H3N3 avian influenza virus strain and application thereof

Abstract

The invention relates to the field of animal virology, and relates to separation and identification of a chicken-derived H3N3 avian influenza virus strain and application of the chicken-derived H3N3 avian influenza virus strain in vaccine development. The H3N3 subtype avian influenza virus AIV-S03 strain is preserved in the China General Microbiological Culture Collection Center on May 16, 2024, and the preservation number of the H3N3 subtype avian influenza virus AIV-S03 strain is CGMCC (China General Microbiological Culture Collection Center) No.45981. The AIV-S03 strain provided by the invention is subjected to chick embryo amplification and formaldehyde inactivation, and is respectively mixed with a novel 605 adjuvant and a white oil adjuvant to prepare inactivated vaccines of different dosage forms, immune evaluation is performed through a serological method and an immune challenge method, and the two different adjuvant vaccines can both generate a hemagglutination inhibition antibody with the ratio of 1: 64 or above. The challenge protection rate is 100%, and the feed additive has a good protection effect on poultry groups. The invention has an important value for preventing and treating the low-pathogenicity avian influenza virus.

Description

Technical Field

[0001] The present invention relates to the field of animal virology, and provides the separation and identification of an H3N3 avian influenza virus vaccine strain and an inactivated vaccine for preventing avian influenza prepared by using the strain. Technical Background

[0002] Avian influenza virus (AIV) belongs to the influenza virus genus of the Orthomyxoviridae family. According to the difference in the nucleoprotein and matrix protein of influenza virus, it can be divided into three serotypes: A, B, and C. Avian influenza virus belongs to influenza A virus. The influenza A virus particle is spherical with a diameter of about 100nm. The virus has an envelope with 12-14nm filaments on it. There are two different types, HA and NA. The nucleocapsid of the virus is helically symmetrical, and the nucleic acid is a single-stranded negative-strand RNA, which can be divided into 8 fragments with a total length of about 13.6kb. The envelope surface of the avian influenza virus has hemagglutinin (HA), which can agglutinate the red blood cells of many animals and can be inhibited by specific antiserum. AIV can be divided into highly pathogenic AIV and low pathogenic AIV according to its pathogenicity. The highly pathogenic and low pathogenic AIV that infect poultry are mainly H5 and H9, respectively.

[0003] Since 2021, the egg-laying performance of commercial laying hens has seriously declined. The clinical autopsy of dead chickens showed tracheal ring bleeding, large amounts of mucus secreted from the larynx and trachea, obvious bronchial obstruction, lung congestion, kidney swelling in some chickens, and liquefaction of follicles in laying hens. After preliminary separation and identification of the collected diseased materials, H3N3 subtype avian influenza virus was found in the diseased materials.

[0004] It is reported that the N3N3 subtype avian influenza virus belongs to the low pathogenic avian influenza virus, which may be the result of the reassortment of the H3N8 virus and the H10N3 virus. The H3N3 subtype avian influenza has strong adaptability to chickens, and the virus has strong horizontal transmission ability and certain pathogenicity. In addition, relevant domestic scholars have boldly predicted that this virus is currently spreading rapidly among poultry and may affect the health of domestic poultry in the future. Based on the experience of prevention and control of low pathogenic avian influenza, a large number of inactivated vaccines have been produced and used, which has played a good role in the occurrence of avian influenza, and at the same time strengthened the protection of heterologous strains, so that the effect of avian influenza inactivated vaccines can be brought into play. Summary of the invention

[0005] The invention provides the separation and identification of an H3N3 avian influenza virus vaccine strain and different dosage forms of inactivated vaccines for preventing avian influenza prepared by using the strain. The prepared vaccine is a vaccine against avian H3N3 subtype influenza virus.

[0006] The H3N3 subtype avian influenza virus was identified by the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences on November 24, 2023 and classified as the avian influenza H3N3 subtype virus. The strain was deposited in the General Microbiological Center of the China Microbiological Culture Collection (referred to as CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing) on ​​May 16, 2024, with the deposit number CGMCC No. 45981. The H3N3 subtype avian influenza virus is referred to as the AIV-S03 strain.

[0007] The present invention prepares an avian influenza virus vaccine, the active ingredient of which is an inactivated AIV-S03 strain virus. The prepared vaccine is a vaccine against avian H3N3 subtype influenza virus. The preparation method of the avian influenza vaccine,

[0008] The method comprises inactivating the AIV-S03 virus liquid with formaldehyde at a final concentration of 0.2%, inactivating the liquid at 37°C for 24 hours, and mixing the inactivated liquid with a novel 605 adjuvant at a ratio of 1:1 to 4:1 to obtain an avian influenza virus water adjuvant inactivated vaccine.

[0009] The method comprises inactivating the AIV-S03 virus liquid with formaldehyde at a final concentration of 0.2%, inactivating the liquid at 37°C for 24 hours, and mixing the inactivated liquid with a white oil adjuvant at a ratio of 1:2 to 1:3 to obtain an avian influenza virus oil adjuvant inactivated vaccine.

[0010] Compared with the prior art, the present invention achieves beneficial technical effects.

[0011] The avian influenza vaccine prepared in the present invention is used to evaluate the immune effect of the vaccine using a serological method and an immune challenge method. The results show that the avian influenza inactivated vaccine prepared in the present invention has a good protective effect on poultry. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Analysis of HA gene of avian influenza S03 strain (H3N3 subtype)

[0013] Figure 2 Analysis of NA gene of avian influenza S03 strain (H3N3 subtype) DETAILED DESCRIPTION

[0014] Example 1 Isolation and Identification of Avian Influenza Virus AIV-S03 Strain of H3N3 Subtype Avian Influenza Virus

[0015] 1. Virus Isolation and Passaging

[0016] Collect the samples of larynx, trachea, liver and lung from the diseased chickens, mix them, cut them with scissors, grind them into homogenate with glass grinder, add them into sterile saline at 1:5, treat them with ultrasound, centrifuge them at 3000r / min for 15min, take the supernatant and add penicillin (streptomycin) double resistance to 2000IU / mL (2mg / mL), put them in 4℃ refrigerator overnight, filter and sterilize them and pass the bacterial inspection, dilute them 1000 times, and inoculate 20 10-day-old SPF chicken embryos in the allantoic cavity, 0.1ml / piece. The dead chicken embryos within 24 hours after inoculation are discarded, and the allantoic fluid of the dead chicken embryos from 72 to 96 hours and the non-dead chicken embryos after 96 hours are harvested, which are recorded as the first generation.

[0017] The first-generation chicken embryo fluid was neutralized with equal amounts of Newcastle disease positive serum, avian influenza H5 subtype positive serum, avian influenza H7 subtype positive serum, and avian influenza H9 subtype positive serum, and then inoculated into chicken embryos. The allantoic fluid of chicken embryos that died 72 to 96 hours later and those that did not die after 96 hours were harvested, and the chicken embryo fluid was recorded as the second generation.

[0018] The second-generation chicken embryo fluid was neutralized with equal amounts of Newcastle disease positive serum, avian influenza H5 subtype positive serum, avian influenza H7 subtype positive serum, and avian influenza H9 subtype positive serum, and then inoculated into chicken embryos. The allantoic fluid of chicken embryos that died 72 to 96 hours later and those that did not die after 96 hours were harvested, and the chicken embryo fluid was recorded as the third generation.

[0019] After the third generation was diluted 1000 times, 20 10-day-old SPF chicken embryos were inoculated into the allantoic cavity, 0.1 ml / egg. The dead chicken embryos within 24 hours after inoculation were discarded, and the allantoic fluids of the dead chicken embryos between 72 and 96 hours and the non-dead chicken embryos after 96 hours were harvested, and the chicken embryo fluids with a hemagglutination titer of 9 to 11 were mixed and recorded as the fourth generation.

[0020] After diluting the 4th generation 10,000 times, inoculate the allantoic cavity with 20 10-day-old SPF chicken embryos, 0.1 ml / egg. Discard the dead chicken embryos within 24 hours after inoculation, harvest the allantoic fluid of the dead chicken embryos from 72 to 96 hours and the chicken embryos that are not dead after 96 hours, take the chicken embryo fluid with a hemagglutination titer of 9 to 11 and mix them to record the 5th generation. Take the 5th generation chicken embryo fluid for various tests.

[0021] 2. Virus Identification

[0022] 2.1 Hemagglutination test (HA)

[0023] The collected allantoic fluid was used as the sample to be tested, and the HA test was performed to observe the agglutination reaction. The test set up a PBS negative control. The hemagglutination titer was greater than 1:16 and was judged as positive. The results showed that the agglutination titer of the 5th generation chicken embryo allantoic fluid against 1% chicken red blood cells was 1:1024.

[0024] 2.2 Hemagglutination inhibition test (HI)

[0025] According to the results of the agglutination test, 4 working units of antigen were prepared with sterile PBS according to the method in the appendix of the Chinese Veterinary Pharmacopoeia. The test was carried out using a V-type microplate, with a total reaction volume of 75μl. After serial dilution of avian influenza positive serum (H9 subtype, H7 subtype, H5 subtype and H3 subtype), Newcastle disease positive serum, egg drop syndrome positive serum and SPF chicken negative serum with PBS (pH 7.0-7.2), 4 units of antigen were added, and the reaction was allowed to proceed at room temperature for 30 minutes. Then 1% chicken red blood cells were added, gently mixed, and the reaction was allowed to proceed at room temperature for 30±5 minutes to observe the agglutination inhibition reaction. The results showed that it could not react with Newcastle disease, H5 subtype avian influenza positive serum, H7 subtype avian influenza positive serum, H9 subtype avian influenza positive serum, egg drop syndrome positive serum and SPF chicken negative serum, or the reaction was negative; it was positive with equine influenza virus (H3 subtype) positive serum. The results are shown in Table 1.

[0026] Table 1 HI test of avian influenza virus S03 strain

[0027]

[0028] 2.3 RT-PCR Identification of Virus HA and NA Genes

[0029] 2.3.1 Gene amplification

[0030] The 5th generation avian influenza S03 virus liquid was used to extract total RNA using an RNA extraction kit, and then HA and NA gene RT-PCR amplification was performed. According to the primer sequences in Table 2, the target fragments were amplified according to the following system:

[0031] The HA gene amplification system: 2×-R-mix 12.5ul, E-mix 0.5ul, primers HA-F / R 1ul each, RNA extract 10ul, a total of 25ul system. Reaction conditions: reverse transcription 45℃30min; PCR reaction 94℃5min, 94℃45s, 49℃45s, 72℃2min 35 cycles, 72℃10min. After the reaction is completed, store at 4℃.

[0032] The NA gene amplification system: 2×-R-mix 12.5ul, E-mix 0.5ul, primers NA-F / R 1ul each, RNA extract 10ul, a total of 25ul system. Reaction conditions: reverse transcription 45℃30min; PCR reaction 94℃5min, 94℃45s, 44℃45s, 72℃2min 35 cycles, 72℃10min. After the reaction is completed, store at 4℃.

[0033] The PCR products were subjected to 1% agarose gel electrophoresis to analyze the target fragments, and the target fragments of the expected size were obtained, with the HA gene being approximately 1600 bp and the NA gene being approximately 1400 bp.

[0034] Table 2 Primer sequences of viral HA and NA genes

[0035]

[0036] 2.3.2 Evolutionary analysis of HA and NA genes

[0037] The HA and NA genes of the avian influenza S03 strain were amplified by RT-PCR, and the target fragments were recovered and sent to Beijing Bioengineering for sequence determination. The sequence analysis was performed using clustalx and MEGA software. The evolutionary analysis was performed using the HA sequences of avian influenza (H3 subtype) and NA sequences of avian influenza (N3 subtype) in recent years. The results showed that the avian influenza (H3 subtype) S03 strains were all strains that were prevalent in the past two years. From the analysis of kinship, the HA gene of H3 was closer to H3N8 and farther from H3N2; the NA gene of N3 was closer to H10N3 and farther from H1N3, H7N3 and the earlier isolated H3N3.

[0038] 2.4 Virus regression test

[0039] The 5th generation of the virus liquid of the bird flu S03 strain was inoculated into 10 SPF chickens of 42 days old. On the 5th day after the inoculation of the SPF chickens, the virus isolation positive rate of the 10 SPF chickens was 100% (10 / 10). 14 days after the attack, the serum of 10 SPF chickens was collected, and all of them could react positively with the H3 subtype HI antigen (HI antibody titer was not less than 4log2). The chicken embryo allantoic fluid with positive virus isolation after the bird flu S03 strain was attacked by the virus was extracted by RNA extraction kit and then RT-PCR amplification was performed. The results showed that the virus inoculation group amplified the target fragments of HA and NA genes consistent with the expected size. The virus isolation of the physiological saline inoculation group was negative. The results are shown in Table 3.

[0040] Table 3 Virus virulence regression test results

[0041]

[0042] 2.5 Determination of virus EID50

[0043] The 5th generation virus solution of avian influenza virus S03 strain was tested using 10-day-old SPF chicken embryos. The results showed that the virus titer reached 10. 8.5 EID 50 / 0.1ml.

[0044] 2.6 IVPI test

[0045] The fifth-generation virus solution of the S03 strain of avian influenza virus was inoculated into 42-day-old SPF chickens via the wing vein. After 10 days of observation, all the chickens were alive and well without showing any clinical symptoms. The chickens in the control group also showed no abnormalities, and the IVPI was 0.

[0046] The results showed that a strain of H3N3 subtype low pathogenic avian influenza virus was isolated.

[0047] Example 2 Preparation of AIV-S03 strain vaccines with different adjuvants

[0048] 1. Preparation of antigen solution for vaccine production

[0049] Take the 5th generation of avian influenza S03 virus liquid for production, and use sterile saline to make 10 -4 Dilute and inoculate 10-day-old SPF chicken embryos, inoculate 0.1 ml in the allantoic cavity of each embryo, seal the pinhole after inoculation, and continue incubating at 37°C without turning the eggs. After the chicken embryos are inoculated, light the eggs once a day, and discard the chicken embryos that died 48 hours ago. Thereafter, light the eggs once every 4 to 6 hours, and take out the dead chicken embryos at any time until 96 hours. Regardless of whether they are dead or not, take them all out, with the air chamber facing vertically, and place them at 2 to 8°C to cool for 24 hours. Take out the cooled chicken embryos, disinfect the air chamber part with iodine tincture, and then peel off the eggshell of the air chamber part with sterile surgery, remove the eggshell membrane, cut the chorioallantoic membrane and amnion, and absorb the embryo fluid. Each chicken embryo should be carefully checked before absorbing the embryo fluid. Any fetus corruption, turbid embryo fluid, or any suspected contamination should be discarded. Dead embryos and live embryos were harvested separately, and several chicken embryos were divided into one group. The embryo fluid was aspirated and placed in the same sterilized container. Samples were taken from each group to measure the hemagglutination titer. Those with a hemagglutination titer lower than 1:256 (micro-measurement method) were discarded.

[0050] 2. Inactivation

[0051] Add 10% formaldehyde solution to the harvested chicken embryo liquid, shake it as you add it, and mix it thoroughly. The final concentration of the formaldehyde solution is 0.2%. After adding the formaldehyde solution, it is best to pour it into another bottle to prevent the virus adhering near the bottleneck from contacting the inactivator. Then inactivate it at 37℃ for 24 hours (start the time when the temperature in the bottle reaches 37℃). After inactivation, store the virus liquid at 2-8℃.

[0052] 3. Sterility test

[0053] The inactivated embryo fluid should be obtained according to the method in the appendix of the current "Chinese Veterinary Pharmacopoeia" and should be sterile for growth.

[0054] 4. Inactivation test

[0055] Take 10 10-day-old SPF chicken embryos, inoculate each embryo with 0.2 ml, and continue to incubate at 37°C. Remove the dead chicken embryos within 24 hours, and observe for 5 days. The non-specific death of chicken embryos should not exceed 2. Harvest the embryonic fluid of all chicken embryos, and then observe the fetal lesions of the chicken embryos. There should be no lesions in all of them. Determine the hemagglutination value of all embryonic fluids separately, and there should be no hemagglutination. Mix the harvested chicken embryonic fluids, blindly pass them for 1 generation, and there should be no lesions in the fetuses of the chicken embryos. There should be no hemagglutination in all embryonic fluids, and it is considered to be completely inactivated.

[0056] 5. Toxicity determination

[0057] The embryo fluid taken before inactivation was diluted 10 times in series, and 10 -7 , 10 -8 , 10 -9 Inoculate 5 10-day-old SPF chicken embryos at 3 dilutions, 0.1 ml of allantoic fluid in each embryo, and observe for 5 days. The hemagglutination titer of all embryos, whether dead or alive, should be measured. Those with a hemagglutination titer of no less than 1:64 are considered infected and the EID is calculated. 50 , the virus content per 0.1ml is 10 8.5 EID 50 , used to prepare vaccines.

[0058] 6. Preparation of inactivated vaccines

[0059] 6.1 Preparation of water-adjuvanted vaccines

[0060] After the 605 adjuvant is mixed according to the proportion of various substances, it is mixed evenly, sterilized by high pressure at 4 degrees and stored for later use. The inactivated avian influenza S03 virus liquid and the adjuvant are mixed in a ratio of 1:1 and 4:1. The avian influenza (H3 subtype) virus S03 virus titer before inactivation is 10 8.5 EID 50 / 0.1ml. Stir at a speed of 100-500r / min for not less than 30 minutes. Pack quantitatively, seal with a cover, label, and store water adjuvant vaccine group 1 and water adjuvant vaccine group 2 at 2-8℃.

[0061] Table 4 Components of water adjuvant inactivated vaccine

[0062]

[0063] Table 5 Main ingredients of 605 adjuvant

[0064]

[0065] 6.2 Preparation of oil adjuvanted vaccines

[0066] 6.2.1 Oil phase preparation

[0067] Take 94 parts of white oil for injection and 6 parts of Span-80, mix them, sterilize them by high pressure at 116°C for 30 minutes, and cool them to room temperature for use.

[0068] 6.2.2 Preparation of aqueous phase

[0069] The inactivated antigen of the avian influenza S03 virus liquid that passed the test, the virus titer of the avian influenza (H3 subtype) S03 virus before inactivation was 10 8.5 EID 50 / 0.1ml. Then mix 96 parts of antigen and 4 parts of sterile Tween-80 evenly to dissolve Tween-80 completely and set aside.

[0070] 6.2.3 Emulsification

[0071] Pour 2 portions of the oil phase into a sterile beaker, start the motor to stir slowly, then slowly add 1 portion of the water phase, and after adding, emulsify at 8000-10000r / min for 10-15 minutes. After emulsification, quantitatively package. Cover and seal, label, and store 3 groups of oil adjuvant vaccines at 2-8℃.

[0072] Pour 3 portions of the oil phase into a sterile beaker, start the motor to stir slowly, then slowly add 1 portion of the water phase, and after adding, emulsify at 8000-10000r / min for 10-15 minutes. After emulsification, quantitatively package. Cover and seal, label, and store 4 groups of oil adjuvant vaccines at 2-8℃.

[0073] Example 3 Vaccine safety effect detection

[0074] 40 7-day-old SPF chickens were used, and 0.6 ml of vaccine was injected subcutaneously in the neck of each chicken. After 14 days of observation, the spirit, feeding, drinking, breathing, fur, feces, and actions of all vaccinated chickens should be normal, and there should be no local reactions such as redness, swelling, ulcers, nodules, and granulomas caused by the vaccine at the injection site. In addition, 20 chickens were taken as controls, 10 of which were injected with normal saline, and 10 were used as blank controls. The results showed that there was no residue in water adjuvant vaccine group 1 and water adjuvant vaccine group 2, and no local and systemic adverse reactions were caused; there was vaccine residue in oil adjuvant vaccine group 3 and oil adjuvant vaccine group 4, but no local reactions such as swelling and ulcers were caused. The results are shown in Table 6.

[0075] Table 6 Safety test of inactivated vaccines with different adjuvants

[0076]

[0077]

[0078] The results showed that the isolated H3N3 subtype low pathogenic avian influenza virus S03 strain was safe for chickens when used to prepare water-adjuvanted vaccines and oil-adjuvanted vaccines.

[0079] Example 4 Vaccine Immune Effect Detection

[0080] 1. Serological testing

[0081] 45 21-day-old SPF chickens were used, 10 chickens were vaccinated in each group, and the vaccine was injected subcutaneously in the neck

[0082] 0.2ml, and another 5 were used as controls. On the 14th, 28th, and 42nd day after vaccination, blood was collected from each chicken, and the serum was separated. The HI antibody was measured using the H3 subtype antigen of the avian influenza virus. The results showed that protective antibodies were produced on the 14th day, and the antibody titer remained high until the 42nd day, indicating high protective power. The serum antibodies in the water adjuvant vaccine group 2 and the oil adjuvant vaccine group 3 were higher, which may be related to the antigen content in the vaccine.

[0083] The results are shown in Table 7.

[0084] Table 7 Changes in avian influenza antibody levels in serum from different adjuvant vaccines

[0085]

[0086]

[0087] Note: The HI titer level of the antibody is the geometric mean of each group

[0088] 2. Immune attack method

[0089] 45 21-day-old SPF chickens were used, 10 in each group were vaccinated, 0.2 ml of vaccine was injected subcutaneously in the neck, and the other 5 were used as controls. 21 days after vaccination, the H3 subtype AIV-S03 strain virus was diluted 1:10 for wing vein injection, 0.2 ml per chicken. On the 5th day after the challenge, the cloacal cotton swabs of each chicken were collected, and the cloacal cotton swabs of the same chicken were inoculated into 5 10-day-old SPF chicken embryos through the allantoic cavity, 0.2 ml per embryo, and observed for 5 days, and the HA titer of the chicken embryo fluid was determined embryo by embryo. The results showed that the HA titer of 5 chicken embryos inoculated with cotton swabs of 10 chickens in water adjuvant vaccine group 1, water adjuvant vaccine group 2, oil adjuvant vaccine group 3, and oil adjuvant vaccine group 4 was less than 1:2, and the HA titer of the cotton swabs of 5 chickens in the control group was between 7 and 10. After immunization of the chickens, the virus isolation of the vaccine group was all negative, and the virus isolation of 5 chickens in the control group was positive. After vaccination, the antibodies produced can protect against infection by AIV-S03 strain. The results are shown in Table 8.

[0090] Table 8 Protection results of different adjuvant vaccines against avian influenza (H3 subtype)

[0091]

[0092]

[0093] The results showed that a low pathogenic avian influenza virus S03 strain of the H3N3 subtype was isolated and used to prepare inactivated vaccines in different dosage forms of water adjuvant and oil adjuvant. After immunizing chickens, high levels of antibodies were produced, not less than 1:64 (6.0log2), and the antibodies were able to resist viral infection.

[0094] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above examples, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art are considered to be within the scope of protection of the present invention.

[0095] SEQ ID No.1: Nucleic acid sequence of HA gene

[0096] ATGAAGACCATTATTGCATTGAACTACATTCTCTGCCTGGCATTTGGCCGG

[0097] AATCTTCCAGGGAAAGACAGCAGCACAGCAACACTCTGTCTGGGACATCAT

[0098] TCAGTGCCGAATGGAACAATAGTCAAGACAATCACTGACGATCAGATTGA

[0099] GGTGACCAATGCTACTGAGTTGGTTCAAAATTCCTCAAAGGGAAAATATGC

[0100] AACAATCCTCACAAGGTTCTTGATGGAAGAGGCTGCACATTAATAGATGCC

[0101] TTGCTTGGAGACCCTCATTGTGATGTTTTTCAAGATGAAAAGTGGGATCTC

[0102] TTTGTTGAGCGAAGCGGTGCTTTCAGCAATTGTTATCCTTATGATGTGCCG

[0103] GATTATGCCTCCCTTCGATCCCTAATTGCTTCCTCAGGCACACTGGACTTCA

[0104] TTACTGAAAGTTTCATCTGGGCAGGAGTGAGCCAGAATGGAGGAAGCAGT

[0105] GCCTGCAAAAGAGGACCTGCCAACGGTTTCTTCAGCAGATTGAACTGTTGA

[0106] CTAGTCAGAGCTCATATCACTATGAACGTGACTATGCCTACAATTACAATTT

[0107] GACAGCTTATACATCTGGGGGTTCACCACCCAGTACAACCAAGAACAGACT

[0108] AACCTATATGTTCAAGCCTCAGGAAGAGTCACAGTCTCCACCAGGAGAAGC

[0109] CAACAAACCATAGTCCCAAACATTGGATCTAGACCTTGGGTGAGAGGTCAA

[0110] TCTGGTAGAATAAGTATATATTGGACAATAGTCAAACCTGGTGACGTACTA

[0111] GTAATCAATAGTAATGGAAATCTGATTGCGCCTCGGGGATTTTTCAAGATC

[0112] CGGACCGGAAGAAGCTCAATAATGAGGTCAGATGCACCTATAGAAACTTG

[0113] CATTTCAGAATGCATTACCCCAAATGGAAGCATTCCCAATGACAAGCCTTTT

[0114] CAAAATGTAAACAAAATCACATACGGGGCATGCCCCAAATACGTGAAGCAA

[0115] AATACCCTAAAGTTGGCTACAGGGATGAGGAATGTGCCTGAGAAGCAAAC

[0116] CAGAGGTATATTCGGTGCAATAGCAGGATTCATAGAGAATGGGTGGGAA

[0117] GGAATGATAGATGGTTGGTATGGCTTCAGGCACCAAAATTCTGAAGGCAC

[0118] AGGACAAGCTGCAGATCTTAAAAGCACTCAAGCGGCCATTGATCAAATCAA

[0119] TGGGAAATTGAACAGAGTGATTGAAAAGACGAATGAAAAATTCCATCAAA

[0120] TCGAAAAGGAATTCTCCGAAGTTGAAGGGAGAATTCAAGATCTTGAGAAA

[0121] TATGTTGAGGACACAAAAGTGGATCTATGGTCTTATAATGCAGAGCTTCTT

[0122] GTTGCTCTGGAGAACCAGCATACAATTGACCTGACAGACTCTGAGATGAAC

[0123] AAGTTATTTGAAAAGACCAGAAGGCAGCTAAGAGAGAATGCTGAAGATAT

[0124] GGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCTTGCATCGA

[0125] ATCAATTAGGAACGGGACTTATGACCATGACATATACCGAGACGAGGCACT

[0126] GAACAATCGGTTCCAGATCAGAGGTGTTGAACTAAAATCTGGATACAAAG

[0127] ACTGGATTCTGTGGATTTCCTTTGCCATATCATGCCTTTTGCTTTGTGTTGT

[0128] ATTGTTGGGGTTCATTATGTGGGCTTGCCAGAAAGGCAACATTAGGTGCA

[0129] ACATTTGCATTTGA

[0130] SEQ ID No.2: Nucleotide sequence of NA gene

[0131] ATGAATCCAAACAGAAAATAATAACACTCGGTATAGTGAACACAACCCTGT

[0132] CAACATTGGCCCTCCTCATTGGAATTGGAAATCAGATTTTCAACATTGTTAT

[0133] ACATGAGAAAGTAGGAGTACATCAAACTGTGGTATGCCCAACAACAACACC

[0134] CCCAGTGGTACCAAACTGCAGTGGAACCACAATTACATACAACAACACTGT

[0135] GGTAAACAACATAACAACAACAATAGTAAATAAAGCGAAAAAGCAGTTCAA

[0136] GTCCTCACTGCCACTGTGTCCCTTCCGAGGCTTCTTCCCCTTCCATAAGGAC

[0137] AATGCAATACGATTGGGTGAAAACAAAGATGTAATAGTCACAAGGGAGCC

[0138] CTATGTCAGTTGTGACAATGATGATTGCTGGTCCTTCGCCCTTGCCCAAGG

[0139] GGCTCTGCTAGGAACTAAACACAGCAATGGAACCATAAAAGATAGAACACC

[0140] GTATAGATCATTGATTCGATTCCCGATAGGGACAGCTCCAGTGCTGGGCAA

[0141] TTACAAGGAAATATGTGTTGCTTGGTCAAGTAGCAGTTGTTTCGATGGAAA

[0142] GGAATGGATGCATGTCTGCATGACTGGAAATGACAATGATGCTAGTGGCC

[0143] AAATAATATATGCCGGAAGGATGACAGACTCCATCAAATCATGGAGAAGA

[0144] GACATATTAAGAACTCAAGAGTCTGAATGTCAATGCATTGATGGGACCTGT

[0145] ATTGTCGCCATTACAGATGGCCCTGCGGCTCATAGTGCAGACCACAGAATT

[0146] TACTGGATACTAGAAGGGAAGATAATAAAGTATGAAAACATTCCCAAAACA

[0147] AAGATACAACACTTAGAGGAGTGTTCTTGCTATGTGGACATCGATGTGTAC

[0148] TGCATATGTAGGGATAATTGGAAAGGTTCTAACAGGCCCTGGGTGAGGAT

[0149] CAACAATGAGACCATAATAGAAACAGGGTATGTATGCAGCAAATTTCATTC

[0150] AGACACCCCCAGGCCAGCCGATCCCTCAACAATATCATGTGATTCCCCAAGT

[0151] AATATAAATGGAGAACCTGGAGTCAAGGGATTTGGCTTCAAAGCGGGTAA

[0152] TGATGTATGGCTGGGAAGGACGGTATCTATTACTGGAAGATCAGGCTTTG

[0153] AAGTCATTAAGGTCACAGAAGGATGGATCAATTCCCCCAATCATACTAAAT

[0154] CAGTTACACAGACACTAGTACCGAACAGCAACTGGTCAGGTTACTCAGGGA

[0155] GTTTCATTGTCGAGAACAACGGCTGTTTTCAGCCTTGCTTCTATATAGAACT

[0156] CATACGAGGAAGGCCCAATAGAGGCGATGATGTTTCCTGGACAAGCAATA

[0157] GTATAGTTACTTTCTGTGGACTAGACAATGAACCTGGATCGGGAAATTGGC

[0158] CTGATGGTTCCAACATTGGGTTCATGCCCAAGTAA

Claims

1. An avian influenza virus strain, characterized in that: It is an avian influenza H3N3 subtype virus AIV-S03 strain, with a preservation number of CGMCC No.45981. The nucleic acid sequence of the HA gene of the avian influenza virus strain is shown in SEQ ID No.1, and the nucleic acid sequence of the NA gene of the avian influenza virus strain is shown in SEQ ID No.

2.

2. An application of an avian influenza virus strain in the preparation of biological products, characterized in that: The avian influenza virus strain is the avian influenza H3N3 subtype virus AIV-S03 strain, with a preservation number of CGMCC No.45981. The biological product is any one of an avian influenza vaccine, an antigen reagent for diagnosing avian influenza virus, or a positive serum preparation for diagnosing avian influenza virus.

3. The use according to claim 2, characterized in that: The avian influenza vaccine is an inactivated vaccine.

4. The use according to claim 3, characterized in that: The preparation method comprises the following steps: inoculating chicken embryos with the AIV-S03 strain virus, harvesting infected embryo fluid, inactivating the fluid with formaldehyde, and mixing the fluid with a novel oil-free adjuvant 605 adjuvant in a ratio of 1:1 to 4:

1.

5. The use according to claim 4, characterized in that The AIV-S03 virus strain is used to inoculate chicken embryo culture, and the infected embryo fluid is harvested, inactivated by formaldehyde, and then emulsified with a white oil adjuvant in a ratio of 1:2 to 1:

3.

6. A biological product prepared using the avian influenza virus strain according to claim 1, wherein the biological product is any one of an avian influenza vaccine, an antigen reagent for diagnosing avian influenza virus, or a positive serum preparation for diagnosing avian influenza virus.

Images