Beta-amylase thermal stability regulation and control method and application thereof

Abstract

The invention discloses a beta-amylase thermal stability regulation and control method and application thereof, relates to the technical field of molecular biology, and regulates the thermal stability of plant beta-amylase by regulating and controlling the type of amino acid on the 118 site on an amino acid fragment as shown in SEQ ID NO.2. The new key gene locus influencing the thermal stability of the beta-amylase is developed, molecular support is provided for adjusting the thermal stability of the barley variety beta-amylase, and the important scientific research and practical value is achieved.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, in particular to a method for regulating the thermal stability of beta-amylase and an application thereof. Background Art

[0002] β-amylase plays a key role in craft beer. It is an important hydrolase in the brewing industry. β-amylase specifically acts on the non-reducing end of starch, gradually releases maltose by hydrolyzing α-1,4-glycosidic bonds, improves saccharification efficiency and optimizes the sugar composition of wort. The maltose generated is closely related to the aroma and flavor of beer, which can improve the quality of beer. Combined with pullulanase, low-sugar craft beer can be produced to meet health needs. Compared with artificially added yeast, using β-amylase in barley grains is more natural and safe, which is conducive to maintaining the original flavor of beer.

[0003] Different studies have shown that the thermal stability of barley grain β-amylase varies significantly between different varieties, including studies on wild barley, cultivated barley, Australian barley varieties, Italian cultivated barley, and Swedish cultivated barley. Plant genotype determines the thermal stability of barley grain β-amylase; the activity of barley grain β-amylase is significantly affected by the variety. The Bmy1 gene encodes seed-specific β-amylase. The thermal stability of β-amylase in barley materials can be divided into high thermal stability type (type A), medium thermal stability type (type B), and low thermal stability type (type C) (Kihara et al. 1998, Kaneko et al. 2002). Ma et al. (2001) reported that β-amylases with different thermal stabilities are caused by the substitution of two amino acids (V233A and L347S). These two mutations increase the thermal stability index T50 value (the temperature at which β-amylase activity is half lost) of β-amylase by 1.9℃ (B to A) and 2.1℃ (C to B), respectively.

[0004] In summary, the regulation of β-amylase activity is of great significance. It is not only convenient for achieving precise control of the beer brewing process and meeting different quality and production requirements, but can also be expanded to more food, beverage, chemical and pharmaceutical industries.

[0005] Therefore, developing relevant molecular tools to achieve the regulation of β-amylase activity is a technical challenge that needs to be solved urgently. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a method for regulating the thermal stability of beta-amylase and application thereof.

[0007] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0008] The present invention comprises an amino acid fragment with single-site polymorphism, whose amino acid sequence is shown in SEQ ID NO.2 in the sequence table, and wherein the amino acid at position 118 has polymorphism; the polymorphism has the biological effect of regulating the enzyme activity of the amino acid fragment.

[0009] As a preferred technical solution of the present invention, the polymorphism includes: the amino acid at position 118 mutates / substitutes from N to D to form a new amino acid fragment; and / or the amino acid at position 118 mutates / substitutes from N to other amino acids to form a new amino acid fragment.

[0010] The present invention also includes an amino acid sequence having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the above-mentioned amino acid fragment.

[0011] The present invention also includes a nucleotide fragment A encoding the above-mentioned amino acid fragment; and / or a nucleotide fragment B equivalent to the nucleotide fragment A in molecular biology; and / or a nucleotide fragment C obtained by expression or post-expression modification in molecular biology to obtain the amino acid fragment.

[0012] The present invention also includes a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the above-mentioned nucleotide fragment.

[0013] The present invention also includes a primer combination for amplifying the above-mentioned nucleotide fragment.

[0014] The present invention also includes the use of the above-mentioned amino acid fragment, the above-mentioned nucleotide fragment, the above-mentioned recombinant expression vector or expression cassette or transgenic cell line or recombinant bacteria, and the above-mentioned primer combination to adjust the thermal stability of plant β-amylase by regulating the type of amino acid at position 118 on the amino acid fragment of SEQ ID NO.2.

[0015] Based on the above-mentioned uses, the thermal stability of plant β-amylase is adjusted in relevant industries according to production needs, specifically including: increasing the thermal stability of plant β-amylase based on the amino acid type at position 118 on the amino acid fragment described in SEQ ID NO.2 and decreasing the thermal stability of plant β-amylase based on the amino acid type at position 118 on the amino acid fragment described in SEQ ID NO.2; potential application scenarios for increasing the thermal stability of plant β-amylase are: increasing the activity of amylase to thoroughly saccharify starch, thereby preparing various beverages or fillings with high sugar content, high alcohol content, refreshing taste, low turbidity and high stability; potential application scenarios for decreasing the thermal stability of plant β-amylase are: reducing the activity of amylase to inhibit the saccharification effect of starch, thereby preparing various beverages or fillings with low sugar content, low alcohol content but mellow taste.

[0016] The present invention also includes a SNP site, which is related to the thermal stability of plant β-amylase. The SNP site corresponds to the 567th base from the 5' end of the sequence shown in SEQ ID NO.1. The site has two genotypes, A or G. The dCAPS primer combination used to detect the genotype of the SNP site is shown in SEQ ID NO.3-8 in the sequence table.

[0017] The present invention also includes a primer combination for detecting the single nucleotide polymorphism of the above-mentioned SNP site.

[0018] The present invention also includes a gene detection kit for the single nucleotide polymorphism of the above-mentioned SNP site, wherein the gene detection kit comprises a buffer, a polymerase, dNTPs, a template sequence, and a primer; the primer is the primer combination described above.

[0019] The beneficial effect of adopting the above technical solution is that: the present invention develops new key gene sites that affect the thermal stability of β-amylase, provides molecular support for adjusting the thermal stability of β-amylase in barley varieties, and has important scientific research and practical value.

[0020] The new technology developed by the present invention can not only be used for the precise control of the beer brewing process to meet different quality and production requirements; it can also be expanded to more food, beverage, chemical and pharmaceutical industries, etc., and has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The diagram is a schematic diagram of the isoelectric focusing (IEF) electrophoresis type of representative cultivated barley β-amylase; in the figure, lane 1: Harrington; 2: OUNI096; 3: OUC1152; 4: HarunaNijo; 5: OUI429; 6: OUI462; 7: OUU421;

[0022] Figure 2 Schematic diagram of the phylogenetic tree constructed based on the genomic DNA sequences of Bmy1 alleles;

[0023] Figure 3 A schematic diagram of the difference sites of the genome sequences of OUI429 and CAS140 extracted using DNAMAN;

[0024] Figure 4 Schematic diagram of the remaining β-amylase activity of different barley varieties after heat treatment at different temperatures for 30 minutes;

[0025] Figure 5is the banding pattern of OUI429; in the figure, "Screened with 1 enzyme, 0 sites found" means that one enzyme (BspMII) was used for enzyme digestion, and 0 enzyme cutting sites were found in the sequence; "BspMII T / CCGGA / 0"; "Fragments generated by digestion (bp): Linear DNA: 125" indicates that the size of the fragments generated after enzyme digestion is still 125 base pairs; the sequence of the amplified fragment of OUI429 is given later, and there is no BspMII enzyme cutting site in the sequence;

[0026] Figure 6 is the relevant banding pattern map of CAS140; in the figure, "Screened with 1 enzyme, 1 sites found" means that one enzyme (BspMII) was used for enzyme digestion, and 1 enzyme cutting site was found in the sequence; "BspMII T / CCGGA 1:15" indicates the sequence characteristics of the BspMII enzyme cutting site and that there is a site with a fragment size of 15; "List by Site Order" lists the BspMII enzyme cutting sites with a fragment size of 15 in site order; "Fragments generated by digestion (bp): Linear DNA: 15, 110" indicates that the fragment sizes generated after enzyme digestion are 15 and 110 base pairs respectively; the amplified sequence of CAS140 is given in the latter part of the picture, and a BspMII enzyme cutting site is marked in the sequence. DETAILED DESCRIPTION

[0027] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained through market purchase. Among them, Chinese barley materials are provided by the Crop Germplasm Resources Institute of the Chinese Academy of Agricultural Sciences, and the remaining materials are owned by the Institute of Biological Resources of Okayama University (see Table 1).

[0028] Table 1. List of 15 typical cultivated barley materials used for DNA sequencing

[0029]

[0030] It should be understood that the term "and / or" used in the present specification and the appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations. As used in the present specification and the appended claims, the term "if" can be interpreted as "when..." or "once" or "in response to determination" or "in response to detection" depending on the context. Similarly, the phrase "if it is determined" or "if [the described condition or event] is detected" can be interpreted as meaning "once it is determined" or "in response to determination" or "once [the described condition or event] is detected" or "in response to detection of [the described condition or event]" depending on the context.

[0031] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the description and cannot be understood as indicating or implying relative importance. References to "one embodiment" or "some embodiments" etc. described in the present application specification mean that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways.

[0032] The terms "include", "comprising", "having" and variations thereof all mean "including but not limited to", unless specifically emphasized otherwise.

[0033] Example 1: Technical Operation Scheme of This Study

[0034] 1.1. Barley β-amylase crude extraction scheme

[0035] The crude β-amylase was extracted basically according to the method of Kihara et al. (1998). Several or more seeds were extracted according to the seed size. The barley seeds were ground and added to the extract solution (1 mg flour: 5 μl acetate buffer, 50 mM, pH 5.5, containing 10 mM dithiothreitol) and shaken at 4°C for 12 hours. The extract was centrifuged at 15000 rpm for 10 min at 4°C, and the supernatant was used as the crude enzyme solution for heat stability. At least two samples were analyzed for each addition to check the difference.

[0036] 1.2. Barley β-amylase thermal stability analysis scheme

[0037] The barley β-amylase extract was diluted 100 times with 50 mM MOPS buffer (pH 7.1) containing 1% bovine serum albumin V (Sigma Chemical Co.), 50 μl of the diluted sample was incubated at 57.5°C for 30 minutes, immediately cooled in ice water, and the β-amylase activity of the heat-treated and untreated samples was measured using the BETAMYL kit (Megazyme Ltd., Wicklow Ireland), and the relative residual activity (%) was calculated as activity after heat treatment / activity without treatment (Kihara et al. 1998). Among them, cultivated barley Hanura Nijo, Harrington and Schooner were used as control varieties of A, B and C types.

[0038] 1.3 DNA extraction protocol

[0039] Genomic DNA was extracted according to the CTAB method (Zhang et al., 2007). The plant tissue was placed in a 2 mL centrifuge tube, and one sterilized steel bead was added. The tube was frozen in liquid nitrogen and ground in a ball mill. 800 μL of CTAB extraction buffer was added and the tube was incubated at 65°C for 1 h. The tube was mixed several times every 15 min. 800 μL of phenol:chloroform:isopropanol (25:24:1) was added and mixed by inversion. The tube was centrifuged at 12,000 rpm for 10 min. The upper aqueous phase was transferred to a new 2 mL centrifuge tube. An equal volume of chloroform:isopropanol (24:1) was added and mixed by inversion. The tube was centrifuged at 12,000 rpm for 10 min. The supernatant was transferred to a new 1.5 mL centrifuge tube. 0.6 times the volume of isopropanol was added and the tube was precipitated at -20°C for more than 30 min. The tube was centrifuged at 12,000 rpm for 10 min, the supernatant was discarded, and 75% ethanol was added for washing twice. The tube was dried for about 40 min and water was added to dissolve the DNA.

[0040] 1.4 PCR amplification protocol

[0041] The PCR amplification scheme was designed as follows. Three pairs of PCR primers (F1, R1; F2, R2 and F3, R3) were designed based on the genomic DNA sequence of the Bmy1 gene of Haruna Nijo (Genbank D49999), which overlap and cover the entire region, including the translation start codon ATG and the translation stop codon TAA. The information of these primers is as follows; the PCR process is as follows: after pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 59°C for 40 seconds, extension at 72°C for 2 minutes, 30 cycles, and finally extension at 72°C for 5 minutes. The PCR amplification products were recovered by 1% agarose / EtBr gel electrophoresis, subcloned into the pMD18-T vector (Takara, Japan), and sequenced.

[0042] The 15 typical cultivated barley materials used for DNA sequencing are shown in Table 1. In the table, the numbers in the * brackets represent different CAPS types; A, B, and C represent high thermal stability, medium thermal stability, and low thermal stability, respectively; I, Ia, II, IIa, IIb, IIc, and IV represent different IEF isoelectric focusing electrophoresis modes; Type A: 58-62%; Type B: 25-34%; Type C: 1-5%.

[0043] Example 2: Thermal stability test, isoelectric focusing electrophoresis and CAPS analysis of β-amylase from cultivated barley materials

[0044] The thermostability test and isoelectric focusing electrophoresis analysis of β-amylase from 8,270 cultivated barley materials worldwide showed that there was a wide range of genetic variation at the Bmy1 locus, and a total of 14 different types were identified. Among them, the thermostability was determined by measuring the residual enzyme activity of β-amylase after heat treatment at 57.5 degrees Celsius for 30 minutes. According to the general standard, type A: residual enzyme activity is 60±2%, type B: residual enzyme activity is 30±2%, and type C: residual enzyme activity is 3±2%. The identification results showed that the thermostability of β-amylase is mainly divided into five types. In addition to the previously reported types A, B, and C, there is also type A+: residual enzyme activity is 68%, and type AB: residual enzyme activity is 38-47%. Then, isoelectric focusing electrophoresis analysis was performed on barley cultivars, which can be divided into a total of 7 types: I, I a, II a, II, II b, II c, IV ( Figure 1 ), based on the thermal stability data and isoelectric focusing electrophoresis data of different varieties, they can be divided into 14 types: A-II, BI, B-Ia, B-II, C-II, A+-II, A-Ia, A-IIa, AB-IIb, AB-IIc, CI, C-Ia, C-IV and no β-amylase.

[0045] It can be seen that 516 samples (including all 14 types mentioned above) were selected from 8270 cultivated barley samples for further CAPS analysis, using six endonucleases BglⅡ, DdeⅠ, DraⅠ, HaeⅢ, HinfⅠ, and TaqⅠ, and a total of 9 CAPS types were obtained (Table 2). Combined with the previous thermal stability and isoelectric point electrophoresis results, a total of 16 Bmy1 allele types were obtained (Table 3).

[0046] Table 2 CAPS typing study of cultivated barley using 6 restriction endonucleases Different letters represent different banding polymorphisms

[0047]

[0048]

[0049] Table 3 Statistical analysis of Bmy1 allele types in cultivated barley by combining β-amylase thermostability, isoelectric focusing and Bmy1 gene CAPS typing data

[0050]

[0051] Example 3. Processing and analysis of typical cultivated barley materials

[0052] The β-amylase of cultivated barley materials analyzed previously were limited to three types: Sd2H (A-II), Sd1 (BI) and Sd2L (C-II). Twelve of the 16 Bmy1 allele types in this study were newly reported. Since the thermostability type and IEF pattern of β-amylase are determined by the Bmy1 gene sequence, 13 typical cultivated barley materials representing 12 Bmy1 allele types were sequenced in this study. The detailed information of the barley materials is shown in Table 1. The analysis of the control Bmy1 gene sequence difference sites shows that the total length of different types of Bmy1 alleles varies greatly, ranging from 3585 to 3766 bp. In general, these different Bmy1 alleles can be divided into three groups, namely the HarunaNijo-like group, the Schooler-like group and the Harrington-like group. The Haruna nijo-like group included alleles Bmy1 A-II (CAPS types 5, 6, and 7), Bmy1 AB-IIb, Bmy1 AB-IIc, and Bmy1 A-IIa. The significant changes in this group compared to the other two groups were ： In intron III, there is an 11-bp (TTGAAAGTAGG) insertion, a 6-bp (ACTCGT) deletion, a 4-bp (ACGC) deletion, and a 5-bp (TCGTA) substitution. The Schooner-like group consists of C-II, C-IV, and B-II type alleles, and the most unique nucleotide change in these alleles is the insertion of 126 bp in the 5'-proximal end of intron III. The Harrington-like group can be easily distinguished from the other two groups by the insertion of 14 bp (atagatatatatatatat) in intron II and the deletion of 21 bp (GAAAGGTGGGCTATGCATTTA) in intron III (Table 4). The maximum parsimony phylogenetic tree based on the DNA sequences of Bmy1 alleles also revealed that they are mainly divided into three clusters ( Figure 2 ).

[0053] Table 4 Nucleotide changes in the genome sequence of Bmy1 alleles (compared with the genome sequence of HarunaNijo)

[0054]

[0055] *: Published genome sequence data. Haruna Nijo (D49999), Adorra (AF061203); HA52 (AJ301645), Schooner (AF300799), Harrington (AB048949), the numbers in () represent different CAPS typing.

[0056] The open reading frames (ORFs) of the genomic DNA sequences were estimated based on the published cDNA sequences, and a 1,605 bp cDNA sequence was constructed from all the genomic DNA sequences, and a 535 amino acid polypeptide was deduced. All of these amino acid sequences were consistent with the published β-amylase cDNA sequence (Adorra ( et al. 1998), Hiproly (Kreis et al. 1987), Schooner (Ma et al. 2001), HarunaNijo (Yoshige et al. 1994), Harrington (Li et al. 2002) and HA52 ( et al. 2001) and predicted 25 amino acid substitutions, most of which were reported for the first time (Table 5).

[0057] Table 5 Amino acid substitutions in different β-amylase alleles in cultivated barley

[0058]

[0059]

[0060] Example 4. Thermal stability variation analysis and subsequent development of Bym1 β-amylase

[0061] See attached Figure 3-4 The present invention studies and analyzes the DNA sequence / amino acid sequence of the gene locus where the thermal stability of Bmy1β-amylase changes. Specifically, the material with β-amylase sequence variation is OUI429. The analysis results show that OUI429 has three point mutations (567bp, 670bp and 3523bp) and a 2bp (GG) deletion (1941-1942bp) compared with the genome sequence of barley CAS140 ( Figure 3), among which point mutation (670bp) and 2bp deletion (1941-1942bp) occurred in the second and third intron regions, point mutations (567bp and 3523bp) occurred in the second and seventh exon regions, and only the point mutation at 567bp in the second exon changed the amino acid, resulting in a single amino acid substitution D118N, which changed the relative residual thermal stability from A (about 60%) to AB (47.1%).

[0062] Specifically, the amino acid sequence of OUI429 is shown in SEQ ID NO.2; the different amino acid is at the 118th amino acid, OUI429 is N, CAS140 is D, and the other sequences are exactly the same.

[0063] In addition, correspondingly, at the gene level, referring to SEQ ID NO.1, there is a SNP difference at the 567bp position in OUI429 after sequencing, OUI429 is A, and the reported CAS140 is G.

[0064] Based on the differences in gene sequences, the genotypes of different plants can be distinguished by developing dCAPS molecular markers, and application-oriented molecular operation components and procedures can be constructed based on this. Specifically, primers (as follows) are designed according to the differences in DNA sequences corresponding to the differential nucleotides for PCR amplification, and the amplified products are digested with endonuclease BspMII and then electrophoresed (2% agarose); the following molecular marker primer combinations are specifically developed:

[0065] The primers for amplifying Bmy1 genomic DNA are as follows (BspMII enzyme; recognition sites are: 5'T↓CCGGA3'; 3'AGGCC↓T5')

[0066] F1: TCATCCATAGCCAGCATCCACAAT(SEQ ID NO.3)

[0067] R1: GTCAGGTTTACCACGCCTTG (SEQ ID NO.4)

[0068] F2: ACATTGAAGTGGGACTTGGC (SEQ ID NO.5)

[0069] R2:ATTGAGTTCTCTCGGGAGTGTC(SEQ ID NO.6)

[0070] F3:TTTGGCACTACTTTTGCCTTCCGGGA(SEQ ID NO.7)

[0071] R3: GAGAAAGGTTTCTCTGTCACACTCAC (SEQ ID NO.8)

[0072] dCAPS related primers for progeny screening:

[0073] F: GTCGGCACGCGTGATCCG (SEQ ID NO.9)

[0074] R:AAAGTAACCTGGACGGCAG(SEQ ID NO.10)

[0075] After enzyme digestion, only one band of about 110bp is the CAS140 band type (BspMII is used for enzyme digestion, and one enzyme cutting site is found in the sequence, and the size of the fragment obtained by enzyme digestion is about 15 / 110bp), corresponding to the CAS140 barley variety / strain, and the other is a band of about 125bp (the sequence does not have a BspMII enzyme cutting site), that is, the OUI429 band type, corresponding to the OUI429 barley variety / strain.

[0076] Further applications include backcrossing in beer barley breeding, assisting in the screening of offspring lines when hybridizing OUI429 and CAS140 types, and screening of molecular markers while conducting high-yield and wide-adaptability screening. After amplification, BspMII enzyme digestion and 2% agarose gel electrophoresis detection showed that the 110bp band of β-amylase had high thermal stability and was retained preferentially under the premise of having the same excellent agronomic traits.

[0077] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0078] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. An amino acid fragment with a single-site polymorphism, whose amino acid sequence is shown in SEQ ID NO.2 in the sequence table, and wherein the amino acid at position 118 has a polymorphism; the polymorphism has a biological effect of regulating the enzymatic activity of the amino acid fragment.

2. The amino acid fragment according to claim 1, characterized in that: The polymorphism includes: the amino acid at position 118 mutates / substitutes from N to D to form a new amino acid fragment; and / or the amino acid at position 118 mutates / substitutes from N to other amino acids to form a new amino acid fragment.

3. The amino acid fragment according to any one of claims 1 to 2, characterized in that: It also includes an amino acid sequence with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid fragment according to any one of claims 1 to 2.

4. A nucleotide fragment A encoding the amino acid fragment according to any one of claims 1 to 3; and / or a nucleotide fragment B equivalent to the nucleotide fragment A in molecular biology; and / or a nucleotide fragment C obtained by expression or post-expression modification in molecular biology.

5. A recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the nucleotide fragment according to claim 4.

6. A primer combination for amplifying the nucleotide fragment according to claim 4.

7. Use of the amino acid fragment according to any one of claims 1 to 3, the nucleotide fragment according to claim 4, the recombinant expression vector or expression cassette or transgenic cell line or recombinant bacteria according to claim 5, and the primer combination according to claim 6, characterized in that: The thermal stability of plant beta-amylase is regulated by adjusting the type of amino acid at position 118 on the amino acid fragment described in SEQ ID NO.

2.

8. The use according to claim 7, characterized in that: In related industries, the thermal stability of plant β-amylase is adjusted according to production needs, specifically including: increasing the thermal stability of plant β-amylase based on the amino acid type at position 118 on the amino acid fragment described in SEQ ID NO.2 and decreasing the thermal stability of plant β-amylase based on the amino acid type at position 118 on the amino acid fragment described in SEQ ID NO.2; potential application scenarios for increasing the thermal stability of plant β-amylase are: increasing the activity of amylase to thoroughly saccharify starch, thereby preparing various beverages or fillings with high sugar content, high alcohol content, refreshing taste, low turbidity and high stability; potential application scenarios for decreasing the thermal stability of plant β-amylase are: reducing the activity of amylase to inhibit the saccharification effect of starch, thereby preparing various beverages or fillings with low sugar content, low alcohol content but mellow taste.

9. A SNP site, which is related to the thermal stability of plant β-amylase, corresponds to the 567th base from the 5' end of the sequence shown in SEQ ID NO.1, and the site has two genotypes, A or G; the dCAPS primer combination used to detect the genotype of the SNP site is shown in SEQ ID NO.3-8 in the sequence table.

10. A gene detection kit for detecting the single nucleotide polymorphism of the SNP site described in claim 9, wherein the gene detection kit comprises a buffer, a polymerase, dNTPs, a template sequence; and also comprises a primer combination and a restriction endonuclease; the primer combination is the primer combination described in claim 9.

Images