Preparation method for constructing phage display cyclopeptide library by using pH-value-adjusted isothiocyanate one-pot method

Abstract

The invention relates to the technical field of cyclopeptide drug screening, in particular to a preparation method for constructing a phage display cyclopeptide library through a pH-value-adjusted isothiocyanate one-pot method, and the preparation method comprises the following steps: synthesizing cyclopeptide through chemical reaction of isothiocyanate with cysteine and N-terminal amino or epsilon amino in an unprotected peptide sequence under a weak acidic or alkaline condition; constructing a phage cyclopeptide library on the basis of the reaction property of efficient biocompatibility of the isothiocyanate molecule with cysteine and N-terminal amino or epsilon amino in an unprotected peptide sequence; a polypeptide library containing cysteine and N-terminal amino or epsilon amino is displayed on a phage, the polypeptide library is cyclized by utilizing isothiocyanate, and a cyclic peptide ligand with specific binding is elutriated aiming at target protein. In a strategy of performing polypeptide cyclization by using isothiocyanate, the polypeptide has good reaction activity with a sequence peptide containing cysteine and an N-terminal amino group or an epsilon amino group, the reaction condition is simple, and the polypeptide has good biocompatibility.

Description

Technical Field

[0001] The invention relates to the technical field of cyclic peptide drug screening, and specifically to a preparation method for constructing a phage-displayed cyclic peptide library by a pH-regulated isothiocyanate one-pot method. Background Art

[0002] Cyclic peptides have become an important form of molecular recognition tools and lead compounds because they have the excellent properties of both small molecules and biomacromolecules, especially they can target undruggable biological entities. There are several methods to support the acquisition of highly active cyclic peptides. Structure-guided cyclic peptide design has been successfully used to identify protein active interfaces, but the reliance on co-crystallized structures hinders the application of this strategy in targeting targets with model-free structures. Deep learning-based models have made great progress in the de novo design of protein binders, which reduces the necessity of protein crystal structures and helps to discover high-affinity cyclic peptides. However, the poor adaptability to protruding surfaces or polar epitopes and the low binding force of the initially designed peptides indicate that this field still faces challenges.

[0003] Therefore, phage display platforms that integrate post-translational modifications and genetic encoding of peptides are crucial as they avoid the above-mentioned drawbacks and allow the generation of up to 10 12In order to select cyclic peptides with different topological structures, several strategies have been developed to cross-link Cys residues, NCys, N-terminal amines or Lys residues. In phage panning, the spontaneous cyclization of disulfide bonds leads to the production of cyclic peptides with two cysteines as ring-forming units, which imposes higher conformational constraints on linear precursors, but the easy reduction property in plasma limits the expansion of disulfide cyclized peptides in biological selection [Wu Chuanliu, Lu Shuaimin, Wu Yapei. Method for constructing a phage-displayed multi-cyclic peptide library based on precise disulfide bond pairing: CN202010862365.0[P].2020-11-17; Wu Chuanliu, Fan Shihui, Zhuang Jie, etc. Multi-cyclic peptide ligand framework specifically targeting CD28: CN202210520286.0[P].2022-08-23.]. Symmetric cross-linkers pioneered by the Heinis and Derda groups achieve stable covalent cross-linking with two or three cysteines, allowing TBMB and its derivatives to produce active cyclic peptides with therapeutic potential in genetic systems and make progress in a variety of clinical applications, such as bicyclic toxin conjugates (BTCs) and tumor-targeted immune cell agonists (TICAs) [Kale, SS; Villequey, C.; Kong, XD; Zorzi, A.; Deyle, K. Heinis, C. Cyclization of peptides with two chemical bridges affords large scaffold diversity. Nat. Chem. 2018, 10, 715-723; Kong, XD; Moriya, J.; Carle, V.; Pojer, F.; Abriata, LA; Deyle, K. Heinis, C. De novo development of proteolyticallyresistant therapeutic peptides for oral administration. administration. Nat. Biomed. Eng. 2020, 4, 560-571.]. The limitation of this strategy is that the activity of the phage is impaired due to the loss of the intrinsic disulfide bonds of the PIII protein.Other alternative strategies involve cross-linking of amino groups, by using asymmetric cross-linkers to react with amino groups to generate various functional macrocyclic peptides with asymmetric skeletons [Wu Chuanliu, Zheng Xuejun, Liu Weidong, etc. Method for constructing a phage-displayed cyclic peptide library based on 4-hydroxy-2,6-difluoro-1,3,5-benzenetrinitrile: CN202010784645.4[P].2020-08-06; W. Liu. Genetically encoded phage-displayed cyclic peptide library and preparation method thereof: CN201980095777.1[P].2021-11-30.], and asymmetric cyclic peptides are considered to be the closest in structure to bioactive molecules in nature. However, the clinical potential of these amino-reaction-related strategies has not been fully confirmed. In addition, the introduction of functional molecules into the skeleton has also been shown to promote the functional diversity of cyclic peptide lead compounds. We have also recently developed a cyclization strategy for o-phthalaldehyde (OPA) to construct a macrocyclic peptide library with an isoindole skeleton, and screened three target proteins with important biological functions: protein tyrosine phosphatase 1B (PTP1B), NIMA-associated kinase 7 (NEK7) and human Kelch-like ECH-associated protein 1 (hKeap1), and obtained micromolar active ligands. [Hua Xiang, Liwen Bai, and Xinxiang Lei, A facile strategy for the construction of aphage display cyclic peptide library for the selection of functional macrocycles, Chem. Sci., 2024, 15, 11847-11855.; Lei Xinxiang et al. A method for preparing a phage display cyclic peptide library based on o-phthalaldehyde", application number: 202410254452.6].

[0004] Thiourea is one of the most stable thiocarbonyl compounds in nature and has attracted much attention due to its biological activity. Exploring thiourea derivatives in lead compounds is an effective way to improve biological activity, thereby developing a variety of thiourea-containing therapeutic drugs [Rahman, FU; Bibi, M.; Khan, E.; Shah, AB; Muhammad, M.; Tahir, MN; Shahzad, A.; Ullah, F.; Zahoor, M.; Alamery, S. Thiourea Derivatives, Simple in Structure but Efficient Enzyme Inhibitors and Mercury Sensors. Molecules 2021, 26, 4506-4522.; Ronchetti, R.; Moroni, G.; Carotti, A.; Gioiello, A. Camaioni, E. Recent advances inurea- and thiourea-containing compounds: focus on innovative approaches inmedicinal chemistry and organic synthesis. RSC. Med. Chem. 2021, 12, 1046-1064.]. Therefore, we hope to integrate the thiourea backbone into the cyclic peptide library and combine it with phage display technology to discover functional cyclic peptides with unique activities. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides a method for preparing a pH-regulated isothiocyanate-based phage-displayed cyclic peptide library, which has good biocompatibility and stability, simple reaction conditions, and does not require metal catalysts or organic solvents.

[0006] In order to achieve the above purpose, the technical solutions provided are as follows:

[0007] A method for preparing a phage-displayed cyclic peptide library by a one-pot method of isothiocyanate with pH value adjustment, characterized in that it comprises the following steps:

[0008] Step 1: Synthesize a cyclic peptide by using isothiocyanate to react with cysteine ​​and N-terminal amino group or ε-amino group in the unprotected peptide sequence under weakly acidic or alkaline conditions through click chemistry reaction;

[0009] Step 2: construct a phage cyclic peptide library based on the highly efficient and biocompatible reaction properties of the above isothiocyanate molecules with cysteine ​​and N-terminal amino or ε amino groups in unprotected peptide sequences;

[0010] Step 3: Display a peptide library containing cysteine ​​and N-terminal amino group or ε amino group on phage, cyclize the peptide library using isothiocyanate, and select cyclic peptide ligands with specific binding to the target protein.

[0011] Preferably, in step 1, the specific method for synthesizing the cyclic peptide is:

[0012] S1. Dissolving a polypeptide powder containing cysteine ​​and an N-terminal amino group or an ε-amino group in a solvent to obtain a polypeptide solution A, and dissolving an isothiocyanate powder in a solvent to obtain a solution B;

[0013] S2. Adding polypeptide solution A and solution B to a weakly acidic or alkaline buffer solution to react and obtain a cyclic peptide product;

[0014] S3. Analyze and characterize the product using high performance liquid chromatography and mass spectrometry.

[0015] Specifically, in S1, the sequence of the polypeptide containing cysteine ​​and ε amino group is Y m KX n CZ k The sequence of the polypeptide containing cysteine ​​and N-terminal amino acid is NH2-AX n CZ k , where K represents lysine, C represents cysteine, A represents alanine, Y, X, Z represent random amino acids, and m, n, k represent the number of random amino acids.

[0016] Specifically, in S1, the solvent may be one of water, acetonitrile or dimethyl sulfoxide.

[0017] Specifically, in S2, the isothiocyanate powder can be dissolved in dimethyl sulfoxide to obtain a solution B with a concentration of 0.5 mol / L, and then diluted with water to 50 mmol / L and 5 mmol / L for later use.

[0018] Specifically, in S2, the weakly acidic buffer solution is a phosphate with a pH of 6.5, and the alkaline buffer solution is a phosphate with a pH of 9.5.

[0019] Specifically, in S2, the ratio of the solution B to the polypeptide in the polypeptide solution A is ≥1:1; the reaction temperature is 37°C, and the reaction time is greater than 12 hours in a weakly acidic buffer solution; and the reaction time is greater than 3 hours in an alkaline buffer solution.

[0020] Preferably, in step 2, the method for constructing a phage cyclic peptide library is: selecting the polypeptide synthesized in step 1 as a template, fusion-expressing the polypeptide template on the surface of the phage, and constructing a phage cyclic peptide library;

[0021] The template is NH2-AX 12 CZ k / Y m KX n CZ k

[0022] Among them, K represents lysine, C represents cysteine, A represents alanine, Y, X, and Z represent any amino acid, and m, n, and k represent the number of random amino acids;

[0023] The polypeptide sequence fused and expressed on the surface of the phage is: NH2-AXXXXXXXXXXXXC / KXXXXXXXC

[0024] Where X represents a random amino acid, and random amino acid mutations are introduced at the specified position by the NNK method:

[0025] The corresponding DNA sequence designed according to the above polypeptide sequence is:

[0026] NH2-AX n C: CATGCTGCCATGGCTGCCNNKNNKNNKNNKNNKNNKNNKNNKNNKNNK

[0027] NNKNNKTGTGCTGGTTCAGGTGGATCCAAA;

[0028] KX n C:CATGCTGCCATGGCTGCCGGTGCTGGTGGTAAGNNKNNKNNKNNKNNKNNKNNKT

[0029] GTGCTGGTTCAGGTGGATCCAAA

[0030] The number of amino acids in the above DNA sequence can be increased or decreased as needed, and all changes in polypeptide configuration and other modification methods made in the present invention should be considered within the scope of protection of this patent;

[0031] The general formula of the cross-linking substructure used to construct the phage cyclic peptide library is:

[0032] S=C=NXR

[0033] Wherein, R is a halogen, and X includes but is not limited to an alkyl group, an alkenyl group, an aminoalkyl group, a haloalkyl group, a cyanoalkyl group, an (aryl)alkyl group, a nitro group, or an alkyl group, a heterocycloalkyl group, a carboxyalkyl group, an alkylcarboxyalkyl ester, a nitroalkyl group, and the like; if X is a benzene ring, a naphthalene ring, an aromatic heterocycle, and the like, the position and number of the substituents on the ring are not limited, and the types of substituents include but are not limited to the above-mentioned groups.

[0034] Specifically, the specific method for constructing the phage cyclic peptide library is:

[0035] S1. Construction of NH2-AX by insertion method using pSEX81 plasmid as template 12 C phagemid library, using two primers, Li-AF: CATGCTGCCATGGCTGCCNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAA and Li-AR: 5'-CATGTTTGGATCCACCTGAACCAGC-3'; the amplified fragments were recovered by PAGE gel; the pSEX81 template was digested with restriction endonucleases Nco I and Bam HI, and the digestion products were recovered by agarose gel;

[0036] S2. The KX7C phagemid library was constructed by the insertion method using the pSEX81 plasmid as a template, using two primers, Li-BF: CATGCTGCCATGGCTGCCGGTGCTGGTGGT AAGNNKNNKNNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAA and Li-BR: 5'-CATGTTTGGATCCACCTGAACCAGC-3'; the amplified fragments were recovered by PAGE gel; the pSEX81 template was digested with restriction endonucleases NcoI and BamHI, and the digestion products were recovered by agarose gel;

[0037] S3. The template digested with restriction endonucleases NcoI and BamHI was ligated with the DNA fragment recovered by PCR using T4 DNA ligase at 16°C for 24 hours. After ligation, the DNA fragments were inactivated at 65°C for 10 minutes. The buffer was replaced by the size exclusion method, and the cells were transformed into Escherichia coli TG1 chemically competent cells by electroporation to evaluate the ligation and transformation efficiency. Finally, the M13 phage library displaying the random polypeptide was obtained.

[0038] Specifically, the method of displaying a polypeptide library containing cysteine ​​and N-terminal amino group / ε amino group on a phage, cyclizing the polypeptide library using isothiocyanate, and selecting a cyclic peptide ligand with specific binding can be:

[0039] S1, titer greater than 10 10TCEP was added to a phage library containing at least one cysteine ​​and one N-terminal amino group / ε amino group displayed at the N-terminus at a final concentration of 1 mM, the phage library was reduced, and a PEG-NaCl solution was added after reduction, and the phage was placed on ice to precipitate. After precipitation, the solution B was added to a final concentration of 400 μM (the linker concentration of the KX7C peptide library was 100 μM), and a PEG-NaCl solution was added after the reaction, and the phage was placed on ice to precipitate. After precipitation, the solution was centrifuged, the supernatant was removed, and the precipitate was resuspended in a phosphate buffer solution to obtain an isothiocyanate-modified phage cyclic peptide library;

[0040] S2. The mono-phage cyclic peptide library was selected. First, 5 μL of streptavidin magnetic beads were added to the cyclic peptide library and blocked with 0.5% TBS-Tween (containing 2% BSA) at 25°C for 4 h. After blocking, the magnetic beads were removed, and the biotinylated target protein was added. The binding was allowed to proceed overnight at 4°C / 25°C. The conjugate was incubated with the blocked streptavidin magnetic beads (blocked with TBS containing 2% BSA at 37°C for 2 h) at 25°C for 30 min. After incubation, the unbound complex was removed, and 1 mM biotin was added and incubated at 25°C for 30 min. n, washed 8 times with 0.5% TBS-Tween (EP tubes were replaced at least 3 times during this period), and the specifically bound phages were recovered by acid-base elution and amplified for the next round of panning; the second round of panning used neutral magnetic beads to avoid nonspecific binding (neutral magnetic beads were used for panning without biotin incubation), and the third round of panning used streptavidin magnetic beads. After multiple rounds of in vitro panning, the phages bound to the target protein were effectively enriched; the eluate was processed to construct an NGS library for second-generation sequencing to decode the amino acid sequence bound to the target protein.

[0041] Specifically, in S1, the amount of PEG-NaCl added is 1 / 5 of the total volume; the incubation time on ice can be 2 to 6 hours; the centrifugation condition can be 8000 rpm for 20 minutes;

[0042] Specifically, in S2, the panning is performed using Cyp D, TNF-α, Keap1 and MDM2 as target proteins; the multiple rounds of in vitro panning can be performed for 3 to 5 rounds;

[0043] The blocking solution for the cyclic peptide library was 0.5% TBS-Tween (containing 2% BSA) solution, and the blocking solution for the magnetic beads was TBS (containing 2% BSA); 0.5% TBS-Tween 20 was used to wash the unbound phages during panning.

[0044] The active peptide sequences selected for the target protein Cyp D are as follows:

[0045] NH2-AHVTPGFMRLQGSC-CONH2(peptide 1)

[0046] The active peptide sequences selected for the target protein TNF-α are as follows:

[0047] NH2-ALSLHVAQSRFRDC-CONH2(peptide 2)

[0048] NH2-ADQGGSSSLSVQDC-CONH2(peptide 3)

[0049] The active peptide sequences selected for the target protein Keap1 are as follows:

[0050] Ac-KSLRSLQSC-CONH2(peptide 4)

[0051] Ac-KSSQRPESC-CONH2(peptide 5)

[0052] The active peptide sequences selected for the target protein MDM2 are as follows:

[0053] Ac-KGSVRYPYC-CONH2(peptide 6)

[0054] The peptides were synthesized by solid phase synthesis and then subjected to cyclization reaction. The affinity of the cyclic peptide ligand and the target protein was verified by biolayer interference experiment to test the feasibility and effectiveness of the cyclization method and the selection method.

[0055] The present invention provides a method for constructing a phage display cyclic peptide library based on isothiocyanate molecules and using the phage cyclic peptide library to select cyclic peptide ligands that specifically bind to a target. The present invention first uses isothiocyanate to undergo a click chemical reaction with a polypeptide containing cysteine ​​and an N-terminal amino group / ε amino group under weakly acidic or alkaline conditions to synthesize a monocyclic peptide.

[0056] In the present invention, in order to obtain a new cyclic peptide skeleton with a thiourea structure, the present invention proposes a "one-pot" strategy compatible with the biological environment, and successfully combines it with a phage display platform to generate a new thiourea skeleton. In this strategy, isothiocyanate and its derivatives can be coupled with cysteine ​​and N-terminal amino or ε amino in a weakly acidic or alkaline buffer, and thiourea cyclic peptides containing two different conformational constraints can be formed in one step, and the cyclic peptides can be inserted into the pIII protein. The cyclization strategy of the present invention has been proven to be biocompatible, and two types of phage cyclic peptide libraries are produced without destroying the activity of the phage, providing an effective way to construct a phage library containing a thiourea structure to explore new cyclic peptide ligands. And by panning for different biological targets to obtain active cyclic peptide ligands, it is further fully proved that the strategy has high biocompatibility.

[0057] The beneficial effects of the present invention are:

[0058] 1. In the strategy of peptide cyclization by isothiocyanate adjusted at different pH values ​​of the present invention, it is found that it has good reactivity with sequence peptides containing cysteine ​​and N-terminal amino group or ε amino group, the reaction conditions are simple, and it has good biocompatibility. The reaction system does not need to add organic solvents or metal catalysts, and is suitable for biological systems. The monocyclic peptide method is obtained by investigating the yield and reaction rate of the cyclic peptide reaction.

[0059] 2. The present invention constructs a phage cyclic peptide library by a one-pot method with isothiocyanates adjusted at different pH values, and performs panning against the target to obtain a monocyclic peptide ligand with high affinity. The development of this chemically selective biocoupling and peptide cyclization based on isothiocyanates under different pH conditions provides a reliable method for studying the chemical space occupied by thiourea. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 It is a reaction diagram of isothiocyanate and a sequence peptide containing cysteine ​​and N-terminal amino group / ε amino group in the present invention.

[0061] Figure 2 This is a chromatographic characterization diagram of the isothiocyanate modification efficiency of Pep 1 in the present invention under different ratio buffer conditions.

[0062] Figure 3 This is a chromatographic characterization diagram of the isothiocyanate modification efficiency of Pep 2 in the present invention under different ratio buffers and different pH conditions.

[0063] Figure 4 This is a mass spectrometry characterization result diagram of the successful modification of isothiocyanate on the model peptide in the present invention.

[0064] Figure 5 The figure is a comparison of the recovery rates of the N(12) and K(7) phage libraries in the pull-down assay after isothiocyanate modification in the present invention.

[0065] Figure 6 The figure is a characterization diagram of the phage activity of the N(12) and K(7) phage libraries in the present invention under different conditions.

[0066] Figure 7 The figure is a flow chart of phage display panning in the present invention.

[0067] Figure 8 Schematic diagram of NGS analysis of enriched sequences after three rounds of panning of the circular K(7) library for Keap1 in the present invention.

[0068] Fig. 9 The figure shows the active polypeptide sequences and affinity results of the N(12) phage library enriched against Cyp D and TNF-α in the present invention.

[0069] Fig.10 The figure shows the active polypeptide sequences and affinity results of the K(7) phage library enriched against Keap1 and MDM2 in the present invention.

[0070] Fig.11 This is a characterization diagram of the affinity of the cyclic peptide and the corresponding linear precursor bound to Cyp D determined by biolayer interferometry in the present invention.

[0071] Fig.12 This is a characterization diagram of the affinity of the cyclic peptide and the corresponding linear precursor binding to TNF-α determined by the biolayer interferometry method in the present invention.

[0072] Fig.13 The chemical structure of the thiourea-containing cyclic peptide CK1 in the present invention and the three-dimensional diagram of the interaction between CK1 and Keap1 simulated by molecular docking.

[0073] Fig.14 This is a characterization diagram of the binding affinity between CK1 and Keap1 measured by the bio-layer interferometry method in the present invention.

[0074] Fig.15 The biolayer interferometry method used in the present invention is used to determine the expression of CK1 and mutant Keap1 (Ala) Binding affinity characterization diagram.

[0075] Fig.16 This is a characterization diagram of the binding affinity between CM1 and MDM2 measured by the bio-layer interferometry method in the present invention.

[0076] Fig.17 The biolayer interferometry method used in the present invention is used to determine the expression of CM1 and mutant MDM2 (Ala) Binding affinity characterization diagram. DETAILED DESCRIPTION

[0077] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0078] A preparation method for constructing a phage display cyclic peptide library based on an isothiocyanate one-pot method with pH value adjustment comprises the following steps:

[0079] 1) Construction of phage display cyclic peptide library:

[0080] Template: NH2-AX n CZ k / Y m KXn CZ k

[0081] Among them, K represents lysine, C represents cysteine, A represents alanine, Y, X, and Z represent any amino acid, and m, n, and k represent the number of random amino acids;

[0082] The polypeptide sequence fused and expressed on the surface of the phage is: NH2-AXXXXXXXXXXXXC / KXXXXXXXC

[0083] Where X represents a random amino acid, and random amino acid mutations are introduced at the specified position by the NNK method:

[0084] The corresponding DNA sequence designed according to the above polypeptide sequence is:

[0085] NH2-AX n C: CATGCTGCCATGGCTGCCNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAA;

[0086] KX n C: CATGCTGCCATGGCT GCCGGTGCTGGTGGTAAGNNKNNKNNKNNKNNKNNKNNKTG

[0087] TGCTGGTTCAGGTGGATCCAAAA;

[0088] The NH2-AX was constructed by insertion method using pSEX81 plasmid as template 12 C phagemid library, using two primers, Li-AF: CATGCTGCCATGGGCTGCCNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAA and Li-AR: 5'-CATGTTTGGATCCACCTGAACCAGC-3'; the amplified fragments were recovered by PAGE gel; the pSEX81 template was digested with restriction endonucleases Nco I and Bam HI, and the digestion products were recovered by agarose gel;

[0089] The KX7C phagemid library was constructed by the insertion method using pSEX81 plasmid as a template, using two primers, Li-BF: CATGCTGCCATGGCTGCCGGTGCTGGTGGTAAAGNNKNNKNNKNNKNNKNNKNNTGTGCTGGTTCAGGTGGATCCAAA and Li-BR: 5'-CATGTTTGGATCCACCTGAACCAGC-3'; the amplified fragments were recovered by PAGE gel; the pSEX81 template was digested with restriction endonucleases NcoI and BamHI, and the digestion products were recovered by agarose gel;

[0090] The template digested with restriction endonucleases NcoI and BamHI was connected to the DNA fragment recovered by PCR at 16°C for 24 hours using T4 DNA ligase. After connection, it was inactivated at 65°C for 10 minutes. The buffer was replaced by molecular exclusion method and transformed into Escherichia coli TG1 chemical competent cells by electroporation to evaluate the connection and transformation efficiency. The transformant was incubated at 37°C and 220rpm for one hour with 1mL LB medium. 10μL of sample was diluted to determine the titer, and 20 single clones were selected for DNA sequencing to check the randomness of the amino acid distribution of the library;

[0091] 2) Preparation of phage cyclic peptide library:

[0092] The above transformation sample was inoculated into 500 mL of LB medium containing 50 μg / mL carbenicillin, of which 400 mL was cultured at 37°C and 220 rpm until the OD 600 Mix with 50% glycerol to 0.8-1.0 and place in -80℃ refrigerator for later use; the remaining 100mL is cultured until OD 600 After the pH is 0.4-0.6, helper phage is added for infection for 2 hours. After adding 0.5mM IPTG and culturing at 37°C for 12-14 hours, centrifuge at 4°C and 8000rpm for 20 minutes to remove the bacterial precipitate and collect the supernatant. Add 1 / 5 volume of PEG-NaCl to precipitate the supernatant containing phage (it can be placed on ice for precipitation for 4-6 hours or at 4°C overnight), centrifuge at 4°C and 8000rpm for 20 minutes to collect the precipitate, add 2mL PBS buffer to resuspend, add 400μM (the linker concentration of KX7C peptide library is 100μM) isothiocyanate to react at 37°C for sufficient time, add 1 / 5 volume of PEG-NaCl to precipitate the phage library, centrifuge at 4°C and 10000rpm for 1 minute to collect the precipitate, and finally resuspend the precipitate with PBS buffer to obtain the phage cyclic peptide library.

[0093] 3) Determination of the titer of phage cyclic peptide library:

[0094] Take 10 μL of the test solution and add 990 μL of 2×YT liquid medium to dilute it. Take 10 μL of the dilution solution and add 990 μL of 2×YT liquid medium to dilute it. Then dilute it step by step to 10 -8 -10 -10 , take 10 μL of the dilution and add it to 150 μL of TG1 in the logarithmic growth phase. After standing at 37°C for 30 minutes, the culture is evenly spread on the surface of a solid plate containing 50 μg / mL carbenicillin, inverted in a 37°C constant temperature incubator and cultured for 10-12 hours. Take out and count to calculate its titer.

[0095] 4) Selection:

[0096] First, add 5 μL of streptavidin magnetic beads to the cyclic peptide library and block with 0.5% TBS-Tween (containing 2% BSA) at 25°C for 4 hours. After blocking, remove the magnetic beads, add biotinylated target protein, bind overnight at 4°C / 25°C, incubate the conjugate with blocked streptavidin magnetic beads (blocked with TBS containing 2% BSA at 37°C for 2 hours) at 25°C for 30 minutes, remove unbound complexes after incubation, add 1 mM biotin, incubate at 25°C for 30 minutes, and wash 8 times with 0.5% TBS-Tween (change the EP tube at least 3 times during this period).

[0097] 5) Elution:

[0098] After adding 200 μL of Gly-HCl (containing 1% BSA) with pH = 2.2 and eluting at 25°C and 60 rpm for 10 min, 30 μL of Tris-HCl with pH = 9.1 was added for neutralization, and the eluate was collected. 10 μL of the eluate was taken and diluted according to the above step 3) and then infected with TG1 in the logarithmic growth phase and the titer was determined;

[0099] After repeating the above steps (alternating between streptavidin magnetic beads and neutral magnetic beads) for three rounds of panning of the target protein, the last round of eluate was processed to construct an NGS library for next-generation sequencing, and random peptide sequences bound to the target protein were decoded and analyzed.

[0100] The peptide sequences with high enrichment obtained by sequencing are subjected to solid phase synthesis. The specific synthesis steps are as follows:

[0101] (1) Swelling resin

[0102] Weigh 0.5 g of RinkAmide Resin with a degree of substitution of 0.93, pour it into a reaction bottle, and add 30 mL of DMF to swell for 1 hour.

[0103] (2) Deprotection

[0104] The DMF in the reaction bottle was drained, and a 20% piperidine / DMF solution was added to remove Fmoc. The reaction was continued for 15 min. The reaction was repeated once, and the reaction was drained. The reaction was washed with DMF for 5 times and the reaction was drained.

[0105] (3) Condensation reaction

[0106] The condensation was carried out using a combination of HOBT / HBTU / DIEA activators. Three equivalents of HOBT / HBTU and Fmoc-amino acid were added, dissolved in DMF and added to the reaction bottle. DIEA was added, nitrogen was agitated, the reaction was carried out for 2 h, and the mixture was dried.

[0107] (4) Detection and washing

[0108] Take a little resin from the reaction bottle, put it into a small test tube, wash it once with DMF, add ninhydrin solution and heat it at 100℃ for 3min, take it out and observe the color of the resin. If the resin does not turn purple or blue, it indicates that the condensation reaction is complete. Stop the reaction, drain, and wash it 3 times with DMF. If the color of the resin is blue, purple or other colors, it means that the reaction is not complete. Drain and wash it 3 times, weigh the same amount of the current reaction and put it into the reaction column to react again until the detection reaction is complete.

[0109] (5) Repeated condensation

[0110] Repeat steps 2-5 for the subsequent amino acid connections, and use the same algorithm to weigh different amino acids, while keeping the amounts of HOBT / HBTU / DIEA constant.

[0111] (6) Contraction

[0112] After the last amino acid is connected, repeat step 2), then wash with DCM 3 times, methanol 3 times, drain, and place the resin in a fume hood to dry.

[0113] (7) Acetylation (KX n This step is required for C-peptide)

[0114] Add 20 mL of a mixed solution of pyridine: anhydrous dichloroethylene: acetic anhydride = 1:2:1, react at room temperature for 1 h, and drain.

[0115] (8) Inspection

[0116] Take a small amount of resin from the reaction bottle, put it into a small test tube, add ninhydrin solution and heat at 100℃ for 3min, take out and observe the color of the resin. If the resin does not turn purple or blue, it indicates that the acetylation reaction is complete. Stop the reaction, wash with DMF 3 times, DCM 3 times, and methanol 3 times, and dry. If the color of the resin is detected to be blue or purple or other colors, it indicates that the reaction is not complete. Continue to add acetylation reagent to react until the reaction is complete.

[0117] (9) Cut off

[0118] Add 20 mL of cutting agent (TFA / Tris / H2O=19 / 0.5 / 0.5) to the reaction bottle, stir and react for 2 h, collect the filtrate, remove the liquid inside by rotary evaporation, add ether for precipitation, at this time the polypeptide is precipitated to form a polypeptide ether suspension, transfer the above liquid to a 50 mL centrifuge tube, centrifuge at 7000 rpm for 5 min, pour off the supernatant, add ether for washing, repeat 2 times, vacuum dry, remove the ether residue, and the obtained solid is the crude target polypeptide.

[0119] (10) Purification

[0120] The crude product is dissolved in water or methanol, filtered, and separated and purified by high performance liquid chromatography to finally obtain a pure target polypeptide with a purity of more than 95%.

[0121] According to the enriched peptide sequences obtained from the sequencing results ( Fig. 9 , 10 ), we synthesized the following peptides:

[0122] Synthetic peptides include but are not limited to:

[0123] NH2-AHVTPGFMRLQGSC-CONH2(peptide 1)

[0124] NH2-ALSLHVAQSRFRDC-CONH2(peptide 2)

[0125] NH2-ADQGGSSSLSVQDC-CONH2(peptide 3)

[0126] Ac-KSLRSLQSC-CONH2(peptide 4)

[0127] Ac-KSSQRPESC-CONH2(peptide 5)

[0128] Ac-KGSVRYPYC-CONH2(peptide 6)

[0129] The synthesized peptides were analyzed and characterized by HPLC.

[0130] Taking the cyclization of peptide 1 as an example, the specific cyclization method is:

[0131] The polypeptide was dissolved in PBS at pH=6.5 to prepare a 1 mM solution, and isothiocyanate was added to make the final concentration 400 μM, and the reaction was carried out at 37° C. for 12 h. The cyclization product was detected by mass spectrometry, and the expected product was obtained.

[0132] The affinity of linear peptides, cyclic peptides and Cyp D was determined by biolayer interferometry. First, the linear peptide and cyclic peptide of pepetide 1 were purified by chromatography and then quantified. They were diluted to 125nM, 250nM, 500nM, 1000nM and 2000nM with 0.05% PBS-Tween 20. The target protein Cyp D was diluted to 20μg / mL with 0.05% PBS-Tween20. At the same time, no target protein and no peptide ligand were set as background. After deducting the background, the affinity of the target protein and the peptide ligand under different concentration gradient conditions was globally fitted (three parallel experiments). The affinity of the cyclic peptide ligand to Cyp D was calculated to be 0.73±0.08μM, and the affinity of the linear ligand to Cyp D was 27.74±2.65μM ( Fig.11 ).

[0133] The affinity of linear peptides and cyclic peptides to TNF-α was determined by biolayer interferometry. First, the linear peptide and cyclic peptide of pepetide 2 were purified by chromatography and quantified, and diluted to 62.5nM, 125nM, 250nM, 500nM, and 1000nM with 0.05% PBS-Tween 20. The target protein TNF-α was diluted to 20μg / mL with 0.05% PBS-Tween 20. At the same time, no target protein and no peptide ligand were set as backgrounds. After deducting the background, the affinity of the target protein and the peptide ligand under different concentration gradient conditions was globally fitted (three parallel experiments). The affinity of the cyclic peptide ligand to TNF-α was calculated to be 0.91±0.12μM, and the affinity of the linear ligand to TNF-α was 18.43±2.28μM. We also analyzed the binding affinity of peptide 3's linear and cyclic peptides to TNF-α. The binding affinity of the cyclic peptide to TNF-α was 6.17±1.31μM, while no signal was observed for the linear molecule T2 in BLI ( Fig.12 ).

[0134] The affinity of linear peptides and cyclic peptides to hKeap1 was determined by biolayer interferometry. First, the linear peptide and cyclic peptide of pepetide 4 were purified by chromatography and quantified, and diluted to 25nM, 50nM, 100nM, 200nM, and 400nM with 0.05% PBS-Tween 20. The target protein hKeap1 was diluted to 20μg / mL with 0.05% PBS-Tween 20. At the same time, no target protein and no peptide ligand were set as background. After deducting the background, the affinity of the target protein and the peptide ligand under different concentration gradient conditions was globally fitted (three parallel experiments). The affinity of the cyclic peptide ligand to hKeap1 was calculated to be 41.58±3.71nM ( Fig.14). In order to ensure the accuracy of the analytical method, another measurement tool SPR was used and the experiment showed the same level of results. Although it does not conform to the traditional active sequence, CK1 also shows a strong affinity. The reason for this phenomenon may be that the generation of this skeleton leads to a drastic change in conformational constraints. Therefore, molecular docking simulation is used to analyze the interaction mode between the two. The data show that CK1 interacts with a large number of residues in the Kelch domain, including Tyr 334, Ser 363, Arg 380, Arg 415, Arg 483, Ser 508 ( Fig.13 ), these residues are also present in the Keap1-Nrf2 complex. Theoretical support consistent with the interaction model suggests that the lack of authenticity of the traditional motif does not reduce the potential of CT1 as an effective binder. Finally, mutagenesis experiments were used to provide more precise proof of specific binding. Based on the information provided by the molecular docking simulation results, several key residues of the Kelch domain that may provide interaction forces (Ser 363, Arg 380, Asn 382, ​​Arg 415, Arg 483) were mutated to conserved Ala. After the key residues were replaced, the target protein Keap1 (Ala) The affinity for CK1 was significantly reduced, with a Kd value of only 17.92±1.41μM ( Fig.15 ), which proves that CK1 indeed acts on a few amino acid residues in the Keap1 Kelch domain.

[0135] The affinity of linear peptides and cyclic peptides to MDM2 was determined by biolayer interferometry. First, the linear peptide and cyclic peptide of pepetide 6 were purified by chromatography and quantified, and diluted to 0.5μM, 1.0μM, 2.0μM, 4.0μM, and 8.0μM with 0.05% PBS-Tween 20. The target protein MDM2 was diluted to 20μg / mL with 0.05% PBS-Tween 20. At the same time, no target protein and no peptide ligand were set as the background. After deducting the background, the affinity of the target protein and the peptide ligand under different concentration gradient conditions was globally fitted (three parallel experiments). The affinity of the cyclic peptide ligand to MDM2 was calculated to be 5.22±1.70μM ( Fig.16 Compared with the reported crystal structure, the MD study preliminarily clarified the specificity of CM1 targeting the MDM2 p53 binding domain. The amino acids in this binding region involve Thr 15, Phe 55, Gln 59, Try 67, and Val 93. Mutagenesis experiments and NMR titration further verified that CM1 binds to MDM2 (ala) The Kd value of binding was reduced by 13-fold ( Fig.17). These characterization results were in line with expectations, proving that our cyclization strategy to generate new backbones in peptides is reasonable and feasible, laying a solid foundation for clinical research on MDM2.

[0136] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

Claims

1. A method for preparing a phage-displayed cyclic peptide library by a one-pot method of isothiocyanate with pH adjustment, characterized in that: The steps include: Step 1: Synthesize a cyclic peptide by using isothiocyanate to react with cysteine ​​and N-terminal amino group or ε-amino group in the unprotected peptide sequence under weakly acidic or alkaline conditions through click chemistry reaction; Step 2: construct a phage cyclic peptide library based on the highly efficient and biocompatible reaction properties of the above isothiocyanate molecules with cysteine ​​and N-terminal amino or ε amino groups in unprotected peptide sequences; Step 3: Display a peptide library containing cysteine ​​and N-terminal amino group or ε amino group on phage, cyclize the peptide library using isothiocyanate, and select cyclic peptide ligands with specific binding to the target protein.

2. The method for preparing a phage-displayed cyclic peptide library by a one-pot method of isothiocyanate with pH adjustment according to claim 1, characterized in that: In step 1, the specific method for synthesizing the cyclic peptide is: S1. Dissolving a polypeptide powder containing cysteine ​​and an N-terminal amino group or an ε-amino group in a solvent to obtain a polypeptide solution A, and dissolving an isothiocyanate powder in a solvent to obtain a solution B; S2. Adding polypeptide solution A and solution B to a weakly acidic or alkaline buffer solution to react and obtain a cyclic peptide product; S3. Analyze and characterize the product using high performance liquid chromatography and mass spectrometry.

3. The method for preparing a phage-displayed cyclic peptide library by a one-pot method of isothiocyanate with pH adjustment according to claim 2, characterized in that: In S1, the sequence of the polypeptide containing cysteine ​​and ε amino group is Y m KX n CZ k The sequence of the polypeptide containing cysteine ​​and N-terminal amino acid is NH2-AX n CZ k , wherein K represents lysine, C represents cysteine, A represents alanine, Y, X, and Z represent random amino acids, and m, n, and k represent the number of random amino acids; the solvent can be one of water, acetonitrile, or dimethyl sulfoxide; the isothiocyanate powder can be dissolved in dimethyl sulfoxide to obtain a solution B with a concentration of 0.5 mol / L, which is diluted with water to 50 mmol / L and 5 mmol / L for later use.

4. The method for preparing a phage-displayed cyclic peptide library by a one-pot method of isothiocyanate with pH adjustment according to claim 2, characterized in that: In S2, the weakly acidic buffer solution is a phosphate with a pH of 6.5, and the alkaline buffer solution is a phosphate with a pH of 9.5; the ratio of the solution B to the polypeptide in the polypeptide solution A is ≥1:1; the reaction temperature is 37°C, and in the weakly acidic buffer solution, the reaction time is greater than 12 hours; in the alkaline buffer solution, the reaction time is greater than 3 hours.

5. The method for preparing a phage-displayed cyclic peptide library by a one-pot method of isothiocyanate with pH adjustment according to claim 3, characterized in that: In step 2, the method for constructing a phage cyclic peptide library is as follows: the polypeptide synthesized in step 1 is selected as a template, the polypeptide template is fused and expressed on the surface of the phage to construct a phage cyclic peptide library; The template is: NH2-AX 12 CZ k / Y m KX n CZ k Among them, K represents lysine, C represents cysteine, A represents alanine, Y, X, and Z represent any amino acid, and m, n, and k represent the number of random amino acids; The polypeptide sequence fused and expressed on the surface of the phage is: NH2-AXXXXXXXXXXXXC / KXXXXXXXC Where X represents a random amino acid, and random amino acid mutations are introduced at the specified position by the NNK method: The corresponding DNA sequence designed according to the above polypeptide sequence is: NH2-AX n C:CATGCTGCCATGGCTGCCNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAA; KX n C:CATGCTGCCATGGCTGCCGGTGCTGGTGGTAAGNNKNNKNNKNNKNNKNNKNNK TGTGCTGGTTCAGGTGGATCCAAA The number of amino acids in the above DNA sequence can be increased or decreased as needed; The general formula of the cross-linking substructure used to construct the phage cyclic peptide library is: S=C=NXR Wherein, R is a halogen, and X includes but is not limited to an alkyl group, an alkenyl group, an aminoalkyl group, a haloalkyl group, a cyanoalkyl group, an (aryl)alkyl group, a nitro group, or an alkyl group, a heterocycloalkyl group, a carboxyalkyl group, an alkylcarboxyalkyl ester, a nitroalkyl group, and the like; if X is a benzene ring, a naphthalene ring, an aromatic heterocycle, and the like, the position and number of the substituents on the ring are not limited, and the types of substituents include but are not limited to the above-mentioned groups.

6. The method for preparing a phage-displayed cyclic peptide library by a one-pot method of isothiocyanate with pH adjustment according to claim 5, characterized in that: The specific method for constructing the phage display cyclic peptide library is: S1. Construction of NH2-AX by insertion method using pSEX81 plasmid as template 12 C phagemid library, using two primers, Li-AF: CATGCTGCCATGGCTGCCNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAA and Li-AR: 5'-CATGTTTGGATCCACCTGAACCAGC-3'; the amplified fragments were recovered by PAGE gel; the pSEX81 template was digested with restriction endonucleases Nco I and Bam HI, and the digestion products were recovered by agarose gel; S2. The KX7C phagemid library was constructed by the insertion method using the pSEX81 plasmid as a template, using two primers, Li-BF: CATGCTGCCATGGCTGCCGGTGCTGGTGGT AAGNNKNNKNNKNNKNNKNNKTGTGCTGGTTCAGGTGGATCCAAA and Li-BR: 5'-CATGTTTGGATCCACCTGAACCAGC-3'; the amplified fragments were recovered by PAGE gel; the pSEX81 template was digested with restriction endonucleases NcoI and BamHI, and the digestion products were recovered by agarose gel; S3. The template digested with restriction endonucleases NcoI and BamHI was ligated with the DNA fragment recovered by PCR using T4 DNA ligase at 16°C for 24 hours. After ligation, the DNA fragments were inactivated at 65°C for 10 minutes. The buffer was replaced by the size exclusion method, and the cells were transformed into Escherichia coli TG1 chemically competent cells by electroporation to evaluate the ligation and transformation efficiency. Finally, the M13 phage library displaying the random polypeptide was obtained.

7. The method for preparing a phage-displayed cyclic peptide library by a one-pot method of isothiocyanate with pH adjustment according to claim 1, characterized in that: In step three, the specific method of displaying a polypeptide library containing cysteine ​​and an N-terminal amino group or an ε amino group on a phage, cyclizing the polypeptide library using isothiocyanate, and selecting a cyclic peptide ligand with specific binding can be: S1, titer greater than 10 10 pfu / mL, TCEP was added to a phage library containing at least one cysteine ​​and one N-terminal amino group or ε amino group displayed at the N-terminus to make a final concentration of 1 mM, the phage library was reduced, PEG-NaCl solution was added after reduction, the phage was placed on ice to precipitate, and the phage was centrifuged after precipitation, and solution B was added to make a final concentration of 400 μM, the linker concentration of the KX7C peptide library was 100 μM, PEG-NaCl solution was added after the reaction, the phage was placed on ice to precipitate, and the phage was centrifuged after precipitation, the supernatant was removed, and the precipitate was resuspended in a phosphate buffer solution to obtain a phage cyclic peptide library containing a thiourea structure; S2. The mono-phage cyclic peptide library was selected. First, 5 μL of streptavidin magnetic beads were added to the cyclic peptide library and blocked with 0.5% TBS-Tween containing 2% BSA at 25°C for 4 h. After blocking, the magnetic beads were removed and the biotinylated target protein was added. The binding was allowed to proceed overnight at 4°C / 25°C. The conjugate was incubated with the blocked streptavidin magnetic beads (blocked with TBS containing 2% BSA at 37°C for 2 h) at 25°C for 30 min. After incubation, the unbound complex was removed and 1 mM biotin was added and incubated at 25°C for 30 min. min, washed 8 times with 0.5% TBS-Tween, during which the EP tube was replaced at least 3 times, and the specifically bound phages were recovered by acid-base elution and amplified for the next round of panning; the second round of panning used neutral magnetic beads to avoid nonspecific binding, and neutral magnetic beads were used for panning without biotin incubation. The third round of panning used streptavidin magnetic beads. After multiple rounds of in vitro panning, the phages bound to the target protein were effectively enriched; the eluate was processed to construct an NGS library for second-generation sequencing to decode the amino acid sequence bound to the target protein.

8. The method for preparing a phage-displayed cyclic peptide library by a one-pot method of isothiocyanate with pH adjustment according to claim 7, characterized in that: In S1, the amount of PEG-NaCl added is 1 / 5 of the total volume; the incubation time on ice can be 2 to 6 hours; and the centrifugation condition can be centrifugation at 8000 rpm for 20 minutes.

9. The method for preparing a phage-displayed cyclic peptide library by a one-pot method of isothiocyanate with pH adjustment according to claim 7, characterized in that: In S2, the panning is performed using Cyp D, TNF-α, Keap1 and MDM2 as target proteins; and the multiple rounds of in vitro panning can be performed for 3 to 5 rounds.

10. The method for preparing a phage display cyclic peptide library based on isothiocyanate according to claim 9, characterized in that: The active peptide sequences selected for the target protein Cyp D are as follows: NH2-AHVTPGFMRLQGSC-CONH2(peptide 1) The active peptide sequences selected for the target protein TNF-α are as follows: NH2-ALSLHVAQSRFRDC-CONH2(peptide 2) NH2-ADQGGSSSLSVQDC-CONH2(peptide 3) The active peptide sequences selected for the target protein Keap1 are as follows: Ac-KSLRSLQSC-CONH2(peptide 4) Ac-KSSQRPESC-CONH2(peptide 5) The active peptide sequences selected for the target protein MDM2 are as follows: Ac-KGSVRYPYC-CONH2(peptide 6) The peptides were synthesized by solid phase synthesis and then subjected to cyclization reaction. The affinity of the cyclic peptide ligand and the target protein was verified by biolayer interference experiment to test the feasibility and effectiveness of the cyclization method and the selection method.

Images