCAAACGAGGAAACTGAGGCTCGGAGGCCTGGAGCAATGTGTTCCAGGACAGACGGCAGGAAGCCGGGGTAGGAATTCCAACAGGGAGTTCCCTCTGTGGAAGGGAACGTGGCTGGCACCTCCCTGCCTTCCACCCTCAGAGCTAGTGTGAAAAAGAAGACGGGGTTATGGAAAAGGCAACGGGCTGGAGATTCCCCGGATTCCCAGGCTAGGGCGCCGGTCTCACTGTGCGCGCAGGTGGGGCGCGTGCCAGAACAGGGCCTGGGGGTCAGGCCGAGACCGGCGGGCACCTTCACCAGGGCCGCCCGTGGCGTTCCCCCAGCCCCTCTGCCGCGGGCCCCACGTGGCCCCGACCCTGCGGCAGCCTTTCGGAAGGGCGGAGCTGAAAAACGGCCGCTTGGCTCCACTCGGCCCCACAGCGCCCAGGAGCGAATCCCGAGTCCGTTCGGAACCGCCTCGCCGCGTGGCCTGGGGCGGCGTCGCCACCGCGCGTTCTCGGCCTCCCGGCTGCGGCAGCGATGCCGGTCCTTGGAGCTGGAGCGGGGAGTCCAGGAGGCGGCAGCGCTCCGGAGAGAGACGCCCTGGTCCCCCGCCGCGCGTTCCCGCCTCTGTGCCCTGGGGGGGAGGAGGGGGCGGTCGCCGCTGCCATTGGCCGTGGGGGGTGAGGCGGGCCCCGCGCAGGAAACCCCGCCCCTCCCTCTGCGGCGGGGGCGGCCCCAGCGGATGAATGAAGCGGCGCGTGGCTGCCGGGGAGGCCA (SEQ ID No. 2).

[0113] Example 3 TFE3 can directly bind to SLCO4A1 1. Experimental method (1) Luciferase reporter gene experiment proved that TFE3 can bind to SLCO4A1: The SLCO4A1 promoter fragment was inserted into the luciferase reporter gene plasmid pGL3-basic. Positive clones were screened, clones were amplified, and plasmids were extracted and set aside. TFE3 overexpression and empty vector control plasmids were amplified at the same time and set aside. 200,000 HeLa cells were inoculated into 6-well plates, and TFE3 overexpression plasmids and empty vector plasmids were co-transfected into HeLa cells with SLCO4A1 firefly luciferase reporter plasmid using Lipo6000, and Renilla luciferase expression vector was used as an internal reference. 48 hours after plasmid transfection, the intensity of the luciferase reporter gene was quantitatively detected using the Promega dual luciferase detection kit to determine whether TFE3 can bind to the SLCO4A1 promoter. Then, the nucleic acid sequences that may bind to the two were mutated, and their binding ability was tested.

[0114] (2) CHIP experiments proved that TFE3 can bind to SLCO4A1: HeLa cells were cultured under normoxic and hypoxic conditions (1% O2) for 8 hours, and formaldehyde (final concentration of 1%) was used to crosslink DNA and protein. The cells were washed with ice PBS three times, and micrococcal nuclease was added and ultrasonic lysed to break DNA fragments to 150-900 bp. The chromatin mixture was immunoprecipitated with the target protein, TFE3 polyclonal antibody, and negative control IgG using agarose magnetic beads, incubated at 4°C overnight, and the beads were washed. The antibody / protein / DNA complex was eluted from the magnetic beads by SDS and heating. The crosslinking of protein and DNA was then reversed by heating at 65°C for 4 hours with sodium chloride, and the existing proteins and RNA were degraded with proteinase K and RNase A. The remaining DNA was purified using a PCR purification kit. After resuspending the precipitate, qPCR was used to detect the expression of the SLCO4A1 promoter to confirm the endogenous binding of TFE3 to the SLCO4A1 promoter under hypoxic conditions.

[0115] 2. Experimental results Next, we studied the mechanism by which TFE3 regulates SLCO4A1. In order to find the regulatory mechanism of the two, we first inserted the promoter sequence of SLCO4A1 into the reporter gene plasmid. We cultured the cells under normoxic and hypoxic conditions and detected the luminescence intensity respectively. The dual luciferase reporter gene experiment showed that the activity of luciferase under hypoxic conditions was significantly higher than that under normoxic conditions ( Figure 3A), indicating that it may be due to the fact that TFE3 binds more to the SLCO4A1 promoter sequence under hypoxic conditions. To further prove that TFE3 can bind to the SLCO4A1 promoter, we constructed a TFE3 overexpression plasmid and predicted the nucleic acid sequence of TFE3 binding to SLCO4A1 through bioinformatics. We mutated the sequence and tested the luciferase activity. The results showed that overexpression of TFE3 can significantly promote its binding to the SLCO4A1 promoter region, and after mutating the nucleic acid sequence where the two may bind, the luciferase activity decreased significantly ( Figure 3 B). In addition, we used CHIP technology to prove that TFE3 can directly bind to SLCO4A1, and hypoxia can promote the binding of the two. The above data show that under hypoxic conditions, TFE3 can enter the nucleus and act as a transcription factor, bind to the promoter region of SCLO4A1, and promote its expression.

[0116] Example 4 The cancer-promoting effect of TFE3 depends on SLCO4A1 1. Experimental methods: TFE3 was knocked down in HeLa cells and SLCO4A1 was complemented. The HeLa cell lines with stable low expression of SLCO4A1, down-expression control, and SLCO4A1 complemented on the basis of knocking down SLCO4A1 (5 million / site) were inoculated into 5-week-old female nude mice (3 groups, 5 mice in each group). After determining the palpable tumor, the tumor size was measured every three days, and the tumor volume was calculated using the formula 1 / 2×L×W2, and the growth curve was drawn. Finally, the mice were killed according to the specifications, and the tumors were obtained and weighed for statistical analysis. The shRNA sequence for knocking down TFE3 is shTFE3: ATTGTTGCTGACATAGAATTA (SEQ ID No.3).

[0117] 2. Experimental results: To explore how TFE3 promotes cancer, we knocked down TFE3 in the cervical cancer cell line HeLa. Consistent with the previous results, knocking down TFE3 led to downregulation of SLCO4A1 expression ( Figure 4 A). Nude mouse tumorigenesis experiments showed that downregulating TFE3 could significantly inhibit the growth of tumor cells in vivo ( Figure 4 To verify whether the tumor-promoting effect of TFE3 depends on the regulation of SLCO4A1 expression, we overexpressed SLCO4A1 in cells in which SLCO4A1 was downregulated ( Figure 4 A). The results showed that replenishing SLCO4A1 could rescue the tumor growth inhibition caused by downregulation of TFE3 ( Figure 4 B-4D), further indicating that TFE3 plays a pro-cancer role in vivo by regulating SLCO4A1.

[0118] Example 5 Figure 5A schematic flow chart of a method for computer-aided drug screening based on TFE3 and SLCO4A1 provided in an embodiment of the present invention specifically includes: S101: Obtain TFE3 protein data and SLCO4A1 gene data; In some embodiments of the present invention, TEF3 is a member of the transcription factor E family, which can promote the proliferation of vascular endothelial cells and change the morphology of vascular endothelial cells. SLCO4A1 is a membrane transport protein, belonging to the solute carrier organic anion transport protein family member 4A1. As a membrane transport protein, SLCO4A1 plays a role in the transport of substances inside and outside the cell. In a specific embodiment of the present invention, we found that knocking out SLCO4A1 can inhibit the growth of cervical cancer cells, and replenishing SLCO4A1 restored the growth inhibition of cervical cancer cells. Further, we found that TEF3 can bind to the promoter region of SLCO4A1 to promote the expression of SLCO4A1, thereby regulating the growth of cervical cancer cells.

[0119] S102: determining the binding site of the two according to the TFE3 protein data and the SLCO4A1 gene data; In some embodiments, a binding site is a specific part of a molecule that can form a stable interaction with a ligand. The binding sites of genes usually have specific sequence and structural characteristics, such as a specific base arrangement order, spatial conformation, etc., which enable them to specifically bind to specific molecules.

[0120] S103: Obtain candidate drugs that simultaneously target the binding sites of the two through computer-assisted screening.

[0121] In some embodiments, computer-aided drug screening is a technology that uses computer-aided drug design methods to screen drugs. It can help researchers quickly screen candidate drugs that have strong binding ability with target proteins and potential efficacy from a large number of small molecule compounds.

[0122] In some embodiments of the present invention, the specific steps of obtaining candidate drugs that simultaneously target the binding sites of the two through computer-assisted screening include: screening compounds targeting the binding sites based on the spatial structure of the binding sites; molecularly docking the compounds with TFE3 and SLCO4A1, calculating the affinity / binding energy to obtain scores, and ranking according to the scores to obtain candidate drugs.

[0123] In some embodiments of the present invention, step S101 of the present invention can be replaced by obtaining TFE3 protein data, and accordingly, step S102 is replaced by screening TFE3 protein structural analogs based on the spatial structure of TFE3 protein, and step 103 is replaced by molecular docking of the TFE3 protein structural analogs with SLCO4A1, calculating the affinity / binding energy to obtain a score, and ranking according to the score to obtain candidate drugs.

[0124] In some embodiments of the present invention, step S102 of the present invention can also be replaced by obtaining SLCO4A1 gene data. Accordingly, step S102 is replaced by screening SLCO4A1 structural analogs based on the spatial structure of SLCO4A1, and step S103 is replaced by molecular docking of SLCO4A1 structural analogs with TFE3 protein, calculating affinity / binding energy to obtain scores, and ranking according to the scores to obtain candidate drugs.

[0125] Example 6 Figure 6 A schematic diagram of a computer-assisted drug screening system based on TFE3 and SLCO4A1 provided in an embodiment of the present invention specifically includes: Data acquisition unit: obtain TFE3 protein data and SLCO4A1 gene data; A site determination unit: determining the binding site of the two genes according to the TFE3 gene data and the SLCO4A1 gene data; Candidate drug acquisition unit: obtains candidate drugs that simultaneously target the binding sites of the two through computer-assisted screening.

[0126] In some embodiments of the present invention, the system may also be: Data acquisition unit: obtain TFE3 protein data; Structural analogue screening unit: Screening TFE3 protein structural analogues based on the spatial structure of TFE3 protein; Candidate drug acquisition unit: molecular docking the TFE3 protein structure analogs with SLCO4A1, calculating affinity / binding energy to obtain scores, and ranking according to the scores to obtain candidate drugs.

[0127] In some embodiments of the present invention, the system may further include: Data acquisition unit: acquiring SLCO4A1 gene data; Structural analog screening unit: Screening SLCO4A1 structural analogs based on the spatial structure of SLCO4A1; Candidate drug acquisition unit: perform molecular docking of SLCO4A1 structural analogs with TFE3 protein, calculate affinity / binding energy to obtain scores, and rank them according to the scores to obtain candidate drugs.

[0128] Figure 7 A schematic diagram of a device for computer-assisted drug screening based on TFE3 and SLCO4A1 provided in an embodiment of the present invention specifically includes: A memory and a processor, wherein the memory is used to store program instructions; the processor is used to call the program instructions, and when the program instructions are executed, the above-mentioned computer-assisted drug screening method based on TFE3 and SLCO4A1 is implemented.

[0129] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. Any of the following applications: (1) Application of SLCO4A1 inhibitors in the preparation of drugs for treating cancer; (2) Application of SLCO4A1 in screening candidate drugs for cancer treatment; (3) Use of agents that inhibit the binding of TFE3 and SLCO4A1 in the preparation of drugs for treating cancer; (4) Application of the complex formed by the binding of TFE3 and SLCO4A1 in screening drugs for treating cancer; (5) Application of the complex formed by the binding of TFE3 and SLCO4A1 in screening agents that inhibit the binding of TFE3 and SLCO4A1; (6) Application of TFE3 in the preparation of SLCO4A1 expression regulators in cells; (7) Application of TFE3 in preparing cell models of SLCO4A1 overexpression and / or SLCO4A1 underexpression.

2. The use according to claim 1, characterized in that: The SLCO4A1 inhibitor reduces the expression level of SLCO4A1; Preferably, the inhibitor includes a nucleic acid inhibitor, a protein inhibitor, or a compound; Preferably, the nucleic acid inhibitor comprises siRNA, shRNA, ribozyme, antisense oligonucleotide; Preferably, the sequence of the shRNA is shown as SEQ ID No.

1.

3. The use according to claim 1, characterized in that: The action site of the agent that inhibits the binding between TFE3 and SLCO4A1 is on the promoter region of SLCO4A1; Preferably, the action site of the agent that inhibits the binding between TFE3 and SLCO4A1 is on the CACGTG sequence in the promoter region of SLCO4A1; Preferably, the cancer comprises gastric cancer, breast cancer, ovarian cancer, bladder cancer, lung cancer, colon cancer, rectal cancer, prostate cancer, blood cancer, lymphoma, cervical cancer, osteosarcoma, glioblastoma, melanoma, pancreatic cancer, liver cancer, kidney cancer, gallbladder cancer, bile duct cancer, esophageal cancer or neuroblastoma; Preferably, the cancer is selected from cervical cancer; Preferably, the cancer cells are selected from cervical cancer cells.

4. A pharmaceutical composition for treating cancer, characterized in that: The pharmaceutical composition includes an inhibitor of SLCO4A1 and / or an agent that inhibits the binding of TFE3 and SLCO4A1; Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient; Preferably, the cancer comprises gastric cancer, breast cancer, ovarian cancer, bladder cancer, lung cancer, colon cancer, rectal cancer, prostate cancer, blood cancer, lymphoma, cervical cancer, osteosarcoma, glioblastoma, melanoma, pancreatic cancer, liver cancer, kidney cancer, gallbladder cancer, bile duct cancer, esophageal cancer or neuroblastoma; Preferably, the cancer is selected from cervical cancer.

5. A composite, characterized in that The complex comprises TFE3 and SLCO4A1; the TFE3 binds to the promoter region of SLCO4A1.

6. A method for screening drugs for treating cancer, characterized in that: The method comprises: (1) contacting the test substance with a system expressing or containing SLCO4A1; (2) detecting the expression level of SLCO4A1 in the system; (3) selecting substances that can reduce the expression level of SLCO4A1 as candidate drugs for treating or preventing cancer; Or the method comprises: (1) contacting the test substance with a system containing a complex formed by TFE3 and SLCO4A1; (2) detecting the binding level of TFE3 and SLCO4A1 in the system; (3) Select substances that can reduce the binding level of TFE3 and SLCO4A1 as candidate drugs for treating or preventing cancer.

7. The method according to claim 6, characterized in that The system is selected from: a cell system, a subcellular system, a solution system, a tissue system, an organ system or an animal system; The cancer includes gastric cancer, breast cancer, ovarian cancer, bladder cancer, lung cancer, colon cancer, rectal cancer, prostate cancer, blood cancer, lymphoma, cervical cancer, osteosarcoma, glioblastoma, melanoma, pancreatic cancer, liver cancer, kidney cancer, gallbladder cancer, bile duct cancer, esophageal cancer or neuroblastoma; Preferably, the cancer is selected from cervical cancer.

8. A method for regulating SLCO4A1 expression in a cell, characterized in that: The method comprises altering the expression of TFE3 in a cell; Preferably, the method for promoting the expression of SLCO4A1 in a cell comprises promoting the expression of TFE3 in the cell; Preferably, promoting the expression of TFE3 in the cell comprises administering a TFE3 promoter to the cell; Preferably, the method of inhibiting the expression of SLCO4A1 in a cell comprises inhibiting the expression of TFE3 in the cell; Preferably, inhibiting the expression of TFE3 in the cell comprises administering a TFE3 inhibitor to the cell; Preferably, the cells are selected from cervical cancer cells.

9. A method for constructing a cell model of SLCO4A1 overexpression or SLCO4A1 underexpression, characterized in that: The method comprises regulating the expression of TFE3 in a cell; Preferably, the method for constructing a cell model of SLCO4A1 overexpression comprises promoting the expression of TFE3 in the cell; Preferably, the promoting the expression of TFE3 in the cell comprises administering a TFE3 promoter to the cell; Preferably, the method for constructing a cell model with low expression of SLCO4A1 comprises inhibiting the expression of TFE3 in the cell; Preferably, inhibiting the expression of TFE3 in the cell comprises administering a TFE3 inhibitor to the cell; Preferably, the cells are selected from cervical cancer cells.

10. A method for constructing a hypoxic cell model, characterized in that: The method includes promoting the binding of TFE3 and SLCO4A1 in a cell; Preferably, the cells are selected from cervical cancer cells.

Images