Biomarker for early diagnosis of femoral head necrosis and application thereof

Abstract

The invention discloses a biomarker for early diagnosis of femoral head necrosis and application thereof, and relates to the technical field of biology. The biological marker is a serum mechanical gating cation channel Piezo1. The research finds that after early vascular endothelial cells of femoral head necrosis are damaged, the Piezo1 expression is reduced, so that the Piezo1 in blood is obviously reduced, that is, the serum mechanical gating cation channel Piezo1 can assist MRI to serve as a new index of femoral head necrosis; the monitoring of the level of the serum mechanical gating cation channel Piezo1 provides a new marker for the screening of early femoral head necrosis.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a biomarker for early diagnosis of femoral head necrosis and application thereof. Background Art

[0002] Femoral head necrosis is also known as avascular necrosis of the femoral head. Its pathological manifestations include: impaired blood supply to the femoral head, impaired circulation in the bone, and imbalanced bone cell metabolism. It seriously affects the function of the hip joint and eventually leads to femoral head collapse and hip joint degeneration, causing hip disability. It is one of the common and intractable orthopedic diseases in clinical practice. Femoral head necrosis not only brings a heavy burden to the patient and his family, but has also become a public health event that affects society.

[0003] Clinically, osteonecrosis of the femoral head can be roughly divided into traumatic osteonecrosis of the femoral head and non-traumatic osteonecrosis of the femoral head according to its different pathogenic factors. The results of a domestic multicenter epidemiological study in 2015 showed that among all patients with osteonecrosis of the femoral head, 16.4% were traumatic, 24.1% were hormone-induced, 30.7% were alcohol-induced, and 28.8% were idiopathic. Due to the diversity of pathogenic factors of osteonecrosis of the femoral head, fully understanding the pathogenesis of osteonecrosis of the femoral head and rationally preventing and treating the disease are one of the important contents of medical treatment, basic research and translation in my country. At present, there are many explanations for the pathogenesis of osteonecrosis of the femoral head, such as fat metabolism disorder, intraosseous hypertension, cell apoptosis theory, blood coagulation and secondary collision, but the above concepts still need to be verified. Therefore, exploring the pathogenesis of osteonecrosis of the femoral head can provide a solid theoretical basis for the clinical prevention and treatment of the disease, which is crucial for patients and even the entire society. In the early stage, osteonecrosis of the femoral head can be diagnosed through symptoms and signs and auxiliary examination results, including X-ray, CT scan, radionuclide scan, nuclear magnetic resonance scan, etc. Currently, early diagnosis of femoral head necrosis mainly relies on imaging methods, and no specific serum markers have been found for clinical use.

[0004] The Piezo1 mechanosensitive ion channel protein was first identified by Caste et al. in 2010 in the mouse neuroblastoma cell line Neuro2A, and the trimeric propeller structure of the protein was analyzed by GE et al. using electron cryomicroscopy. The highly curved structural characteristics of the protein are conducive to binding to the cell membrane, which amplifies the sensitivity of Piezo1 to changes in membrane tension. Piezo1 senses the mechanical stimulation of the extracellular environment and converts it into bioelectric signals, thereby activating cell signal transduction pathways and affecting cell proliferation, differentiation, migration and apoptosis. Studies have shown that Piezo1 is expressed to varying degrees in related cells of the skeletal system and cardiovascular system, such as osteoblasts, osteoclasts, chondrocytes, endothelial cells and vascular smooth muscle cells, and plays an important role in bone development, joint degeneration and bone homeostasis. Recent studies have found that Piezo1 is also of great significance in inflammatory responses involving mechanical stimulation, and can induce the destruction and absorption of bones by a variety of inflammatory cytokines.

[0005] Although MRI, CT and other imaging methods are currently used clinically to detect early femoral head necrosis, MRI is considered to be the most specific indicator. However, since MRI cannot detect blood perfusion damage, the diagnosis of femoral head necrosis cannot be ruled out for those with high-risk factors and negative MRI. It is difficult to reverse the middle and late clinical stages, while early femoral head necrosis is easier to treat and reverse. Therefore, early detection of femoral head necrosis has become the key to reversing femoral head necrosis. At present, there is still a lack of a highly specific biomarker for early diagnosis of femoral head necrosis. Summary of the invention

[0006] The purpose of the present invention is to provide a biomarker for early diagnosis of femoral head necrosis and its application to solve the problems existing in the above-mentioned prior art. The present invention provides a serum mechanically gated cation channel Piezo1 that can assist MRI as a new indicator of femoral head necrosis, which provides a new marker for early screening of femoral head necrosis.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a biomarker for early diagnosis of femoral head necrosis, wherein the biomarker is a mechanically gated cation channel Piezo1.

[0009] The present invention also provides the use of a reagent for detecting the content of serum mechanically gated cation channel Piezo1 in preparing an early diagnosis product for femoral head necrosis.

[0010] Furthermore, the early diagnosis product includes a kit or a reagent.

[0011] The present invention also provides an early diagnosis product for femoral head necrosis, comprising a reagent for detecting the content of the mechanically gated cation channel Piezo1 in serum.

[0012] Furthermore, the early diagnosis product includes a kit or a reagent.

[0013] The present invention discloses the following technical effects:

[0014] The present invention has found that after the early stage of femoral head necrosis, the expression of endothelial cell Piezo1 will decrease after the damage of vascular endothelial cells, so the mechanical gated cation channel Piezo1 in the blood will decrease significantly. Therefore, serum Piezo1 can assist MRI as a new indicator of femoral head necrosis, and monitoring serum Piezo1 levels provides a new marker for the screening of early femoral head necrosis. According to previous studies, the present invention speculates that the decrease of piezo1 in vascular endothelial cells in the femoral head of mice may cause the formation disorder of new blood vessels, and this generation mechanism is caused by the damage of piezo1 / vegf signaling pathway. Monitoring serum piezo1 levels provides a new marker for the screening of early femoral head necrosis. Repairing the piezo1 / vegf signaling pathway provides a new target for the clinical treatment of piezo1 / vegf. This discovery provides a new treatment idea for early warning and improving prognosis of clinical diagnosis of early femoral head necrosis.

[0015] In summary, in the early stage of femoral head necrosis, due to the decreased expression of piezo1 in the femoral head, the new blood vessels are damaged, resulting in bone formation disorders and causing femoral head necrosis. The experiment of the present invention found that in the early stage of femoral head necrosis, the expression of piezo1 in the femoral head will decrease significantly, and the level of piezo1 in the serum will also decrease synchronously. The experimental results also prove this point. Serum piezo1 can assist MRI as a new indicator for early femoral head necrosis. Diagnostic criteria: femoral head necrosis can be diagnosed when the level of piezo1 in the serum is lower than 461.5pg / ml. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 The ROC curve of serum Piezo1 as a diagnostic marker for early femoral head necrosis;

[0018] Figure 2 The results of WB detection and analysis of Piezo1 in the alcoholic femoral head necrosis mouse model;

[0019] Figure 3 The results of PCR detection of Piezo1 in the alcoholic femoral head necrosis mouse model;

[0020] Figure 4 The results of immunohistochemical staining of Piezo1 in the alcoholic femoral head necrosis mouse model. DETAILED DESCRIPTION

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0023] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0024] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0025] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0026] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods in the art, and are generally carried out according to the conditions and steps recommended by the reagent manufacturers. The reagents used in the following examples are all conventional reagents in the art, and are generally purchased or prepared by conventional standard methods unless otherwise specified.

[0027] Example 1

[0028] 32 healthy subjects and 64 patients with early femoral head necrosis were selected for serum Piezo1 Elisa test (Wuhan Kelu Biological Co., Ltd.). ROC curve was drawn and analyzed. The ROC curve of serum Piezo1 as a diagnostic marker for early femoral head necrosis is shown in Figure 1 , Figure 1 The results showed that serum Piezo1 was highly specific as a diagnostic marker for early femoral head necrosis.

[0029] Example 2

[0030] A 5% alcohol diet was used to establish a femoral head necrosis model in mice, and samples were collected on days 1, 2, 3, 7, and 10. Western Blot experiments of piezo1 were performed to observe the changes in piezo1 expression in femoral head vascular endothelial cells.

[0031] Experimental groups: normal control group (normal mice), experimental group (samples were collected on the 1st, 2nd, 3rd, 7th and 10th days, respectively), 3 mice in each group; target gene: piezo1, the sequence of piezo1 is shown in SEQ ID NO.1.

[0032]

[0033] 2. Experimental equipment and reagents

[0034] The experimental equipment is shown in Table 1, the main experimental reagents are shown in Table 2, and the antibody information is shown in Table 3.

[0035] Table 1

[0036]

[0037]

[0038] Table 2

[0039] Reagents factory Part Number Enhanced RIPA Lysis Buffer Boster AR0102 PMSF (100 mM) Boster AR1192 WB dedicated primary and secondary antibody dilution solution Boster AR1017 BCA Protein Quantification Kit Blue Sky P0012 5*Protein loading buffer Boster AR1112-10 SDS-PAGE Gel Preparation Kit Servicebio G2003 Protein Marker Thermo Fisher 26616 PVDF membrane 0.45um millipore IPVH00010 PVDF membrane 0.22um millipore ISEQ00010 Skim milk powder Servicebio G5002 TWEEN20 Solarbio T8220 ECL Chemiluminescence Kit Servicebio G2014 TBS buffer Boster AR0144

[0040] Table 3

[0041]

[0042]

[0043] 3. Western Blot Experimental Steps (1) Total Tissue Protein Extraction

[0044] ①Wash the tissue block with cold PBS for 3 times to remove blood stains, cut it into small pieces and place it in a homogenizer tube. Add 2 small 2mm magnetic beads and 10 times the volume of the tissue (add protease inhibitors before use) and place it in a homogenizer. Select the program to homogenize thoroughly. For ordinary tissues, 60s, reduce the time for softer ones, and increase the time for tougher ones. Cool down intermittently during the homogenization. The maximum homogenization time is 100s. If the homogenization is not thorough or the tissue block is large, you need to cut the tissue block with scissors; if you need to increase the protein concentration, you can reduce the volume of the reagent appropriately;

[0045] ② Take out the homogenized sample tube, place it in an ice bath for 30 minutes, and shake it every 5 minutes to ensure complete lysis of the tissue;

[0046] ③ Centrifuge at 12000rpm for 10min and collect the supernatant, which is the total protein solution;

[0047] ④The next step is to test the protein concentration. At this time, it is necessary to prevent the protein solution from denaturing and prepare a special protein concentration determination kit BCA to test the protein concentration;

[0048] ⑤ Perform protein denaturation operation, add protein loading buffer at a ratio of 4 times the volume of the protein solution, boil it in a boiling water bath for 15 minutes to fully denature it, and place it in a -20℃ refrigerator for use.

[0049] (2) SDS-PAGE electrophoresis

[0050] ①Clean the glass plate thoroughly, let it stand at room temperature and dry it thoroughly, take a ground glass plate and a flat glass cup, combine them into a pair, then put them into the glue making machine, and use a wedge to clamp the glass plate, and carefully check that the colloid flows out from the bottom of the glass plate;

[0051] ② Prepare 4.0 / 2.7mL of pure water, 3.8mL of 1.5M TRIS-HCl buffer, 0.1mL of 10% SDS solution, 2.0 / 3.3mL of 30% acrylamide solution, 0.1mL of AP solution, and 8 / 4μL of TEMED solution. Mix the above solutions thoroughly to make 6 / 10% separation gel, then put in TEMED solution, shake it immediately to mix it thoroughly, and then pour the gel immediately. After pouring the gel, insert the comb and inject pure water into the gap. Note that the operation should be uniform and slow during injection. After standing, wait for the separation gel to fully solidify, absorb the upper layer of water, and use absorbent paper to fully absorb the gel; the ratio method of 5% concentrated gel is shown in Table 4.

[0052] Table 4

[0053]

[0054] ③First, prepare 5% concentrated gel according to the method in the above table. After successful preparation, place it into the TEMED solution and shake it thoroughly to mix it evenly. Then pour the gel to fill the remaining gaps with the concentrated gel. Finally, insert the comb into the concentrated gel.

[0055] ④ Allow the reaction to stand for a long time, check that the separation gel has solidified sufficiently, take out the gel dispenser, remove the comb, and prepare for the next step of electrophoresis operation;

[0056] ⑤ Prepare the electrophoresis tank, place the gel dispenser in it, fill it with electrophoresis solution, and load the sample. Add the experimental sample into the electrophoresis well and start electrophoresis. Select the appropriate voltage according to the type of gel. Generally, the voltage for separation gel is 120V and the voltage for shrinking gel is 75V. The standard for stopping electrophoresis is when bromophenol blue just runs out, and prepare for the next step.

[0057] (3) Transfer

[0058] ① Prepare the PVDF membrane and put it into methanol for activation, then prepare filter paper with a size of 7cm×9cm;

[0059] ②Put the sponge pad, glass rod, filter paper and PVDF membrane into the basin, add the clips for transfer, and then fill it with transfer solution;

[0060] ③Open the clamp, keep the black surface in a horizontal position, and place a sponge pad and filter paper on it;

[0061] ④ Carefully peel off the separation gel and place it on the filter paper, then cover the PVDF membrane on the separation gel, and then cover three filter papers on the PVDF membrane, carefully suck out the bubbles. Then place another prepared sponge pad on the top layer;

[0062] ⑤ Perform transfer with a current of 200 mA and a time of 60 min. The transfer tank should be placed in ice water during the whole process.

[0063] (4) Immune response

[0064] ① Prepare 5% skim milk, use it to seal the transferred membrane, place it on a decolorizing shaker, and decolorize it at room temperature for 60 minutes;

[0065] ② Dilute the primary antibody solution and incubate overnight at 4°C;

[0066] ③ Prepare TBST solution for washing at room temperature, and wash on a decolorizing shaker for about 15 minutes;

[0067] ④ Prepare TBST solution, dilute the secondary antibody 5000 times, and incubate for about 40 minutes. Prepare TBST solution again for washing at room temperature, and wash on a decolorizing shaker for about 15 minutes in total.

[0068] (5) Chemiluminescence

[0069] ① Prepare a clean centrifuge tube, add equal volumes of ECLA and ECLB reagents, and mix them thoroughly in a dark room for later use;

[0070] ② Place the PVDF membrane in the mixed solution, with the protein side facing up, to allow for full mixing and reaction for about 5 minutes;

[0071] ③ Carefully use a pipette to suck out the residual liquid on the upper layer, cover it with a layer of film, and then carry out exposure treatment.

[0072] (6) Gel image analysis

[0073] ① Scan and save the film image with a scanner, and use PhotoShop software to perform operations such as decolorization;

[0074] ② Use ImageJ software or other processing systems to analyze and record the optical density value of the target band, see Figure 2 .

[0075] 4. Experimental Results

[0076] Figure 2The results of WB detection and analysis of Piezo1 in the alcohol-induced femoral head necrosis mouse model. The results showed that compared with the normal control group, the protein expression level of piezo1 in the femoral head of mice fed with 5% alcohol diet for 10 days was significantly decreased, P<0.001.

[0077] Example 3

[0078] The femoral head necrosis animal model was established by using 5% alcohol feed, and the samples were collected on days 1, 2, 3, 7, and 10. Fluorescence quantitative PCR experiments of piezo1 were performed to observe the changes of piezo1 expression in femoral head vascular endothelial cells.

[0079] 1. Experimental parameters

[0080] Experimental groups: normal control group (normal mice), experimental group (samples were collected on the 1st, 2nd, 3rd, 7th and 10th days respectively), three mice in each group, target gene: piezo1.

[0081] 2. Experimental equipment and reagents

[0082] The experimental instruments are shown in Table 5, and the experimental reagents are shown in Table 6.

[0083] Table 5

[0084]

[0085] Table 6

[0086]

[0087]

[0088] The centrifuge tube and TIP head need to be sterilized by moist heat for 20 minutes and dried.

[0089] 3. Fluorescence quantitative PCR experimental steps

[0090] 3.1. Total RNA extraction (pipette tips and centrifuge tubes are sterilized by wet heat and are RNase-free)

[0091] (1) Animal tissue: Take fresh or -70℃ frozen animal tissue and chop it into small pieces as much as possible. Add 1ml TRIzon Reagent to every 30-50mg tissue and homogenize it with a homogenizer. Or grind it in liquid nitrogen and add 1ml TRIzon Reagent to mix well. Note: The sample volume should generally not exceed 20% of the volume of TRIzon Reagent.

[0092] (2) Pipette TRIzon Reagent into a 2 mL centrifuge tube, pipette and mix, and let stand for 5 min.

[0093] (3) Add 200 μL of chloroform per 1 ml of TRIzon Reagent and shake vigorously for 45 seconds to mix thoroughly until the liquid becomes milky. Let stand at room temperature for 3 min.

[0094] (4) Centrifugation at 12,000 rpm for 10 min at 4°C;

[0095] (5) Transfer the supernatant to a new centrifuge tube, add an equal volume of 70% ethanol, and mix by inversion;

[0096] (6) Add all the solution obtained in the previous step to the adsorption column in the collection tube; if it cannot be added all at once, add it several times; centrifuge at 12000 rpm for 20 seconds, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0097] (7) Add 700 μL of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 20 seconds, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0098] (8) Add 500 μL of Buffer RW2 to the adsorption column, centrifuge at 12,000 rpm for 20 seconds, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0099] (9) Repeat step 8;

[0100] (10) Centrifuge at 12000 rpm for 2 min and discard the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly;

[0101] (11) Place the adsorption column in a new RNase-free centrifuge tube, add 30-50 μL RNase-Free Water to the middle part of the adsorption column, leave at room temperature for 1 min, centrifuge at 12,000 rpm for 1 min, collect the RNA solution, and store the RNA at -70°C to prevent degradation.

[0102] 3.2 Reverse transcription

[0103] The gun tip and PCR were sterilized by moist heat and were RNase-free. The preparation of the reverse transcription reaction solution was shown in Table 7 (the reaction solution was prepared on ice).

[0104] Table 7

[0105] Component name Addition amount 5XEvoM-MLVRTMasterMix 2μL Total RNA 500ng RNase-free water Up to 10 μL

[0106] Reaction conditions: 37℃15min, 85℃5sec, 4℃.

[0107] Quantitative PCR

[0108] 1) The cDNA obtained by the above reverse transcription process was directly subjected to quantitative PCR analysis. The qPCR reaction conditions and PCR reaction procedures are shown in Tables 8 and 9, respectively. The sequence of Primer F is shown in SEQ ID NO.2, and the sequence of Primer R is shown in SEQ ID NO.3. Primer F: 5'-GACTGCAAGGCTGACTGCAAC-3' (SEQ ID NO.2); Primer R: TACAGCCCCCAATCCCGTAC (SEQ ID NO.3).

[0109] Table 8

[0110] Component name system cDNA 2μL Template <100ng Primer F (10 μM) 0.4μL PrimerR (10 μM) 0.4μL ROXReferenceDye (4μM) 0.4μL RNase-free water Up to 20 μL

[0111] Table 9

[0112]

[0113] 4. Result processing

[0114] ΔΔCT method: A = CT (target gene, sample to be tested) - CT (internal standard gene, sample to be tested) B = CT (target gene, control sample) - CT (internal standard gene, control sample) K = AB expression multiple = 2 -K .

[0115] 5. Experimental Results

[0116] Figure 3 The results of PCR detection of Piezo1 in the alcohol-induced femoral head necrosis mouse model show that compared with the normal group, the piezo1 gene expression in the femoral head of mice fed with 5% alcohol feed began to be lower than that of the normal group from the third day, and still could not return to normal levels on the tenth day.

[0117] Example 4

[0118] The femoral head necrosis animal model was established by using 5% alcohol feed, and the samples were collected on days 1, 2, 3, 7, and 10. Immunohistochemical experiments of piezo1 were performed to observe the changes of piezo1 expression in femoral head vascular endothelial cells.

[0119] 1. Observation of Vpiezo1 expression in femoral head tissue using immunohistochemistry

[0120] After deparaffinization, the sections were repaired in 0.01 mol / L citrate buffer at 121°C for 15 min, and then stained. After the sections were inactivated with 30 mL / L hydrogen peroxide to inactivate endogenous peroxidase, they were incubated with rabbit anti-mouse piezo1 antibody (1:100) at 4°C for 12 h; HRP-labeled goat anti-rabbit IgG was incubated at 37°C for 1 h, DAB was used for color development, and DP-72 microscope observation was performed. The sections were magnified 400 times and 6 × 10 10 nm 2 The number of positive cells in each area was 10 samples in each group at each time point, and the average value was taken. Image-Pro Plus 6.0 was used to analyze the number of positive cells in each experimental group for statistical analysis.

[0121] 2. Statistical analysis Microsoft Excel statistical software was used for analysis. The t test was used, and P < 0.05 was considered statistically significant.

[0122] 2. Experimental results

[0123] Figure 4 The immunohistochemical staining results of Piezo1 in the alcoholic femoral head necrosis mouse model. Figure 4 As shown, the brown color represents piezo1-positive vascular cells in the femoral head. Compared with the normal group, it can be seen that the piezo1-positive cells began to decrease from the second day, and by the tenth day, piezo1-positive cells were hardly found in the femoral head.

[0124] The present invention selects the serum of hospitalized patients with femoral head necrosis for detection in the clinical trial stage, and obtains serum Piezo1 as a diagnostic marker for early femoral head necrosis with high specificity. In the animal experiment stage, the present invention finds that the expression of piezol1 in mice with early alcoholic femoral head necrosis is significantly downregulated, but clinically MRI detection is normal, and there is a lack of standard prediction of femoral head necrosis.

[0125] The present invention monitors the serum piezo1 level and provides a new marker for the screening of early femoral head necrosis. In the early femoral head necrosis process, due to the decreased expression of piezo1 in the femoral head, the new blood vessels are damaged, resulting in bone formation disorders and inducing femoral head necrosis. The present invention experimentally found that in the early femoral head necrosis, the expression of piezo1 in the femoral head will decrease significantly, and the piezo1 level in the serum will also decrease synchronously. The experimental results also prove this point, and serum piezo1 can assist MRI as a new indicator for early femoral head necrosis.

[0126] The present invention uses a human piezoelectric mechanosensitive ion channel component 1 (PIEZO-1) enzyme-linked immunosorbent assay kit (article number ELK0343) to detect the expression level of piezo1 in clinical serum samples, uses the data, and uses SPSS to obtain an ROC curve, and selects a method that maximizes the Youden index (sensitivity + specificity - 1) on the ROC curve to determine the threshold. The final diagnostic standard is: femoral head necrosis can be diagnosed when the level of piezo1 in the serum is lower than 461.5 pg / ml.

[0127] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A biomarker for early diagnosis of femoral head necrosis, characterized in that: The biomarker is the mechanically gated cation channel Piezo1.

2. Application of reagents for detecting the content of mechanically gated cation channel Piezo1 in serum in the preparation of early diagnostic products for femoral head necrosis.

3. The use according to claim 2, characterized in that: The early diagnosis product includes a kit or a reagent.

4. An early diagnosis product for femoral head necrosis, characterized in that: Includes reagents for detecting the amount of mechanically gated cation channel Piezo1 in serum.

5. The early diagnosis product according to claim 4, characterized in that: The early diagnosis product includes a kit or a reagent.

Images