Saccharomyces cerevisiae GH-Y16 and application thereof

Abstract

The invention discloses a bacterial strain, which is Saccharomyces cerevisiae GH-Y16, is preserved in China General Microbiological Culture Collection Center (CGMCC), the preservation date is January 22, 2024, and the preservation number is CGMCC No.29719. The invention further discloses a preparation method of the bacterial strain. The invention relates to a method for preparing sugarcane polyphenol through fermentation, which comprises the following steps: preparing saccharomyces cerevisiae into a seed solution, inoculating the seed solution into sugarcane juice or molasses diluent for fermentation, and after the fermentation is finished, filtering the fermentation liquor to remove impurities, and concentrating in vacuum to obtain the sugarcane polyphenol. The saccharomyces cerevisiae is saccharomyces cerevisiae GH-Y16. The method can replace the traditional chemical extraction method combined with the chromatographic purification method to prepare the sugarcane polyphenol, and has the advantages of reducing the production cost of the product, reducing the danger coefficient of the production environment, avoiding the chemical residue of the product, reducing the environmental pollution and the like.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms, and specifically relates to a strain of brewer's yeast GH-Y16 and application thereof in preparing sugarcane polyphenols. Background Art

[0002] Sugarcane polyphenols have the effects of controlling blood sugar, scavenging free radicals, anti-oxidation, anti-inflammatory, anti-aging, and anti-tumor. In particular, they can inhibit the activity of blood sugar-related enzymes such as α-glucosidase, α-amylase, sucrase, and maltase, and affect the glucose transmembrane transporter GLUT2, and control the absorption of glucose by the human body in multiple dimensions, thereby affecting the rapid production of blood sugar. At present, the preparation of sugarcane polyphenols generally adopts chemical extraction combined with chromatography for further purification. This method has high production costs, a high risk factor in the production environment due to the use of a large amount of chemical reagents, and the product has the hidden danger of chemical residues and potential environmental pollution risks. Therefore, it is urgent to develop a low-cost, green, safe, and environmentally friendly preparation method for sugarcane polyphenols. Summary of the invention

[0003] In view of the deficiencies in the prior art, the present invention provides a strain of brewer's yeast GH-Y16 and application thereof in preparing sugarcane polyphenols.

[0004] In order to achieve the above object, the present invention adopts the following technical solutions:

[0005] A strain, the strain is Saccharomyces cerevisiae GH-Y16, which has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is January 22, 2024, and the deposit number is CGMCC No.29719.

[0006] A bacterial agent prepared by using the brewer's yeast GH-Y16.

[0007] The application of the brewer's yeast GH-Y16 or the bacterial agent in the preparation of sugarcane polyphenols.

[0008] A method for preparing sugarcane polyphenols by fermentation, comprising preparing brewer's yeast into seed liquid, inoculating the seed liquid into sugarcane juice or molasses dilution liquid for fermentation, and after the fermentation is completed, filtering the fermentation liquid to remove impurities and vacuum concentrating to obtain sugarcane polyphenols.

[0009] The brewer's yeast is brewer's yeast GH-Y16.

[0010] The molasses diluent is 18-26°Bx, and the sugarcane juice is 18-26°Bx.

[0011] The preparation method of the sugarcane juice is as follows: fresh and mildew-free sugarcane is selected, leaves and roots are removed, sugarcane juice is squeezed to obtain the sugarcane juice, impurities are filtered out through a sieve, and the juice is heated to 40-60° C. and then passed through a ceramic membrane with a pore size of 100-450 nm, and the sugarcane juice passing through the membrane is evaporated and concentrated to 18-26° Bx.

[0012] The method for preparing the seed solution comprises the following steps:

[0013] S1: The GH-Y16 yeast was inoculated into the activation medium and cultured at 33° C. for 12 h.

[0014] S2: Transfer to the primary seed culture medium and culture at 33°C and 150 rpm for 12 h.

[0015] S3: Transfer to the secondary seed culture medium at a 0.8% inoculum and culture at 33°C and 150 rpm for 12 h.

[0016] S4: After the fermentation liquid is centrifuged, the supernatant is discarded, and the same volume of sterilized 18-26°Bx sugarcane juice as the supernatant is added to the yeast precipitate, and the seed liquid is prepared by oscillating evenly.

[0017] The activation medium composition and content are as follows: 10g yeast extract, 20g peptone, 20g glucose and 20g agar dissolved in 1000mL distilled water, sterilized at 121°C for 20min;

[0018] The composition and content of the primary seed culture medium are as follows: 10 g yeast extract, 20 g peptone, 20 g glucose and 180 g sucrose are dissolved in 1000 mL distilled water and sterilized at 121° C. for 20 min;

[0019] The components and content of the secondary seed culture medium are as follows: 50 g yeast extract and 100 g peptone are dissolved in 5000 mL 21.0° Bx sugarcane juice and sterilized at 121° C. for 20 min.

[0020] The fermentation method is as follows: inoculating the seed liquid into the sugarcane juice or molasses dilution liquid at an inoculation rate of 1.0-4.0%, controlling the temperature at 31-33° C. and stirring for the first 30 hours, stopping stirring after 30 hours, and finishing the fermentation after 72-96 hours.

[0021] The fermentation broth filtration and concentration method is as follows: the fermentation broth is first centrifuged to remove yeast cells, and then filtered using a 100-450nm ceramic membrane and a 50-100kDa organic membrane in turn, and the vacuum concentration temperature is 40-60°C.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The brewer's yeast GH-Y16 provided by the present invention can be used to prepare sugarcane polyphenols, and can replace the traditional chemical extraction method combined with the chromatographic purification method, and has the advantages of reducing product production costs, reducing production environmental risk factors, avoiding product chemical residues and reducing environmental pollution. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 is the growth curve of the yeast strain GH-Y16.

[0025] Figure 2 This is a process flow chart for preparing sugarcane polyphenols using sugarcane juice as raw material.

[0026] Figure 3 This is a process flow chart for preparing sugarcane polyphenols using molasses as raw material.

[0027] Figure 4 This is a colony photo of the Saccharomyces cerevisiae GH-Y16.

[0028] Figure 5 This is a photo of the yeast GH-Y16 observed under a microscope. DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further described below through embodiments.

[0030] Culture medium used in the examples

[0031] YPD+sucrose liquid culture medium: 10 g yeast extract, 20 g peptone, 20 g glucose, 180 g sucrose, distilled water to 1 L, sterilized at 121°C for 20 min.

[0032] YPD solid medium: 10 g yeast extract, 20 g peptone, 20 g glucose, 20 g agar, distilled water to 1 L, sterilize at 121°C for 20 min.

[0033] Example 1 Screening and identification of yeast strains

[0034] 1. Preliminary screening of yeast strains

[0035] From February to September 2023, 17 samples of molasses, cane syrup, brown sugar, sugar intermediate products and waste with obvious alcohol smell were collected from sugarcane sugar factories in Guigang, Guangxi Zhuang Autonomous Region. 25g of each sample was added to 225mL containing 50mg·L -1 The culture medium was incubated in a YPD+sucrose liquid medium containing kanamycin at 33°C for 1 to 3 days. The sample group that became turbid and had an alcohol smell was selected. 50 mL of the fermentation liquid was inoculated into a triangular flask containing 450 mL of sterile water and shaken for 30 minutes to prepare a bacterial suspension. The bacterial suspension was then gradiently diluted to 10 -3 , 10-4 , 10 -5 and 10 -6 , apply 50 μL of the dilution on a plate containing 50 mg·L -1 The plate was placed in a 33°C incubator for 48 hours. A single colony with typical yeast characteristics was selected for TTC color development test, and the colony with deep red color was selected for preservation. A total of 29 yeast strains were screened out.

[0036] 2. Yeast strain rescreening

[0037] The 29 yeast strains screened were inoculated into YPD+sucrose liquid medium, and cultured at 33°C and 150r / min for 12h to obtain seed liquid. The seed liquid was inoculated into 21.0°Bx sugarcane juice medium at 2.0% (v / v) inoculation amount, cultured at 33°C and 150r / min for 30h, and then cultured statically for 54h to detect the total polyphenol content. The fermentation liquid of the strain marked as GH-Y16 had the highest total polyphenol content of 1.15g / kg, which was 13.86% higher than the total polyphenol content of 1.01g / kg in sugarcane juice before fermentation.

[0038] 3. Strain identification

[0039] The GH-Y16 strain was sent to Shanghai Biotech Co., Ltd. for identification. The yeast sample DNA was extracted, PCR amplified, sequenced and compared with the gene sequence homology in NCBI by using the 26S rDNA gene D1 / D2 region sequence analysis method. The strain was determined to be Saccharomyces cerevisiae GH-Y16, named Saccharomyces cerevisiae GH-Y16, and deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is January 22, 2024, and the deposit number is CGMCC No. 29719.

[0040] The 26S rDNA of Saccharomyces cerevisiae GH-Y16 is 586 bp in total and the sequence is as follows:

[0041] GGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGC

[0042] TCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTG

[0043] GGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTG

[0044] TGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATG

[0045] CAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGC

[0046] GAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTAC

[0047] GTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTC

[0048] CTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATA

[0049] AATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCT

[0050] GGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGT

[0051] CTT

[0052] like Figure 4 As shown, the colonies of the GH-Y16 strain are nearly circular, with a smooth, moist, sticky surface that is easy to pick up, a uniform texture, and uniform colors on the front and back sides, edges, and center. The colonies are milky white. Figure 5 The bacterial morphology of GH-Y16 observed under a microscope.

[0053] 4. Strain growth characteristics

[0054] The activated Saccharomyces cerevisiae GH-Y16 was inoculated into YPD+sucrose liquid medium at 2% inoculation rate, cultured at 33°C and 80r / min for 36h, sampled every 2h, and the absorbance of the bacterial solution was measured at a wavelength of 600nm. The growth curve of the strain was obtained by plotting the OD600 value representing the bacterial solution concentration against the fermentation time. Figure 1 The yeast shown entered the stable growth phase after 8 hours of cultivation and grew rapidly.

[0055] Example 2 Preparation of sugarcane polyphenols using Saccharomyces cerevisiae GH-Y16 and sugarcane as raw material

[0056] 1. Sugarcane pressing: Select fresh, mildew-free sugarcane, remove leaves and roots, and press to obtain sugarcane juice with a Brix of 14.6°Bx;

[0057] 2. Pre-removal of impurities in sugarcane juice: Filter the sugarcane juice with a 120-mesh vibrating screen to remove impurities such as tiny bagasse, silt, etc. remaining in the sugarcane juice;

[0058] 3. Heating sugarcane juice: Heat the sugarcane juice to 60℃.

[0059] 4. Ceramic membrane filtration: Sugarcane juice is filtered with a 200nm pore size ceramic membrane. The brix of the filtered sugarcane juice is 15.7°Bx and the turbidity is 5.6NTU.

[0060] 5. Evaporation and concentration of sugarcane juice: Evaporate and concentrate the sugarcane juice that has passed through the membrane to 21.0°Bx and set aside.

[0061] 6. Fermentation of sugarcane juice by Saccharomyces cerevisiae GH-Y16.

[0062] (1) Activation culture medium

[0063] 10 g yeast extract, 20 g peptone, 20 g glucose and 20 g agar were dissolved in 1000 mL distilled water and sterilized at 121°C for 20 min.

[0064] (2) Primary seed culture medium

[0065] 10 g yeast extract, 20 g peptone, 20 g glucose and 180 g sucrose were dissolved in 1000 mL distilled water and sterilized at 121°C for 20 min.

[0066] (3) Secondary seed culture medium

[0067] 50 g yeast extract and 100 g peptone were dissolved in 5000 mL 21.0°Bx sugarcane juice and sterilized at 121°C for 20 min.

[0068] (4) Preparation of seed solution

[0069] Inoculate into activation medium and culture at 33°C for 12 hours, transfer to primary seed medium, culture at 33°C, 150 r / min for 12 hours, transfer to secondary seed medium at 0.8% inoculation rate, culture at 33°C, 150 r / min for 12 hours, centrifuge the fermentation liquid at 5000 r / min for 10 minutes, discard the supernatant, take the same volume of sterilized 21.0°Bx sugarcane juice as the supernatant, mix with yeast precipitate, shake for 30 minutes, make uniform seed liquid for use.

[0070] (5) Fermentation method

[0071] The above (4) seed solution was inoculated into a fermentation tank containing 4L 21.0°Bx sugarcane juice at a 2.0% inoculation rate. The temperature was controlled at 31-33°C and the stirring was 150r / min for the first 30h. The stirring was stopped after 30h and the fermentation was completed after 72h. A total of 3 parallel batches were conducted in the experiment.

[0072] (6) Fermentation broth assay

[0073] Determination method of total polyphenol content: weigh 2g of sample (accurate to 0.1mg) in a 10mL volumetric flask, add water to the scale, and mix well. Pipette 1.0mL into a 50mL volumetric flask, add water to the volume and mix well for testing. Accurately pipette 0.2mL of gallic acid series standard working solution and the above sample solution into a graduated test tube, add 1.8mL of distilled water and 0.2mL of Folin phenol reagent to the test tube, shake well, react for 5min, wait until the color in the test tube changes to light green, add 2mL of 7% sodium carbonate solution, add 0.8mL of distilled water, and shake well. Place at room temperature for 90min, use a 10mm cuvette, and measure the absorbance with a spectrophotometer at a wavelength of 750nm. A standard curve was prepared based on the absorbance (A) and concentration of the gallic acid series standard working solutions (aqueous solutions with gallic acid concentrations of 0 mg / L, 40 mg / L, 80 mg / L, 120 mg / L, 160 mg / L, and 200 mg / L, respectively). The content of total polyphenols (calculated as gallic acid) was calculated as follows:

[0074]

[0075] Where:

[0076] X——the content of total polyphenols in the sample (calculated as gallic acid), in grams per kilogram (g / kg);

[0077] C——The concentration of gallic acid in the test solution calculated from the standard curve, in milligrams per liter (mg / L);

[0078] V——fixed volume, in milliliters (mL);

[0079] K——sample dilution multiple;

[0080] m——sampling volume, in grams (g);

[0081] 1000 – The coefficient for converting milliliters (mL) to liters (L).

[0082] Determination method of total flavonoids content: refer to the first method in the fifteenth chapter of the "Technical Guidelines for Testing and Evaluation of Physical, Chemical and Hygienic Indicators of Health Foods (2020 Edition)" for detection.

[0083] Determination of proanthocyanidin content: Take 1.0 mL of each standard series of proanthocyanidin working solutions (proanthocyanidin concentrations of 0 μg / mL, 10 μg / mL, 25 μg / mL, 50 μg / mL, 100 μg / mL, 150 μg / mL, 200 μg / mL, and 250 μg / mL methanol solutions), place them in an ampoule, and accurately add hydrochloric acid-n-butanol solution (measure 50 mL of n-butanol in 100 mL of ampoule). In a volumetric flask, add 5 mL of hydrochloric acid (content is 35% to 37%), dilute to the mark with n-butanol, and shake well) 6.0 mL, ammonium ferric sulfate solution (measure 50 mL of n-butanol in a 100 mL volumetric flask, add 5 mL of hydrochloric acid, dilute to the mark with n-butanol, and shake well) 0.2 mL, mix well, seal it with sealing forceps, heat it in boiling water for 40 minutes, take it out, immediately cool it to room temperature in ice water, and measure the absorbance at a wavelength of 546 nm. Draw a standard curve with absorbance as the ordinate and proanthocyanidin concentration as the abscissa. Weigh 100 mg of the sample (accurate to 0.1 mg) and place it in a 50 mL volumetric flask, add 30 mL of methanol, and ultrasonically dissolve (power 250 W, frequency 50 kHz) for 20 minutes. After it reaches room temperature, add methanol to the mark, shake well, let it clarify, and take the supernatant as the test sample solution, marked as V. If the sample has a high proanthocyanidin content, dilute the sample appropriately before testing, and mark the dilution multiple as k. Accurately pipette 1.0 mL of the sample solution, place it in an ampoule, and then follow the standard curve preparation steps. Use the corresponding reagent as a blank. Determine the sample absorbance and calculate the proanthocyanidin content in the sample solution based on the standard curve. The proanthocyanidin content in the sample is calculated as follows:

[0084]

[0085] Where:

[0086] X——the content of proanthocyanidins in the sample, in grams per kilogram (g / kg);

[0087] c——the content of proanthocyanidins in the sample solution obtained according to the standard curve, in micrograms per milliliter (μg / mL);

[0088] c0——the content of proanthocyanidins in the blank solution, in micrograms per milliliter (μg / mL);

[0089] V——total volume of the sample, in milliliters (mL);

[0090] k——sample dilution multiple;

[0091] m——sampling volume, in milligrams (mg).

[0092] The results of the fermentation broth assay are shown in Table 1.

[0093] Table 1 Example 1 Polyphenol content

[0094] project Total polyphenols (g / kg) Total flavonoids (g / kg) Proanthocyanidins (g / kg) Sugarcane juice before fermentation 0.971 0.161 0.064 GH-Y16 strain 1# fermentation broth 1.125 0.193 0.072 GH-Y16 strain 2# fermentation broth 1.129 0.186 0.073 GH-Y16 strain 3# fermentation broth 1.132 0.189 0.076 average value 1.129 0.189 0.074 Commercial Saccharomyces cerevisiae fermentation broth 0.993 0.169 0.066

[0095] From Table 1 we can see that:

[0096] The average total polyphenol content of the three batches of GH-Y16 yeast fermentation broth was 1.129 g / kg, which was 16.24% higher than the total polyphenol content of 0.971 g / kg in sugarcane juice before fermentation and 13.66% higher than the total polyphenol content of 0.993 g / kg in ordinary commercial brewer's yeast fermentation broth.

[0097] The average total flavonoid content of three batches of GH-Y16 yeast fermentation broth was 0.189 g / kg, which was 17.60% higher than the total flavonoid content of 0.161 g / kg in sugarcane juice before fermentation and 12.03% higher than the total flavonoid content of 0.169 g / kg in ordinary commercial brewer's yeast fermentation broth.

[0098] The average proanthocyanidin content of three batches of GH-Y16 yeast fermentation broth was 0.074 g / kg, which was 15.10% higher than the proanthocyanidin content of 0.074 g / kg in sugarcane juice before fermentation and 11.62% higher than the proanthocyanidin content of 0.066 g / kg in ordinary commercial brewer's yeast fermentation broth.

[0099] 7. Preparation of liquid sugarcane polyphenols

[0100] The fermentation liquid was centrifuged at 5000 r / min for 10 min to remove yeast cells, filtered with a 100 nm ceramic membrane and a 100 kDa organic membrane to further remove impurities, and concentrated at 45° C. under vacuum conditions to a soluble solid content of 72.3% to obtain liquid sugarcane polyphenols. Its main indicators are shown in Tables 2, 3 and 4.

[0101] Table 2 Sensory evaluation results of sugarcane polyphenols

[0102]

[0103] It can be seen from Table 2 that the sensory evaluation results of the sugarcane polyphenols prepared by the present invention all meet the sensory requirements for sugarcane polyphenols in Announcement No. 2 of 2022 of the National Health Commission, and are the same as the sensory evaluation of commercially available sugarcane polyphenols.

[0104] Table 3 Physical and chemical indicators of sugarcane polyphenols

[0105]

[0106]

[0107] Table 3 shows that the physical and chemical indicators of sugarcane polyphenols prepared by the present invention meet the requirements of the National Health Commission's Announcement No. 2 of 2022 for the physical and chemical indicators of sugarcane polyphenols; and compared with commercially available sugarcane polyphenols, the three main component indicators are as follows: the total polyphenol content is 50.32% higher, the total flavonoid content is 17.34% higher, and the proanthocyanidin content is 17.29% higher; no harmful substances such as lead and arsenic were detected.

[0108] Table 4 Microbiological limits of sugarcane polyphenols

[0109]

[0110] It can be seen from Table 4 that the microbial limits of sugarcane polyphenols prepared by the present invention all meet the requirements for sugarcane polyphenols in Announcement No. 2 of 2022 of the National Health Commission.

[0111] Example 3 Preparation of sugarcane polyphenols using molasses as raw material using Saccharomyces cerevisiae GH-Y16

[0112] 1. Molasses dilution: dilute the molasses to 21.0°Bx and set aside.

[0113] 2. Diluted molasses was fermented by Saccharomyces cerevisiae GH-Y16

[0114] (1) Activation culture medium

[0115] 10 g yeast extract, 20 g peptone, 20 g glucose and 20 g agar were dissolved in 1000 mL distilled water and sterilized at 121°C for 20 min.

[0116] (2) Primary seed culture medium

[0117] 10 g yeast extract, 20 g peptone, 20 g glucose and 180 g sucrose were dissolved in 1000 mL distilled water and sterilized at 121°C for 20 min.

[0118] (3) Secondary seed culture medium

[0119] 50 g yeast extract and 100 g peptone were dissolved in 5000 mL 21.0°Bx diluted molasses and sterilized at 121°C for 20 min.

[0120] (4) Preparation of seed solution

[0121] Inoculate into activation medium and culture at 33°C for 12h, transfer to primary seed medium, culture at 33°C, 150r / min for 12h, transfer to secondary seed medium at 0.8% inoculation rate, culture at 33°C, 150r / min for 12h, centrifuge the fermentation broth at 5000r / min for 10min, discard the supernatant, take the same volume of sterilized 21.0°Bx diluted molasses as the supernatant, mix with yeast precipitate, shake for 30min, make uniform seed solution for use.

[0122] (5) Fermentation method

[0123] The seed solution (4) was inoculated into a fermentation tank containing 4L of 21.0°Bx diluted molasses at a 4.0% inoculation rate. The temperature was controlled at 31-33°C and the stirring was 150r / min for the first 30h. The stirring was stopped after 30h and the fermentation was completed after 96h. A total of 3 parallel batches were conducted in the experiment.

[0124] (6) Fermentation broth assay

[0125] Determination of total polyphenol content: The same method as in Example 2 was used.

[0126] Determination of total flavonoids content: The same method as in Example 2 was used.

[0127] Determination of proanthocyanidin content: The same method as in Example 2 was used.

[0128] The results of the fermentation broth assay are shown in Table 5.

[0129] Table 5 Example 2 Polyphenol content

[0130]

[0131]

[0132] It can be seen from Table 5 that the average total polyphenol content of the fermentation broth of GH-Y16 Saccharomyces cerevisiae in three batches was 3.119 g / kg, which was 15.83% higher than the total polyphenol content of 2.693 g / kg before fermentation and 11.84% higher than the total polyphenol content of 2.789 g / kg in the fermentation broth of ordinary commercial Saccharomyces cerevisiae;

[0133] The average total flavonoid content of the fermentation broth of GH-Y16 Saccharomyces cerevisiae in three batches was 0.632 g / kg, which was 14.64% higher than the total flavonoid content of 0.551 g / kg before fermentation and 9.47% higher than the total flavonoid content of 0.577 g / kg in the fermentation broth of ordinary commercial Saccharomyces cerevisiae.

[0134] The average proanthocyanidin content of three batches of GH-Y16 brewer's yeast fermentation broth was 0.379 g / kg, which was 15.30% higher than the proanthocyanidin content of 0.329 g / kg before fermentation and 12.22% higher than the proanthocyanidin content of 0.338 g / kg in ordinary commercial brewer's yeast fermentation broth.

[0135] 7. Preparation of liquid sugarcane polyphenols

[0136] The fermentation liquid was centrifuged at 5000 r / min for 10 min to remove yeast cells, filtered with a 100 nm ceramic membrane and a 100 kDa organic membrane to further remove impurities, and concentrated at 45° C. under vacuum conditions to a soluble solid content of 72.6% to obtain liquid sugarcane polyphenols. The main indicators are shown in Tables 6, 7 and 8.

[0137] Table 6 Sensory evaluation results of sugarcane polyphenols

[0138]

[0139] It can be seen from Table 6 that the sensory evaluation results of sugarcane polyphenols prepared with molasses as raw material all meet the sensory requirements for sugarcane polyphenols in Announcement No. 2 of 2022 of the National Health Commission, and are the same as the sensory evaluation of commercially available sugarcane polyphenols.

[0140] Table 7 Physical and chemical indicators of sugarcane polyphenols

[0141]

[0142]

[0143] Table 7 shows that the physical and chemical indicators of sugarcane polyphenols prepared with molasses as raw material meet the requirements of the National Health Commission's Announcement No. 2 of 2022 for the physical and chemical indicators of sugarcane polyphenols; and compared with commercially available sugarcane polyphenols, the three main component indicators are as follows: the total polyphenol content is 100.83% higher, the total flavonoid content is 58.22% higher, and the proanthocyanidin content is 195.03% higher.

[0144] Table 8 Microbial limits of sugarcane polyphenols

[0145]

[0146]

[0147] It can be seen from Table 8 that the microbial limits of sugarcane polyphenols prepared with molasses as raw material meet the requirements for sugarcane polyphenols in Announcement No. 2 of 2022 of the National Health Commission.

[0148] Example 4

[0149] A method for preparing sugarcane polyphenols by using the brewer's yeast GH-Y16, wherein the brewer's yeast GH-Y16 is prepared into seed liquid, the seed liquid is inoculated into sugarcane juice for fermentation, and after the fermentation is completed, the fermentation liquid is filtered to remove impurities and vacuum concentrated to obtain sugarcane polyphenols.

[0150] The preparation method of the sugarcane juice is as follows: fresh, mildew-free sugarcane is selected, leaves and roots are removed, the sugarcane juice is squeezed, impurities are filtered out through a sieve, and the juice is heated to 40°C and passed through a ceramic membrane with a pore size of 100 nm, and the sugarcane juice passing through the membrane is evaporated and concentrated to 18, 20, 22, 24 or 26°Bx.

[0151] The method for preparing the seed solution comprises the following steps:

[0152] S1: The GH-Y16 yeast was inoculated into the activation medium and cultured at 33° C. for 12 h.

[0153] S2: Transfer to the primary seed culture medium and culture at 33°C and 150 rpm for 12 h.

[0154] S3: Transfer to the secondary seed culture medium at a 0.8% inoculum and culture at 33°C and 150 rpm for 12 h.

[0155] S4: After the fermentation liquid is centrifuged, the supernatant is discarded, and the same volume of sterilized 18°Bx sugarcane juice as the supernatant is added to the yeast precipitate and shaken evenly to prepare the seed liquid.

[0156] The activation medium composition and content are as follows: 10g yeast extract, 20g peptone, 20g glucose and 20g agar dissolved in 1000mL distilled water, sterilized at 121°C for 20min;

[0157] The composition and content of the primary seed culture medium are as follows: 10 g yeast extract, 20 g peptone, 20 g glucose and 180 g sucrose are dissolved in 1000 mL distilled water and sterilized at 121° C. for 20 min;

[0158] The components and content of the secondary seed culture medium are as follows: 50 g yeast extract and 100 g peptone are dissolved in 5000 mL 21.0° Bx sugarcane juice and sterilized at 121° C. for 20 min.

[0159] The fermentation method is as follows: seed liquid is inoculated into sugarcane juice or molasses dilution liquid at an inoculation rate of 1.0%, the temperature is controlled at 31° C. and stirred for the first 30 hours, stirring is stopped after 30 hours, and fermentation ends after 84 hours.

[0160] The fermentation broth filtration and concentration method is as follows: the fermentation broth is first centrifuged to remove yeast cells, and then filtered using a 100 nm ceramic membrane and a 50 kDa organic membrane in sequence, and the vacuum concentration temperature is 40°C.

[0161] Example 5

[0162] A method for preparing sugarcane polyphenols by using the brewer's yeast GH-Y16, comprising preparing the brewer's yeast GH-Y16 into seed liquid, inoculating the seed liquid into a molasses dilution liquid for fermentation, and after the fermentation is completed, filtering the fermentation liquid to remove impurities and vacuum concentrating to obtain sugarcane polyphenols.

[0163] The molasses dilution is 18, 20, 22, 24 or 26° Bx.

[0164] The method for preparing the seed solution comprises the following steps:

[0165] S1: The GH-Y16 yeast was inoculated into the activation medium and cultured at 33° C. for 12 h.

[0166] S2: Transfer to the primary seed culture medium and culture at 33°C and 150 rpm for 12 h.

[0167] S3: Transfer to the secondary seed culture medium at a 0.8% inoculum and culture at 33°C and 150 rpm for 12 h.

[0168] S4: After the fermentation liquid is centrifuged, the supernatant is discarded, and the same volume of sterilized 26°Bx sugarcane juice as the supernatant is added to the yeast precipitate and shaken evenly to prepare the seed liquid.

[0169] The activation medium composition and content are as follows: 10g yeast extract, 20g peptone, 20g glucose and 20g agar dissolved in 1000mL distilled water, sterilized at 121°C for 20min;

[0170] The composition and content of the primary seed culture medium are as follows: 10 g yeast extract, 20 g peptone, 20 g glucose and 180 g sucrose are dissolved in 1000 mL distilled water and sterilized at 121° C. for 20 min;

[0171] The components and content of the secondary seed culture medium are as follows: 50 g yeast extract and 100 g peptone are dissolved in 5000 mL 21.0° Bx sugarcane juice and sterilized at 121° C. for 20 min.

[0172] The fermentation method is as follows: seed liquid is inoculated into sugarcane juice or molasses dilution liquid at an inoculation rate of 1.0-4.0%, the temperature is controlled at 33°C and stirred for the first 30 hours, stirring is stopped after 30 hours, and fermentation ends after 96 hours.

[0173] The fermentation broth filtration and concentration method is as follows: the fermentation broth is first centrifuged to remove yeast cells, and then filtered using a 450nm ceramic membrane and a 100kDa organic membrane in sequence, and the vacuum concentration temperature is 60°C.

Claims

1. A strain, characterized in that The strain is Saccharomyces cerevisiae GH-Y16, with a Latin name of Saccharomyces cerevisiae GH-Y16. It has been deposited in the General Microbiology Center of the China Culture Collection Administration, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is January 22, 2024, and the deposit number is CGMCC No. 29719.

2. A bacterial agent prepared using the brewer's yeast GH-Y16 according to claim 1.

3. Use of the brewer's yeast GH-Y16 according to claim 1 or the bacterial agent according to claim 2 in the preparation of sugarcane polyphenols.

4. A method for preparing sugarcane polyphenols by fermentation, characterized in that: The brewer's yeast is prepared into seed liquid, and the seed liquid is inoculated into sugarcane juice or molasses dilution liquid for fermentation. After the fermentation is completed, the fermentation liquid is filtered to remove impurities and vacuum concentrated to obtain sugarcane polyphenols.

5. The method according to claim 4, characterized in that The brewer's yeast is brewer's yeast GH-Y16.

6. The method according to claim 4 or 5, characterized in that: The molasses diluent is 18-26°Bx, and the sugarcane juice is 18-26°Bx.

7. The method according to claim 4 or 5, characterized in that: The preparation method of the sugarcane juice is as follows: fresh and mildew-free sugarcane is selected, leaves and roots are removed, sugarcane juice is squeezed to obtain the sugarcane juice, impurities are filtered out through a sieve, and the juice is heated to 40-60° C. and then passed through a ceramic membrane with a pore size of 100-450 nm, and the sugarcane juice passing through the membrane is evaporated and concentrated to 18-26° Bx.

8. The method according to claim 4 or 5, characterized in that: The method for preparing the seed solution comprises the following steps: S1: The GH-Y16 yeast was inoculated into the activation medium and cultured at 33° C. for 12 h. S2: Transfer to the primary seed culture medium and culture at 33°C and 150 rpm for 12 h. S3: Transfer to the secondary seed culture medium at a 0.8% inoculum and culture at 33°C and 150 rpm for 12 h. S4: After the fermentation liquid is centrifuged, the supernatant is discarded, and the same volume of sterilized 18-26°Bx sugarcane juice as the supernatant is added to the yeast precipitate, and the seed liquid is prepared by oscillating evenly. The activation medium composition and content are as follows: 10g yeast extract, 20g peptone, 20g glucose and 20g agar dissolved in 1000mL distilled water, sterilized at 121°C for 20min; The composition and content of the primary seed culture medium are as follows: 10 g yeast extract, 20 g peptone, 20 g glucose and 180 g sucrose are dissolved in 1000 mL distilled water and sterilized at 121° C. for 20 min; The components and content of the secondary seed culture medium are as follows: 50 g yeast extract and 100 g peptone are dissolved in 5000 mL 21.0° Bx sugarcane juice and sterilized at 121° C. for 20 min.

9. The method according to claim 4 or 5, characterized in that: The fermentation method is as follows: inoculating the seed liquid into the sugarcane juice or molasses dilution liquid at an inoculation rate of 1.0-4.0%, controlling the temperature at 31-33° C. and stirring for the first 30 hours, stopping stirring after 30 hours, and finishing the fermentation after 72-96 hours.

10. The method according to claim 4 or 5, characterized in that: The fermentation broth filtration and concentration method is as follows: the fermentation broth is first centrifuged to remove yeast cells, and then filtered using a 100-450nm ceramic membrane and a 50-100kDa organic membrane in turn, and the vacuum concentration temperature is 40-60°C.

Images