Application of rice RNA (Ribonucleic Acid) adenine methyltransferase gene in regulation and control of plant virus resistance

Abstract

The invention belongs to the field of plant biocontrol, and particularly provides application of a rice RNA (Ribonucleic Acid) adenine methyltransferase EDM2L gene in regulation and control of plant virus resistance. By comparing an edm2l knockout mutant inoculated with an RSV virus and an edm2l'methyltransferase catalytic activity mutant with ZH11 wild plant analysis, it is found that the resistance of rice to the RSV virus can be remarkably weakened by EDM2L expression down-regulation caused by edm2l knockout, and it is indicated that the gene has an anti-RSV function. The invention provides a new target gene locus for cultivating and enhancing the virus resistance of crops by utilizing a genetic engineering means, and has important significance and wide application prospect in the aspects of regulating the plant resistance and breeding for disease resistance.

Description

Technical Field

[0001] The present invention belongs to the field of biological control, and specifically relates to a plant RNA adenine methyltransferase gene and an application thereof in regulating plant anti-virus. Background Art

[0002] Rice is one of the most important food crops in my country and even in the world. It provides food for nearly 50% of the world's population. Increasing rice production plays an extremely important role in ensuring food security and people's living standards. By 2050, the global population is expected to grow by more than 9 billion, requiring a continuous increase in food production to meet the needs of population growth. China is the world's largest rice producer and consumer. How to feed 22% of the world's population with 7% of the world's arable land has always been a huge challenge faced by Chinese agricultural scientists. Over the past 60 years, Chinese scientists have greatly improved the yield level of rice through a series of variety selection and application promotion around the goal of high rice yield. In particular, the breeding and application research of hybrid rice has made great contributions to ensuring food security in my country and the world.

[0003] However, during the growth of rice, the invasion of various viruses, bacteria, fungi or pests seriously threatens the healthy growth of rice. According to statistics, various pests and diseases cause up to 30% of global grain production losses each year. Among them, plant virus infection has become the second largest disease in agricultural production, causing huge economic losses worldwide every year. Plant viruses are mainly transmitted by insects, accounting for more than 80% of plant viruses, resulting in global losses of US$20 billion each year. In my country, the main insect-borne plant viruses include rice stripe leaf blight (RSV), southern rice black streaked dwarf disease (SRBSDV), wheat yellow dwarf disease (BYDV), etc. At present, there is a lack of control measures for plant viruses. In addition, these viruses are difficult to detect, track, and control by chemical pesticides. Once an epidemic breaks out, it will cause huge economic losses and seriously affect my country's food production security.

[0004] Rice stripe virus (RSV) is one of the most destructive rice viruses in East Asia. When rice is infected with RSV, it causes rice stripe leaf blight, which is called "cancer on rice". Its typical symptoms are discontinuous yellow stripes on the heart leaves, followed by curling, and eventually leading to plant death. Once an epidemic breaks out, it will cause great economic losses and seriously threaten my country's food production security. The symptoms of the disease will be different at different growth stages. Rice infected with RSV in the seedling stage will be severely stunted, unable to grow normally, and finally die; while the symptoms of RSV infection in the late growth stage are relatively mild. RSV has a wide host range, and monocotyledonous grass crops such as rice, wheat, corn, barley, oats, millet, etc. are its main host plants. In addition, some grass weeds can also be infected with RSV. In nature, rice stripe virus is mainly transmitted by the gray leafhopper in a persistent proliferation manner, and can be transmitted to offspring through eggs to achieve vertical transmission. The existing main rice cultivars in my country generally lack resistance to viral diseases, so there is an urgent need to cultivate high-yield and high-quality varieties with resistance to viral diseases. The advent of transgenic technology has greatly shortened the time cost of disease-resistant breeding. While ensuring high yields, changing the expression pattern of plant genes makes it possible for crops to acquire resistance to diseases. Studying the complex immune process of plants and analyzing the molecular mechanisms involved will screen out a large number of plant genes with disease resistance. It can provide rich gene target resources and theoretical basis for transgenic breeding, greatly accelerate the cultivation of high-yield and stable transgenic crop varieties with disease resistance, and thus better ensure food security and the stable development of agricultural production. Therefore, the mining of disease-resistant genes is crucial for the prevention and control of viral diseases. Summary of the invention

[0005] In order to fill the gap in the prior art, the present invention provides a rice RNA adenine methyltransferase gene (EDM2L) and its application in plant antiviral, and specifically provides the following technical solutions: The first aspect of the present invention provides the use of a rice RNA adenine methyltransferase gene and a protein encoded thereby in regulating plant resistance to viruses.

[0006] Preferably, the NCBI sequence number of the nucleotide sequence of the rice RNA adenine methyltransferase gene is Os08g0502000; more preferably, the NCBI sequence number of the protein sequence encoded by the gene is XP_015648848.2.

[0007] In one embodiment, the plant is rice.

[0008] In another embodiment, the virus is RSV.

[0009] In another embodiment, the use includes mutating the rice RNA adenine methyltransferase gene EDM2L in the target plant so that the rice adenine methyltransferase gene in the target plant EDM2L The expression is reduced, thereby obtaining RSV virus susceptible plants.

[0010] Compared with the prior art, the present invention has the following significant improvements: The present invention discloses for the first time that the mutation of RNA adenine methyltransferase EDM2L, an endogenous gene for rice resistance to RSV, can significantly reduce the resistance of rice to RSV, thus providing target gene resources and theoretical basis for rice resistance breeding.

[0011] The present invention experimentally proves that the rice RNA adenine methyltransferase gene EDM2L has an important regulatory effect on rice resistance to RSV, and knocking out the gene to reduce the expression of the gene can weaken rice resistance to RSV. This proves that the gene plays an important regulatory role in the antiviral immunity process of rice, which has important implications for rice resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention.

[0013] Figure 1 Seedlings and inflorescences of wild-type rice ZH11 EDM2L Gene amplification size results; Figure 2 The full-length sequence of EDM2L was determined by RACE experiment. The bright blue part is the newly determined gene sequence; Figure 3 To show that EDM2L wild type and edm2l Schematic diagram of the knockout mutant gene structure; Figure 4 To show that EDM2L wild type and edm2l' Schematic diagram of the knockout mutant gene structure; Figure 5 For wild type and edm2l, edm2l' Knockout mutant growth in healthy state Figure 6 14 days after RSV infection, edm2l, edm2l' Overall growth and disease progression of knockout mutant and wild-type ZH11 rice plants; Figure 7 14 days after RSV infection, edm2l, edm2l' Disease grading results of knockout mutant and wild-type ZH11 rice plants; Figure 814 days after RSV infection, edm2l The amount of RSV-CP RNA accumulation and RSV-CP protein accumulation in knockout mutant plants; Fig. 9 14 days after RSV infection, edm2l' Accumulation of RSV-CP RNA and RSV-CP protein in knockout mutant plants. DETAILED DESCRIPTION

[0014] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0015] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0016] In the following examples, m / v refers to g:ml unless otherwise specified.

[0017] one, EDM2L Identification of full-length transcripts First, to determine EDM2L Full length of gene transcript, determined by 5' RACE assay EDM2L The full-length transcript at the 5' end of the gene. The wild-type rice ZH11 panicles that were heading but not yet filling were collected, and RNA was extracted and then treated with DNase I and reverse transcribed. The reverse transcription experiment of 5' RACE includes the following steps:

[0018] After reacting at 42°C for 2 min, the mixture was placed on ice and centrifuged at 14,000 g for 10 s to collect the reaction product.

[0019] Step 2: Synthesis of first-strand cDNA Add the following to the reaction system:

[0020] Reverse transcription was performed at 42°C, 90 min; 70°C, 10 min; and 4°C, ∞.

[0021] The cDNA obtained by reverse transcription was diluted 2-fold and then PCR-stained with 2× KOD One TM PCR MasterMix EDM2L Amplification of the 5' end sequence of the transcript. The reaction system is as follows:

[0022] Primer sequences used: UPM-long: 5'- CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT -3' (SEQID NO.1) EDM2L- RT-R: 5'- CTATGGTACTCAATGCCAGCTG -3' (SEQ ID NO.2) Perform fragment amplification reaction in a PCR instrument.

[0023] The reaction procedure is as follows:

[0024] The PCR product was subjected to agarose gel electrophoresis and then transformed into E. coli for sequencing after being connected to the T vector. Figure 1 As shown in Figure 2, the size of the PCR amplification product is about 2.5 kb, which is consistent with the size of the transcript fragment amplification predicted by NCBI. Figure 2 As shown, the Sanger sequencing results showed that EDM2L The transcription start site is consistent with the transcription start site predicted by NCBI. EDM2L The transcript is the NCBI annotated transcript XM_015793362.3, and its protein sequence is XP_015648848.2.

[0025] two, EDM2L Phenotypes of two mutants of the gene EDM2L Two mutants of the gene edm2l and edm2l' Obtained from Chen Letian, South China Agricultural University, the mutation types are as follows Figure 3 and Figure 4 As shown, the mutant edm2l This is a knockout mutant with a 39 bp deletion that causes premature translation termination. edm2l' It is a mutant with 2 amino acids in the active site changed due to 3bp deletion in the catalytic domain of methyltransferase. The control used is wild-type rice ZH11 seeds preserved in the laboratory.

[0026] EDM2L knockout mutant edm2l, edm2l' and wild-type rice ZH11 seeds. When the plants were 4 weeks old, the knockout mutants edm2l and wild-type rice ZH11, edm2l' The wild-type rice ZH11 plants were placed on the same horizontal line, and the entire plant was photographed using a special experimental camera.

[0027] edm2l The overall photographic results of the mutant plants are as follows Figure 5The left figure shows the 39 bp knockout mutant of the EDM2L gene edm2l The overall growth of the plant is compared with the wild-type plant. Phenotypic description Compared with the wild-type ZH11, edm2l The growth of mutant plants was consistent with that of wild type plants, and there was no significant difference in plant height between them. edm2l' The overall phenotype of Figure 5 As shown in the right figure, its growth conditions are consistent with the wild type, and there is no obvious difference in plant height and growth potential.

[0028] 3. Phenotypes of the two knockout mutants after RSV inoculation EDM2L knockout mutant edm2l and edm2l' The seeds of wild-type rice ZH11 were sown. RSV virus was inoculated after the plants grew to 10 days. The knockout mutants were observed after two weeks of cultivation of the inoculated rice plants. edm2l and edm2l' The knockout mutants edm2l and wild-type rice ZH11, edm2l' It was placed on the same level as the wild-type rice ZH11, and the entire plant was photographed using a camera specifically designed for the experiment.

[0029] The results of taking photos of plant leaves after infection with plant virus RSV are as follows Figure 6 As shown in the left picture, after RSV virus inoculation edm2l The overall growth of the knockout mutant plants was more seriously affected than that of the wild-type rice ZH11 plants, mainly manifested in a higher degree of plant dwarfing, a higher degree of chlorosis of old leaf stripes, more serious curling and necrosis of new leaves than wild-type rice, and significantly weakened resistance to RSV virus.

[0030] like Figure 6 The right figure shows the methyltransferase activity mutant after RSV virus inoculation edm2l' The symptoms were more severe than those of wild-type rice ZH11, with a higher proportion of plants becoming dwarfed, old leaves turning green and yellow, and new leaves curling and necrosis, and resistance to RSV was significantly weakened.

[0031] The disease classification results of plants infected with plant virus RSV are as follows: Figure 7 As shown, EDM2L Knockout mutants edm2l and methyltransferase activity mutants edm2l' The grade III incidence of the disease was higher than that of the wild type.

[0032] The above results indicate that EDM2L has anti-RSV function.

[0033] 4. qPCR and western blot detection edm2l Knockout mutants after RSV CP RNA and protein accumulation Will EDM2L Two mutants of the gene edm2l and wild-type rice ZH11 seeds were sown. After the plants grew to 10 days old, RSV virus was inoculated, and the infected plants were cultured in an incubator for two weeks before total RNA of mutants and wild-type plants was extracted.

[0034] To extract total RNA from plants, ensure that all reagents and consumables are free of RNase during the experiment. The extracted total RNA is subjected to RNA reverse transcription. RNA reverse transcription includes two steps: removal of genomic DNA and mRNA reverse transcription.

[0035] Step 1: Removal of genomic DNA

[0036] After reacting at 42°C for 2 min, the mixture was placed on ice.

[0037] Step 2: Reverse transcription reaction

[0038] Reverse transcription was performed at 37°C, 15 min; 85°C, 5 s; and 4°C, ∞.

[0039] After RNA was converted into cDNA, the expression level of RSV-CP was detected by qPCR.

[0040] After the cDNA obtained by reverse transcription was diluted 10 times, real-time fluorescence quantitative PCR reaction was performed using 2× ChamQ SYBR qPCR Master Mix from Vazyme. The reaction system is as follows: Component name Amount 2× ChamQ SYBR qPCR Master Mix 5 μL Upstream primer F (10 μM) 0.2 μL Downstream primer R (10 μM) 0.2 μL 50×ROX Reference Dye 1 0.2 μL cDNA (diluted 10 times) 1 μL ddH2O 10 μL ABI stepone plus instrument was used for quantitative PCR experiments.

[0041] Primer sequences used: RSV-CP-qF: 5'-AGTGCTGATCGTATTGACAGA-3' (SEQ ID NO.3) RSV-CP-qR: 5'-GATGAAGTACACAACTGGTC-3' (SEQ ID NO.4) The reaction procedure is as follows:

[0042] Melt Curve Acquisition Signal OsEF1a was used as the internal reference for qPCR. T RSV CP The relative expression of RNA was as follows: Figure 7 After RSV infection, EDM2L Knockout mutants edm2l RSV CP The RNA accumulation of RSV in wild-type rice ZH11 was higher than that in wild-type rice ZH11. CP The amount of RNA accumulation increased significantly.

[0043] At the same time, the RSV infection edm2l Total protein was extracted from mutant and wild-type ZH11 materials and subjected to Western blot experiments. The Western blot experiment was performed as follows: Step 1: Extraction of total protein from rice plant samples The rice leaves were ground under liquid nitrogen, 300 μL of protein extraction liquid was added, incubated at 4°C for 30 min, centrifuged at 12,000 g for 10 min, and the supernatant was the total protein of the rice leaves.

[0044] Step 2: Western blot Total proteins were then boiled in SDS / PAGE sample buffer for 10 min, separated by SDS-PAGE and transferred to nitrocellulose blotting membranes. The membranes were blocked with TBST (1x TBS, containing 5% skim milk and 0.1% Tween-20) for one hour at room temperature and then incubated with Anti-RSV-CP primary antibody overnight at 4°C. After incubation with horseradish peroxidase-conjugated rabbit secondary antibody for one hour at room temperature, immunoblots were visualized using enhanced chemiluminescence solution.

[0045] Western blot experiments detected that the accumulation of RSV CP protein in the mutant was significantly higher than that in the wild-type ZH11, indicating that the protein content of RSV-CP was significantly increased compared with that in the wild-type ZH11.

[0046] Detection by qPCR and western blot EDM2L Knockout mutants edm2l and methyltransferase activity mutants edm2l' and wild-type ZH11 in RSV infected RSV CP The accumulation of RNA and protein, such as Figure 8 and Fig. 9 OsEF1a was used as the internal reference for qPCR. T RSV CP The relative expression of RNA showed that after RSV infection, EDM2L Knockout mutants edm2l and methyltransferase activity mutants edm2l' RSV CP The accumulation of RNA and protein was significantly increased compared with the wild-type ZH11.

[0047] The above results indicate that the EDM2L gene has resistance to RSV.

[0048] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A use of a rice RNA adenine methyltransferase gene or a protein encoded by the gene in regulating plant antiviral activity, characterized in that: The virus is rice stripe virus.

2. The use according to claim 1, characterized in that: The plant is rice.

3. The use according to claim 1 or 2, characterized in that: The NCBI sequence number of the nucleotide sequence of the rice RNA adenine methyltransferase gene is Os08g0502000.

4. The use according to claim 1 or 2, characterized in that: The NCBI sequence number of the protein sequence encoded by the rice RNA adenine methyltransferase gene is XP_015648848.

2.

5. The use according to claim 1 or 2, characterized in that: The application includes: transferring the rice RNA adenine methyltransferase gene in the target plant to EDM2L The mutation reduces the expression of the rice adenine methyltransferase gene EDM2L in the target plant, thereby obtaining a plant susceptible to rice stripe virus.

Images