In-vitro transcription method of m3T-containing non-natural basic group and evaluation and analysis method of m3T-containing non-natural basic group

Abstract

The invention provides an in-vitro transcription method of an m3T-containing non-natural base and an evaluation and analysis method of the m3T-containing non-natural base, and relates to the technical field of non-natural bases. According to the invention, an in-vitro transcription method containing the m3T non-natural base is established, the in-vitro transcription method utilizes T7RNA polymerase for catalysis, and the m3T non-natural base can be doped into the para-position of TPT3 in a DNA template, so that an RNA product containing m3T is generated, and fixed-point modification of short-chain and medium-long-chain RNA is realized. The invention further establishes a fidelity evaluation method of an in-vitro transcription product of the m3T base and universal analysis of an in-vitro transcription sequence of the m3T non-natural base aiming at the m3T base, so as to obtain short-chain and medium-long-chain RNA products containing the m3T non-natural base with high fidelity and provide a detailed basis for fixed-point transcription of m3T nucleoside RNA.

Description

Technical Field

[0001] The present invention belongs to the technical field of non-natural bases, and specifically relates to an in vitro transcription method containing m3T non-natural bases and an evaluation and analysis method thereof. Background Art

[0002] In nature, natural bases of organisms construct information storage and expression systems in life activities, realizing the diversity of life forms. However, the natural bases used to build life are only A, T / U, G, and C, which can only encode 64 codons, which limits the chemical, structural, and functional diversity of nucleic acid molecules, thereby limiting the biological applications of nucleic acid molecules. Non-natural base technology is a technical system designed, synthesized, evaluated, and applied from the source. The discovery of new non-natural bases can enrich the chemical and structural diversity of nucleic acid molecules, increase the storage capacity of genetic information, and expand their biological and medical applications. It has now become a new frontier in chemical biology.

[0003] However, non-natural base technology still faces many challenges. First, the diversity of non-natural base structures with excellent replication and transcription activity is limited. Currently, there are only three representative non-natural base pairs: P / Z, Ds / Px, and TPT3 / NaM. The limitations of the chemical structure of non-natural bases have become a bottleneck for the biomedical application of non-natural base technology. Therefore, how to design and synthesize new artificial base pairs using the principles of hydrogen bond displacement, steric hindrance, shape complementarity, and hydrophobic interaction is still a challenging task. Secondly, the replication, transcription, and translation efficiency and rules of different types of non-natural bases are insufficiently studied, and there is a lack of effective in vitro and in vivo genetic code expansion systems. An effective in vitro and in vivo genetic code expansion system is a key technology for the biomedical application of non-natural bases. The establishment of a non-natural base gene expansion system will be conducive to the application and development of non-natural bases in genetic diagnosis, functional nucleic acid molecule development and site-specific modification, protein drug modification, epidemic prevention, and biosensors. Summary of the invention

[0004] In view of this, the object of the present invention is to provide an in vitro transcription method containing m3T non-natural base, which uses T7 RNA polymerase catalysis to incorporate the m3T non-natural base into the opposite position of TPT3 in the DNA template to achieve site-specific modification of short-chain and medium-long-chain RNA.

[0005] Another object of the present invention is to provide an evaluation and analysis method for the transcription products obtained by the above-mentioned in vitro transcription method, which can simply and effectively evaluate the fidelity of short-chain and medium-chain RNA transcription products containing m3T non-natural bases, and provide a detailed basis for the site-specific transcription of m3T nucleoside RNA.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an in vitro transcription method containing an m3T non-natural base, wherein the in vitro transcription method includes an in vitro transcription method for a short-chain RNA containing an m3T non-natural base and an in vitro transcription method for a medium- and long-chain RNA containing an m3T non-natural base;

[0008] The in vitro transcription method of short-chain RNA containing m3T non-natural base comprises the following steps: mixing a non-natural base transcription template containing TPT3 with a T7 promoter to obtain a double-stranded transcription template DNA; using T7 RNA polymerase to catalyze the double-stranded transcription template DNA to perform an in vitro transcription reaction, and after the transcription reaction is completed, digesting the transcription template DNA to obtain a short-chain RNA transcription product containing m3T non-natural base;

[0009] The in vitro transcription method of medium-length RNA containing m3T non-natural base comprises the following steps: obtaining a double-stranded transcription template DNA containing NaM / TPT3 non-natural base pairs by PCR amplification; performing an in vitro transcription reaction on the double-stranded transcription template DNA by T7 RNA polymerase catalyzed, and after the transcription reaction is completed, digesting the transcription template DNA to obtain a medium-length RNA transcription product containing m3T non-natural bases.

[0010] Preferably, the reagents for the in vitro transcription reaction include Transcription Buffer, NTPs, RNase inhibitor, inorganic pyrophosphatase, enzyme-free sterile water, and rm3TTP.

[0011] Preferably, the in vitro transcription reaction is carried out at 35-37° C. for 5-8 hours.

[0012] Preferably, the in vitro transcription method further comprises detecting the short-chain RNA transcription product or the medium-chain RNA transcription product using a 5% denaturing polyacrylamide gel containing 8M urea.

[0013] The present invention also provides an RNA transcription product containing the m3T non-natural base obtained by the in vitro transcription method.

[0014] The present invention also provides an evaluation and analysis method for RNA transcription products containing m3T non-natural bases, wherein the evaluation and analysis method includes a fidelity evaluation method for short-chain RNA transcription products containing m3T non-natural bases and a fidelity evaluation method for medium- and long-chain RNA transcription products containing m3T non-natural bases.

[0015] Preferably, the fidelity evaluation method of the short-chain RNA transcription product containing the m3T non-natural base comprises the following steps: purifying the obtained short-chain RNA transcription product, and digesting the purified short-chain RNA transcription product into single nucleosides using a nucleic acid digestion enzyme; detecting the digestion product using high performance liquid chromatography, correcting the peak areas of A, T / U, G, C, and m3T nucleoside detection peaks using a single-point molar concentration correction method, and calculating the nucleoside composition of the transcription product by the ratio of the peak areas of each nucleoside; and calculating the fidelity of the transcription product of the m3T nucleoside by the ratio of the actual detection ratio of m3T to the theoretical ratio.

[0016] Preferably, the fidelity evaluation method of the medium-chain RNA transcription product containing the m3T non-natural base comprises the following steps: purifying the obtained medium-chain RNA transcription product, reverse transcribing the purified medium-chain RNA transcription product using reverse transcriptase to obtain a reverse transcription PCR product, performing Sanger sequencing on the reverse transcription PCR product, and judging the fidelity of the m3T non-natural base medium-chain RNA transcription product by using the characteristic of sudden termination of the original sequencing signal of TPT3 in Sanger sequencing.

[0017] Preferably, the evaluation and analysis method also includes a universal analysis of in vitro transcribed sequences containing the m3T non-natural base.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] (1) The present invention utilizes the non-natural base system of TPT3, NaM and m3T to achieve site-specific transcription and modification of m3T in medium-chain RNA. That is, the double-stranded DNA transcription template containing TPT3 is obtained by utilizing the high-fidelity replication characteristics of the NaM-TPT3 base pair and the PCR amplification compatibility amplification, and then based on the m3T-TPT3 base pair, m3T is introduced into a specific site in the medium-chain RNA under the catalysis of T7 RNA polymerase. In addition, the present invention verifies that commercially available reverse transcriptases including reverse transcriptase XL and reverse transcriptase M can recognize dTPT3TP and catalyze its pairing with m3T in RNA to generate cDNA containing TPT3 at a specific site. The present invention utilizes this characteristic of m3T-TPT3 and establishes a reverse transcription-based sequencing analysis method for m3T in medium-chain RNA, converts the m3T base in RNA into TPT3 in cDNA, and then converts it into a TPT3-NaM base pair in double-stranded DNA during PCR amplification of cDNA. The transcription fidelity of the m3T base in medium-chain RNA can be determined by utilizing the characteristic that the original sequencing signal of the TPT3-NaM base pair in Sanger sequencing is suddenly terminated. Analysis of the Sanger sequencing results indicates that the m3T base can achieve high-fidelity transcription of medium-chain RNA.

[0020] (2) The present invention also found through sequence universality analysis that m3T nucleoside transcription has sequence universality, and all 4096 possible sequence combinations were read in three random sequence environments upstream and downstream. By analyzing the upstream and downstream nucleoside combinations of non-natural base sites, the 5'-NNNXTAN-3' sequence combination with the greatest transcriptional advantage was found, and the 5'-GGNXNNN-3' sequence combination that may affect the transcription efficiency was also found. The above results are helpful in guiding the design of template sequences with higher transcription efficiency during the site-specific transcription and modification of m3T nucleoside RNA, or evaluating the feasibility of transcription under a specific sequence environment, and provide a detailed basis for the site-specific transcription of m3T nucleoside RNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the general structural formula of the m3T / TPT3 non-natural base;

[0022] Figure 2 Polyacrylamide gel detection of rm3TTP transcription catalyzed by T7 RNA polymerase;

[0023] Figure 3 This is the HPLC analysis of RNA transcripts after enzymatic digestion. In the figure, the upper figure is the liquid chromatogram of all natural nucleosides and rm3T nucleoside standards, and the lower figure is the liquid chromatogram of the digestion product. Each component is marked above the chromatographic peak;

[0024] Figure 4 This is the MALDI-TOF MS mass spectrum of the elution of the rm3T component in the RNA digestion product, and the upper right corner of the figure is an enlarged view;

[0025] Figure 5 Figure 1 is an ESI mass spectrometry spectrum of rm3T-containing transcription products. In the figure, A) is the original spectrum of ESI mass spectrometry detection, and B) is the normalized spectrum of ESI mass spectrometry detection;

[0026] Figure 6 The original peak graph of DNA double-stranded product Sanger sequencing, in which A) is the original peak graph of DNA double-stranded product Sanger sequencing of the experimental group, and the non-natural base sites are indicated by red arrows, and B) is the original peak graph of DNA double-stranded product Sanger sequencing of the control group;

[0027] Figure 7 This is the m3T non-natural base medium-length RNA transcription. Lanes 1 to 3 in the figure are three randomly selected transcription systems;

[0028] Figure 8 This is a representative gel detection image of the cDNA amplification product produced by reverse transcriptase XL (AMV);

[0029] Fig. 9The original peak graph of Sanger sequencing of cDNA amplification products of RNA obtained under the condition of rm3TTP presence or absence. In the figure, the upper figure is the original peak graph of Sanger sequencing of cDNA amplification products of RNA obtained under the condition of rm3TTP presence, and the lower figure is the original peak graph of Sanger sequencing of cDNA amplification products of RNA obtained under the condition of rm3TTP absence. The figures show the antisense strand of cDNA amplification products;

[0030] Fig.10 This is a representative gel detection image of the cDNA amplification product produced by reverse transcriptase M (MLV);

[0031] Fig.11 The original peak graph of Sanger sequencing of cDNA amplification products of RNA obtained under the condition of rm3TTP presence or absence. In the figure, the upper figure is the original peak graph of Sanger sequencing of cDNA amplification products of RNA obtained under the condition of rm3TTP presence, and the lower figure is the original peak graph of Sanger sequencing of cDNA amplification products of RNA obtained under the condition of rm3TTP absence. The figures show the antisense strand of cDNA amplification products;

[0032] Fig.12 The original peak graph of Sanger sequencing of random DNA double-stranded products. In the figure, A) is the original peak graph of Sanger sequencing of DNA double-stranded products in the experimental group, and the non-natural base sites are indicated by red arrows. B) is the original peak graph of Sanger sequencing of DNA double-stranded products in the control group;

[0033] Fig.13 It is a preliminary test of transcription time in the m3T nucleoside random sequence environment;

[0034] Fig.14 This is the agarose gel detection image of cDNA amplification product;

[0035] Fig.15 The cDNA amplicon sequencing was performed by reverse transcriptase M. In the figure, the RNA on the left was transcribed in the presence of rm3TTP, and the RNA on the right was transcribed in the absence of rm3TTP. The non-natural base sites are indicated by red arrows.

[0036] Fig.16 The cDNA amplicon sequence obtained by reverse transcriptase XL is shown in the figure. In the figure, the RNA on the left is transcribed in the presence of rm3TTP, and the RNA on the right is transcribed in the absence of rm3TTP. The non-natural base sites are indicated by red arrows.

[0037] Fig.17It is the normalized spectrum of positive chain Sanger sequencing. In the figure, the upper figure is the normalized peak diagram of cDNA amplicon Sanger sequencing, and the lower figure is the normalized peak diagram of cDNA amplicon replacing PCR product Sanger sequencing. The conversion site is indicated by a red arrow;

[0038] Fig.18 is the read frequency distribution of all sequences combined;

[0039] Fig.19 The nucleotide distribution statistics and sequence logo of each random site are shown in Figure 1. A) is the natural base distribution of each random site, and B) is the sequence logo.

[0040] Fig. 20 This is a heat map of read frequencies of single nucleotide combinations upstream and downstream of unnatural bases, where sequence reads are normalized to reads per million;

[0041] Fig.21 This is a heat map of read frequencies of dinucleoside combinations upstream and downstream of unnatural bases, where sequence reads are normalized to reads per million;

[0042] Fig. 22 This is a heat map of the read frequency of the three nucleoside combinations upstream and downstream of the non-natural base. In the figure, N represents downward or rightward in the order of A, T, G, and C. The sequence reads are normalized to reads per million. DETAILED DESCRIPTION

[0043] The present invention provides an in vitro transcription method containing an m3T non-natural base, wherein the in vitro transcription method includes an in vitro transcription method for a short-chain RNA containing an m3T non-natural base and an in vitro transcription method for a medium- and long-chain RNA containing an m3T non-natural base;

[0044] The in vitro transcription method of short-chain RNA containing m3T non-natural base preferably comprises the following steps: mixing a non-natural base transcription template containing TPT3 with a T7 promoter to obtain a double-stranded transcription template DNA; using T7 RNA polymerase to catalyze an in vitro transcription reaction of the double-stranded transcription template DNA, and after the transcription reaction is completed, digesting the transcription template DNA to obtain a short-chain RNA transcription product containing m3T non-natural base;

[0045] The in vitro transcription method of medium-chain RNA containing m3T non-natural base preferably includes the following steps: using PCR amplification to obtain a double-stranded transcription template DNA containing NaM / TPT3 non-natural base pairs; using T7 RNA polymerase to catalyze the in vitro transcription reaction of the double-stranded transcription template DNA, and after the transcription reaction is completed, digesting the transcription template DNA to obtain a medium-chain RNA transcription product containing m3T non-natural bases.

[0046] In the present invention, the non-natural base pair containing the m3T non-natural base preferably includes an m3T / TPT3 non-natural base pair, the general formula of which is as follows: Figure 1 As shown:

[0047]

[0048] In the general formula shown, R is a methyl group, an ethyl group, an isopropyl group, an n-butyl group or other alkylated groups;

[0049] In the general formula shown, R1 is an H atom, a methyl group, an ethyl group, an isopropyl group, an amino group, a biotin group, an aromatic group, an alkenyl group, an alkynyl group, a fluorescent group, or a chemical group used for bioorthogonal reaction, specific enrichment and reporting;

[0050] In the general formula shown, R2 is an alkenyl group, an alkynyl group, a propargyl group, a biotin group, a radioisotope labeling group, a fluorescent group, or a chemical group used for bioorthogonal reaction, specific enrichment, and reporting; the alkenyl group includes alkenyl, allyl, propenyl, halogenated vinyl groups such as vinyl chloride, styryl, and styryl substituted with a benzene ring; the biotin group includes, but is not limited to, PEG-biotin, SH-PEG-biotin, N3-PEG-biotin, alkyne-PEG-biotin, silane-PEG-biotin, aldehyde-PEG-biotin, and amine-PEG-biotin; the radioisotope labeling group includes, but is not limited to 18 F. 123 I. 77 Br, 99 mTc, 186 Re and radioactive phosphorus labeled chemical groups; the fluorescent groups include but are not limited to FAM, FITC, Cy2 and Hex.

[0051] R3 in the general formula shown is a hydrogen atom, a halogen, a hydroxyl group, a methoxy group or sulfur; the halogen includes but is not limited to fluorine, chlorine, bromine and iodine.

[0052] In the present invention, the in vitro transcription method of short-chain RNA containing the m3T non-natural base more preferably includes preparation of double-stranded DNA oligonucleotides, in vitro transcription reaction, nuclease treatment of the transcription DNA template, and detection and confirmation of the transcription product. The specific steps are as follows: the transcription template containing the TPT3 non-natural base obtained by solid phase synthesis is dissolved with enzyme-free sterile water, and equal amounts of the transcription template and T7 promoter are placed in 1× transcription buffer. The reaction system was placed in a thermal cycler, denatured at 95°C for 2 minutes, then cooled to 25°C over 10 minutes, maintained at 25°C for 10 minutes, so that the T7 promoter and the transcription template annealed to form 25 μM double-stranded transcription template DNA, and stored at 4°C for standby use; an in vitro transcription reaction was performed according to the configured in vitro transcription reaction solution, and the reaction conditions of the in vitro transcription were preferably to place the in vitro transcription solution in a thermal cycler at 35-37°C for 5-8 hours; after the above transcription reaction was completed, RNase-free DNase I was added to the reaction system, and the reaction was continued at 35-37°C for 2-3 hours to digest the transcription template DNA; after the reaction was completed, the reaction system was placed in a vacuum concentrator to evaporate the water, 4 μL 1× single-stranded loading buffer was used to dissolve the residue, denatured at 95°C for 3 minutes, immediately placed on ice, and electrophoresed on a 15% denaturing polyacrylamide gel containing 8M urea. After the electrophoresis, the gel was stained with 1×YeaRed nucleic acid dye for 10 minutes, and imaged and analyzed by a WD-9413B gel imaging analyzer.

[0053] In the present invention, the in vitro transcription method of medium-length RNA containing m3T unnatural base more preferably comprises PCR amplification of DNA transcription template containing unnatural base and T7 RNA polymerase catalyzing m3T medium-length RNA transcription, and the specific steps are as follows: the double-stranded DNA template containing TPT3 unnatural base used for transcription is obtained by PCR amplification, 0.01 pmol transcription template, 10 pmol upstream primer, 10 pmol downstream primer, dTPT3TP2.5 nmol, dNaMTP 2.5 nmol and Mix 12.5 μL of PCRMasterMix (containing 5 nmol of dNTPs), and add enzyme-free water to the reaction system to 25 μL. The above reaction system was fully mixed for PCR amplification. The thermal cycle conditions were as follows: 95°C denaturation for 15 seconds, 60°C annealing for 15 seconds, 68°C extension for 3 minutes, a total of 15 cycles, and a final extension of 5 minutes. After the reaction was completed, 1.5% agarose gel detection was performed. The PCR product was extracted and purified using a column DNA gel extraction kit and quantified by NanoDropTM OneC. 0.5 ng of PCR product was taken for secondary amplification using sequencing primers FendT-F and FendT-R. The reaction system and thermal cycle conditions were the same as those for PCR amplification containing non-natural base DNA transcription templates. The amplified product was detected and purified by 1.5% agarose gel for Sanger sequencing to evaluate the fidelity of non-natural bases during transcription template PCR amplification. The remaining amplified products were placed in a vacuum concentrator to evaporate the water, and then re-dissolved with sterile enzyme-free water under sterile conditions to a concentration of 1 μg / μL aqueous solution, stored at -20°C for use, and used for in vitro transcription after Sanger sequencing confirmation. The site-specific transcription of medium-length RNA based on m3T bases was completed by in vitro transcription catalyzed by T7 RNA polymerase. The transcription reaction was carried out in a 20 μL reaction system. First, NTPs 0.5mM, rm3TTP 1mM, RNase inhibitor 20U, T7 RNA polymerase 50U, inorganic pyrophosphatase 0.02U and 10×Transcription Buffer were mixed, and finally 1000ng of the double-stranded DNA template containing non-natural bases obtained in the previous step was added and mixed thoroughly. The reaction system was supplemented to 20 μL with sterile enzyme-free water. The above reaction system was placed at 37°C for transcription for 6 hours. After the transcription was completed, RNase-free DNase Ι10U was added and reacted at 37°C for 2 hours to digest the DNA template. The RNA transcription products were detected by 5% denaturing polyacrylamide gel containing 8M urea, stained with 1×YeaRed nucleic acid dye for 10 minutes, and imaged and analyzed by WD-9413B gel imaging analyzer under 302nm ultraviolet light.

[0054] The present invention also provides an RNA transcription product containing the m3T non-natural base obtained by the in vitro transcription method.

[0055] The present invention also provides an evaluation and analysis method for RNA transcription products containing m3T non-natural bases, wherein the evaluation and analysis method includes a fidelity evaluation method for short-chain RNA transcription products containing m3T non-natural bases and a fidelity evaluation method for medium- and long-chain RNA transcription products containing m3T non-natural bases.

[0056] In the present invention, the fidelity evaluation method of the short-chain RNA transcription product containing the m3T non-natural base preferably includes the following steps: purifying the obtained short-chain RNA transcription product, and digesting the purified short-chain RNA transcription product into single nucleosides using a nucleic acid digestion enzyme; detecting the digestion product using high performance liquid chromatography, correcting the peak areas of A, T / U, G, C, and m3T nucleoside detection peaks using a single-point molar concentration correction method, and calculating the nucleoside composition of the transcription product by the ratio of the peak areas of each nucleoside; and calculating the fidelity of the transcription product of the m3T nucleoside by the ratio of the actual detection ratio of m3T to the theoretical ratio.

[0057] In the present invention, the fidelity evaluation method of the medium-chain RNA transcription product containing the m3T non-natural base preferably includes the following steps: purifying the obtained medium-chain RNA transcription product, reverse transcribing the purified medium-chain RNA transcription product using reverse transcriptase to obtain a reverse transcription PCR product, performing Sanger sequencing on the reverse transcription PCR product, and using the feature of the sudden termination of the original sequencing signal of TPT3 in Sanger sequencing to judge the fidelity of the m3T non-natural base medium-chain RNA transcription product.

[0058] In the present invention, the evaluation and analysis method also includes a universal analysis of the in vitro transcription sequence containing the m3T non-natural base. The present invention found through sequence universality analysis that the m3T nucleoside transcription has sequence universality, and all 4096 possible sequence combinations were read in three random sequence environments upstream and downstream. By analyzing the upstream and downstream nucleoside combinations of non-natural base sites, the 5'-NNNXTAN-3' sequence combination with the most transcriptional advantage was found, and the 5'-GGNXNNN-3' sequence combination that may affect the transcription efficiency was also found. The above results are conducive to guiding the design of template sequences with higher transcription efficiency during the site-specific transcription and modification of m3T nucleoside RNA, or evaluating the feasibility of transcription under a specific sequence environment, and provide a detailed basis for the site-specific transcription of m3T nucleoside RNA.

[0059] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0060] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all commercially available products unless otherwise specified. In the following specific examples, T7 RNA polymerase, NTPs, 10× Transcription Buffer, RNase inhibitor, inorganic pyrophosphatase, and DNase I were purchased from Shanghai Shenggong Biological, enzyme-free sterile water was purchased from solarbio, and YeaRed nucleic acid dye, PCR Master Mix was purchased from Yisheng Biotechnology, and reverse transcriptase XL (Avian Myeloblastosis virus) and reverse transcriptase M (Moloney Murine Leukemia Virus) were purchased from Takara. All required primers were synthesized by Shanghai Sangon Biotechnology using solid phase synthesis method.

[0061] Example 1

[0062] An in vitro transcription method containing m3T non-natural base, the in vitro transcription method of short-chain RNA containing m3T non-natural base specifically comprises the following steps:

[0063] 1. Short RNA transcription

[0064] (1) Preparation of double-stranded DNA oligonucleotides

[0065] The transcription template containing TPT3 base obtained by solid phase synthesis was dissolved in enzyme-free sterile water, and equal amounts of the transcription template and T7 promoter were placed in 1× transcription buffer. The above reaction system was placed in a thermal cycler, denatured at 95°C for 2 minutes, then cooled to 25°C over 10 minutes, and maintained at 25°C for 10 minutes to allow the T7 promoter and the transcription template to anneal to form 25 μM double-stranded transcription template DNA, which was stored at 4°C for later use.

[0066] Transcription template sequence: CACTNCTCGGGATTCCCTATAGTGAGTCGTATTAT (SEQ ID NO. 1) (5'→3'); the 5th position of the transcription template sequence is N, which represents the non-natural base TPT3, that is, CACT / TPT3 / CTCGGGATTCCCTATAGTGAGTCGTATTAT.

[0067] T7 promoter sequence: ATAATACGACTCACTATAGGG (SEQ ID NO. 2) (5'→3').

[0068] (2) In vitro transcription reaction

[0069] The in vitro transcription reaction solution was prepared as shown in Table 1. The 10×TranscriptionBuffer contained spermidine, which was easy to form a complex with nucleic acid molecules to produce precipitation and cause the loss of transcription template DNA. Therefore, the DNA template should be added to the reaction system last and mixed immediately. The in vitro transcription reaction solution was placed in a thermal cycler at 37°C for 6 hours.

[0070] Table 1 In vitro transcription reaction solution components

[0071]

[0072]

[0073] (3) Nuclease treatment of transcription DNA template

[0074] After the above transcription reaction was completed, 10 U of RNase-free DNase I was added to the reaction system, and the reaction was continued at 37°C for 2 hours to digest the transcription template DNA.

[0075] (4) Transcription product detection and confirmation

[0076] After the reaction, the reaction system was placed in a vacuum concentrator to evaporate the water, and the residue was redissolved in 4 μL 1× single-stranded loading buffer. The mixture was denatured at 95°C for 3 minutes and immediately placed on ice. The mixture was electrophoresed on a 15% denaturing polyacrylamide gel containing 8 M urea. After the electrophoresis, the gel was stained with 1× YeaRed nucleic acid dye for 10 minutes and imaged and analyzed using a WD-9413B gel imaging analyzer.

[0077] 2. Purification of RNA transcripts

[0078] After the transcription product was detected by 15% denaturing polyacrylamide gel electrophoresis containing 8M urea, it was stained with 1×YeaRed nucleic acid dye for 10 minutes, developed with 302nm ultraviolet light, and the target band was quickly separated using an enzyme-free scalpel and transferred to a 1.5mL sterile, enzyme-free microcentrifuge tube. Use a sterile enzyme-free pipette tip to break the gel block in the tube, estimate the gel volume, add 2 to 3 times the volume of the gel, and incubate at 37°C for 2 hours, using a vortex mixer to shake from time to time. After the incubation is completed, carefully aspirate the supernatant, which is the gel eluate containing RNA, and store it at 4°C. The incubation was repeated 3 times, and the total extraction time was not less than 6 hours. The three eluates were combined, filtered with a 0.22μM sterile filter membrane to remove solid impurities, and then placed in a vacuum concentrator to concentrate to an appropriate volume (preferably without urea crystals). Add 1 / 10 volume of 5M ammonium acetate aqueous solution to make the final concentration of ammonium acetate 0.5M, mix gently, and immediately add 2.5 times the volume of -20℃ pre-cooled anhydrous ethanol, and place it in a -20℃ environment overnight. The next day, centrifuge at 12000 rpm for 30 minutes at 4℃, and carefully discard the supernatant. Wash the precipitate twice with -20℃ 75% ethanol, centrifuge at 12000 rpm for 10 minutes at 4℃, and carefully discard the supernatant. Place the precipitate in an enzyme-free environment for several minutes. After the ethanol is completely evaporated, re-dissolve the precipitate with sterile enzyme-free water to obtain a pure aqueous solution of RNA product, quantify it with NanoDropTM OneC, and use it for subsequent operations, or store it at -80℃.

[0079] Example 2

[0080] A method for evaluating the fidelity of short-chain RNA transcription products containing m3T unnatural bases, the specific steps are as follows:

[0081] (1) Nucleoside composition analysis

[0082] Take 1 μg of the purified m3T short-chain RNA product, add 1 μL of nucleic acid digestion premix, add 2 μL of 10× nucleic acid digestion reaction buffer, and adjust the final reaction volume to 20 μL with enzyme-free water. The reaction system was placed in a thermal cycler and digested at 37°C for 1 hour. After 1 hour, the RNA product was digested into single nucleosides. The reaction product was analyzed by high-performance liquid chromatography using an analytical C18 reversed phase chromatography column (4.6×250mm). The chromatographic conditions were as follows:

[0083] Flow rate: 1mL / min.

[0084] Elution gradient: 0.1 M TEAB combined with acetonitrile gradient, 0-40 min: 0 to 20%, 40-50 min: 20% to 80%, 50-51 min: 80% to 0%, 51-59 min: 0%.

[0085] Detection wavelength: 268nm (m3T).

[0086] Due to the different molar absorption coefficients of the five nucleosides, the response values ​​of the five nucleosides are different when detected at the same wavelength, resulting in that their peak areas cannot accurately reflect the actual content of the components to be tested. Therefore, while the samples were being tested, 0.25nmoL of A, U, G, C, m3T or TPT3 nucleoside standards were tested by liquid chromatography under the same conditions, and the single-point molar concentration correction method was used to calibrate and normalize the peak areas of each nucleoside based on the m3T peak area, and the relative correction factor was calculated. The relative correction factor was used to calibrate the peak area of ​​each nucleoside component in the RNA digestion product to the peak area of ​​the standard substance with the same mass. The proportion of each nucleoside component in the RNA digestion product was calculated based on the corrected peak area of ​​each nucleoside component.

[0087] (2) Mass spectrometry identification of transcription products

[0088] About 10 μM × 20 μL of the purified RNA product was taken, frozen at -80°C, transported on dry ice, and handed over to Shanghai Shenggong Biotechnology Co., Ltd. for ESI-MS mass spectrometry detection. The original ESI-MS result was normalized according to the following formula to obtain the accurate molecular weight of the RNA transcript: MWRNA = mass-to-charge ratio × charge number + number of dissociated hydrogen atoms.

[0089] The theoretical molecular weight of the transcription product was calculated according to the following formula:

[0090] MWRNA = (#A×329.21)+(#G×345.21)+(#C×305.18)+(#U×306.20)+(Nnb×Wnb)-61.96+239.9 (“#” represents the number of corresponding bases, Nnb represents the number of non-natural bases, and Wnb represents the molecular weight of non-natural bases).

[0091] If the error between the mass spectrometry detected molecular weight and the theoretical molecular weight is less than 0.05%, the transcription is considered accurate, and if the error is greater than 0.05%, the transcription fidelity is considered low.

[0092] Example 3

[0093] An in vitro transcription method containing m3T non-natural base, the in vitro transcription method of medium-length RNA containing m3T non-natural base comprises the following steps:

[0094] 1. Medium-length RNA transcription

[0095] (1) PCR amplification of DNA transcription templates containing unnatural bases

[0096] The double-stranded DNA template containing the unnatural base TPT3 or m3T used for transcription was obtained by PCR amplification. 0.01 pmol of transcription template, 10 pmol of upstream primer, 10 pmol of downstream primer, 2.5 nmol of dTPT3TP, 2.5 nmol of dNaMTP and PCR MasterMix 12.5μL (containing 5nmol dNTPs) was mixed, and the reaction system was supplemented to 25μL with enzyme-free water. The primer sequence information used is shown in Table 2. The above reaction system was fully mixed for PCR amplification. The thermal cycle conditions were as follows: 95℃ denaturation for 15 seconds, 60℃ annealing for 15 seconds, 68℃ extension for 3 minutes, a total of 15 cycles, and a final extension of 5 minutes. After the reaction was completed, 1.5% agarose gel detection was performed. The PCR product was extracted and purified using a column DNA gel extraction kit and quantified by NanoDropTM OneC. 0.5ng of PCR product was taken for secondary amplification using sequencing primers FendT-F and FendT-R. The reaction system and thermal cycle conditions were the same as above. The amplified product was detected and purified by 1.5% agarose gel for Sanger sequencing to evaluate the fidelity of non-natural bases during PCR. The remaining amplified products were placed in a vacuum concentrator to evaporate the water, and redissolved with sterile enzyme-free water under sterile conditions to make an aqueous solution with a concentration of 1 μg / μL. The solution was stored at -20°C for future use and used for in vitro transcription after confirmation by Sanger sequencing.

[0097] The first N in NACACAGGAAACAGCTATGACCCGGGTTATTACATGCGCTAG (SEQ ID NO. 3) in Table 2 represents "Cm", which is a methylated cytosine, i.e.

[0098] / Cm / ACACAGGAAACAGCTATGACCCGGGTTATTACATGCGCTAG;

[0099] The 40th position in GGGTTATTACATGCGCTAGCACTTGGAATTCACAACCGGNATCCCGAGGAAA CCATAGTAAATCTCCTTCTTAAAGTTAAGCTTAACCC (SEQ ID NO.5) is a non-natural base TPT3, i.e.

[0100] GGGTTATTACATGCGCTAGCACTTGGAATTCACAACCGG / TPT3 / ATCCCGAGGAAA CCATAGTAAATCTCCTTCTTAAAGTTAAGCTTAACCC.

[0101] Table 2 Primer sequences used in Example 3

[0102]

[0103] (2) T7 RNA polymerase catalyzes the transcription of long-chain RNA in m3T

[0104] The site-directed transcription of medium-length RNA based on m3T base was completed by in vitro transcription catalyzed by T7 RNA polymerase. The transcription reaction was carried out in a 20 μL reaction system. First, 0.5 mM NTPs, 1 mM rm3TTP, 20 U RNase inhibitor, 50 U T7 RNA polymerase, 0.02 U inorganic pyrophosphatase and 10 × Transcription Buffer were mixed. Finally, 1000 ng of the double-stranded DNA template containing non-natural bases obtained in the previous step was added and mixed thoroughly. The reaction system was supplemented to 20 μL with sterile enzyme-free water. The above reaction system was placed at 37 ° C for 6 hours. After the transcription was completed, 10 U of RNase-free DNase Ι was added and reacted at 37 ° C for 2 hours to digest the DNA template. The RNA transcription product was detected with 5% denaturing polyacrylamide gel containing 8 M urea, stained with 1 × YeaRed nucleic acid dye for 10 minutes, and imaged and analyzed by WD-9413B gel imaging analyzer under 302 nm ultraviolet light.

[0105] 2. Purification of RNA transcripts

[0106] After the transcription product was detected by 15% denaturing polyacrylamide gel electrophoresis containing 8M urea, it was stained with 1×YeaRed nucleic acid dye for 10 minutes, developed with 302nm ultraviolet light, and the target band was quickly separated using an enzyme-free scalpel and transferred to a 1.5mL sterile, enzyme-free microcentrifuge tube. Use a sterile enzyme-free pipette tip to break the gel block in the tube, estimate the gel volume, add 2 to 3 times the volume of the gel, and incubate at 37°C for 2 hours, using a vortex mixer to shake from time to time. After the incubation is completed, carefully aspirate the supernatant, which is the gel eluate containing RNA, and store it at 4°C. The incubation was repeated 3 times, and the total extraction time was not less than 6 hours. The three eluates were combined, filtered with a 0.22μM sterile filter membrane to remove solid impurities, and then placed in a vacuum concentrator to concentrate to an appropriate volume (preferably without urea crystals). Add 1 / 10 volume of 5M ammonium acetate aqueous solution to make the final concentration of ammonium acetate 0.5M, mix gently, and immediately add 2.5 times the volume of -20℃ pre-cooled anhydrous ethanol, and place it in a -20℃ environment overnight. The next day, centrifuge at 12000 rpm for 30 minutes at 4℃, and carefully discard the supernatant. Wash the precipitate twice with -20℃ 75% ethanol, centrifuge at 12000 rpm for 10 minutes at 4℃, and carefully discard the supernatant. Place the precipitate in an enzyme-free environment for several minutes. After the ethanol is completely evaporated, re-dissolve the precipitate with sterile enzyme-free water to obtain a pure aqueous solution of RNA product, quantify it with NanoDropTM OneC, and use it for subsequent operations, or store it at -80℃.

[0107] Example 4

[0108] A method for evaluating the fidelity of a medium-length RNA transcription product containing an m3T unnatural base, the specific steps are as follows:

[0109] The RNA products containing m3T were reverse transcribed using commercially available reverse transcriptase XL (Avian Myeloblastosis virus) and reverse transcriptase M (MoloneyMurine Leukemia Virus) to observe whether commonly used reverse transcriptases can recognize the pairing of dTPT3TP and m3T in RNA. The reverse transcription reactions were carried out according to the manufacturer's instructions. The specific experimental details are as follows:

[0110] (1) Reverse Transcriptase XL (AMV) Take 400 ng of RNA product purified by polyacrylamide gel, 20 pmol of specific reverse transcription primer RT-Primer and 10 nmol of dNTPs and mix them thoroughly. Make up the reaction system to 12 μL with enzyme-free sterile water. Incubate the reaction system at 65°C for 5 minutes and immediately place it on ice for at least 2 minutes. Add the following components to the above reaction system on ice: 5× reverse transcription reaction buffer, RNase inhibitor 20U, reverse transcriptase XL (AMV) 5U, dTPT3TP 4nmol, and make up the total reaction system to 20 μL with sterile enzyme-free water. Reverse transcribe at 42°C for 60 minutes, extinguish at 95°C for 5 minutes, and use the reverse transcription product directly for PCR amplification detection. The negative control is the same as the experimental group except that no reverse transcriptase is added and undergoes the same experimental conditions.

[0111] The reverse transcription product of the previous step was amplified by PCR using sequencing primers RT-Seq-dT-F and RT-Seq-dT-R. The amplification reaction system was as follows: 0.5 μL of reverse transcription product, 10 pmol of RT-Seq-dT-F, 10 pmol of RT-Seq-dT-R, 2.5 nmol of dTPT3TP, 2.5 nmol of dNaMTP, PCR MasterMix 12.5μL (containing 5nmol dNTPs), the primer sequence information used is shown in Table 3. The above reaction system was placed in a thermal cycler and PCR amplification was performed according to the following thermal cycle conditions: 95℃ denaturation for 15 seconds, 60℃ annealing for 15 seconds, 68℃ extension for 3 minutes, a total of 20 cycles, and a final extension of 5 minutes. The amplified product was detected by 1.5% agarose gel, and the PCR product after reverse transcription was extracted and purified using a column agarose gel DNA extraction kit and subjected to Sanger sequencing.

[0112] (2) Reverse Transcriptase M (MLV) Take 400 ng of RNA product purified by polyacrylamide gel, 20 pmol of specific reverse transcription primer RT-Primer and 10 nmol of dNTPs and mix them thoroughly. Make up the reaction system to 12 μL with enzyme-free sterile water. Incubate the reaction system at 65°C for 5 minutes and immediately place it on ice for at least 2 minutes. Add the following components to the above reaction system on ice: 5× reverse transcription reaction buffer, RNase inhibitor 20U, reverse transcriptase M (MLV) 100U, dTPT3TP 4nmol, and make up the total reaction system to 20 μL with sterile enzyme-free water. Reverse transcribe at 42°C for 60 minutes, extinguish at 75°C for 15 minutes, and the reverse transcription product is directly used for PCR amplification detection. The negative control is the same as the experimental group except that no reverse transcriptase is added and undergoes the same experimental conditions.

[0113] The reverse transcription product of the previous step was amplified by PCR using sequencing primers RT-Seq-dT-F and RT-Seq-dT-R. The amplification reaction system was as follows: 0.5 μL of reverse transcription product, 10 pmol of RT-Seq-dT-F, 10 pmol of RT-Seq-dT-R, 2.5 nmol of dTPT3TP, 2.5 nmol of dNaMTP, PCR MasterMix 12.5μL (containing 5nmol dNTPs). The above reaction system was placed in a thermal cycler and PCR amplification was performed according to the following thermal cycle conditions: 95℃ denaturation for 15 seconds, 60℃ annealing for 15 seconds, 68℃ extension for 3 minutes, a total of 20 cycles, and a final extension of 5 minutes. The amplified product was detected by 1.5% agarose gel, and the PCR product after reverse transcription was extracted and purified using a column agarose gel DNA extraction kit and subjected to Sanger sequencing.

[0114] Table 3 Primer sequences used in Example 4

[0115]

[0116] Example 5

[0117] Universal analysis of m3T unnatural base in vitro RNA transcription sequence

[0118] (1) T7 RNA polymerase catalyzes transcription, reverse transcription, and cDNA amplification in the m3T random sequence environment

[0119] Solid phase synthesis of a transcription template with random sequences at three base sites upstream and downstream of the non-natural base site. The transcription template was amplified and transcribed according to the method described in Example 3, and reverse transcribed according to the method described in Example 4, except that 2 times T7 RNA polymerase was used in the transcription step. Part of the cDNA product was taken and PCR amplified and Sanger sequenced in the presence of dTPT3TP and dNaMTP using sequencing primers RT-Seq-dT-F and RT-Seq-dT-R. The components of the PCR reaction system and the thermal cycling conditions were the same as those of the cDNA amplification in Example 4. The remaining cDNA products were PCR amplified under the same conditions using RT-Seq-F and RT-Seq-R as primers, detected by 1.5% agarose gel, and extracted and purified by a column agarose gel DNA extraction kit to obtain cDNA amplicons, which were stored at 4°C for use, and used in the next step after cDNA Sanger sequencing was confirmed to be correct.

[0120] (2) Conversion PCR of cDNA amplicons

[0121] About 3 ng of cDNA amplicon was taken, and the sequencing primers RT-Seq-dT-F and RT-Seq-dT-R were used to perform replacement PCR amplification only in the presence of dNaMTP. The number of PCR cycles was 36 cycles, and the other reaction components and thermal cycling conditions were the same as the PCR conditions in Example 4. At the same time, PCR amplification was performed in the presence of both dTPT3TP and dNaMTP as a control, and Sanger sequencing was performed. Due to the sequence preference of dNaM itself, the TPT3 base in cDNA can be converted to a natural A base in the absence of its specific paired base dTPT3, and dNaM itself exhibits the characteristics of a natural T base, so that the Sanger sequencing signal of the cDNA amplicon replacing the PCR product no longer decays, so as to be compatible with the next generation sequencing. After Sanger sequencing confirmed that there were no errors, RT-Seq-F and RT-Seq-R primers were used to perform replacement PCR on the cDNA amplicon. The amplified product was detected by 1.5% agarose gel and extracted and purified by a column agarose gel DNA extraction kit to obtain the cDNA amplicon replacement PCR product for library construction and high-throughput sequencing.

[0122] (3) Sequencing library construction and high-throughput sequencing

[0123] The PCR product band specificity was replaced by 2% agarose gel detection, and the QubitTM dsDNA HS Assay Kit and The fluorometer accurately quantifies the displacement PCR product to determine the amount of DNA that should be added to the PCR reaction.

[0124] Configure the following PCR system for library construction: Robust PCR Master Mix 15μL, 10μM upstream primer 1μL, 10μM search primer 1μL, replacement PCR product 20ng, enzyme-free water to make up the reaction system to 30μL. The above PCR reaction system was fully mixed, and the above reaction system was placed in a thermal cycler. PCR amplification was performed according to the following thermal cycle conditions: 95℃ pre-denaturation for 3 minutes, (94℃ denaturation for 20 seconds, 55℃ annealing for 20 seconds, 72℃ extension for 30 seconds) × 5 cycles, and finally extended for 5 minutes. After the library construction was completed, the library size and band specificity were detected by 2% agarose gel, and the product was purified and recovered using AMPure XP magnetic beads. The purified product was sequenced using a NovaSeq 6000 / MiSeq sequencer (Illumina, San Diego, CA).

[0125] (4) Data quality control

[0126] After high-throughput sequencing data is completed, data quality is controlled:

[0127] Cutadapt (v1.2.1) software was used to excise the adapter sequence with default parameters;

[0128] ② Pinseq-lite (v0.19.5) software was used to remove low-quality bases and sequences using the sliding window method (minimum Q value 20, window value 5, length threshold 50);

[0129] ③ Use usearch (v11.0.667) software in de novo mode to remove chimeric sequences;

[0130] ④ Use the python program written by Shanghai Sangon Biotechnology Co., Ltd. to match the target sequence and perform frequency statistics to obtain high-throughput sequencing pure data for analyzing the universality of upstream and downstream sequences of non-natural base sites.

[0131] (5) Sequence data analysis

[0132] Sequence information was extracted from the deep sequencing data according to the following standard: 5'-TCCCG(NNNTNNN)CGT-3', where N represents a random sequence, T represents the original site of m3T in RNA, which is converted to the NaM site in cDNA during reverse transcription and replaced by replacement PCR. The total number of reads of the extracted sequence is the "total read depth". All sequences containing 5'-TCCCG(NNNTNNN)CGT-3' were retained for further analysis. For the convenience of analyzing the distribution of single nucleosides, the percentage of total read depth was used. The analysis of single nucleoside combinations, dinucleoside combinations, and trinucleoside combinations was normalized to the average number of reads per million. The percentage of each natural base composition at all N sites and the number of reads per million for all sequence combinations were counted to analyze the universality of the sequence.

[0133] Example 6

[0134] In this example, the short-chain RNA in vitro transcription method of Example 1 was used to obtain a short-chain RNA transcription product containing the m3T non-natural base, and the fidelity of the transcription product was evaluated according to the method of Example 2. The specific steps are as follows:

[0135] 1. Polyacrylamide gel detection of transcription products

[0136] In this example, a 35-mer DNA template containing TPT3 at a specific site was used as a transcription template to observe the specificity of rm3TTP incorporation into RNA. A natural DNA template with A at the same site was used as a control, and the transcription product was detected by 15% denaturing polyacrylamide gel containing 8M urea.

[0137] The results showed that when Tr-TPT3 template was used for transcription, if rm3TTP was not added to the reaction system, a small amount of 17-mer full-length RNA product was produced due to natural nucleoside triphosphate mismatch, but the transcription reaction mostly stagnated at the upstream of TPT3 in the DNA template to produce 12-mer interrupted RNA products. When an appropriate amount of rm3TTP was added to the reaction system, the 17-mer full-length RNA product increased significantly due to the pairing of rm3TTP with TPT3 in the template, and the 12-mer interrupted RNA product decreased significantly ( Figure 2 ). Although its transcription efficiency is lower than that of natural DNA templates, it is still efficient enough to produce RNA molecules sufficient for characterization. The above results suggest that T7 RNA polymerase can catalyze the specific pairing of rm3TTP with TPT3 in DNA templates and promote the effective extension of RNA molecules.

[0138] 2. Analysis of nucleotide composition of transcription products

[0139] To confirm the specificity of rm3TTP transcription, this example used Tr-TPT3 template to perform large-scale transcription reaction. The HPLC analysis results of single nucleoside composition showed that the rm3T nucleoside detection peak was found in the RNA digestion product, and its retention time was the same as that of the rm3T nucleoside standard ( Figure 3 To further confirm the nucleoside component, the eluate at the corresponding retention time was collected, appropriately concentrated, and then the molecular weight was confirmed by MALDI-TOF MS method, and it was identified as rm3T nucleoside ( Figure 4 ).

[0140] In order to accurately evaluate the composition ratio of each nucleoside component, the single-point molar concentration correction method was used to calibrate the peak areas of all five nucleosides, and the rm3T nucleoside was used as the benchmark for normalization. It was found that the composition ratio of each nucleoside in the RNA transcription product was C:U:G:A:rm3T=3.03:2.01:6.90:4.04:1.00, which was consistent with the expected RNA product sequence (nucleoside composition ratio is shown in Table 4).

[0141] Table 4 Nucleoside composition of T7 RNA polymerase transcription products

[0142] C U G A 3T Theoretical ratio 3 2 7 4 1 Detection ratio 3.03±0.01 2.01±0.02 6.90±0.19 4.04±0.07 1.00

[0143] 3. Mass spectrometry detection of molecular weight of transcription products

[0144] To further confirm the transcription specificity, in addition to analyzing the nucleotide composition of the transcription products, the RNA transcription products were detected by ESI-TOF mass spectrometry ( Figure 5), the theoretical molecular weight was 5773.3, the detected molecular weight was 5774.8, and the error was less than 0.05%, indicating that the RNA transcription of rm3TTP catalyzed by T7 RNA polymerase had high accuracy and specificity.

[0145] Example 7

[0146] In this example, the medium-chain RNA in vitro transcription method of Example 3 was used to obtain a medium-chain RNA transcription product containing the m3T non-natural base, and the fidelity of the transcription product was evaluated according to the method of Example 4. The specific steps are as follows:

[0147] 1. Transcription template amplification

[0148] The double-stranded DNA template required for transcription was obtained by amplifying a single-stranded DNA template containing TPT3 in the presence of dTPT3TP and dNaMTP, and the obtained template was subjected to Sanger sequencing. The sequencing results show that in the experimental group, dTPT3TP and dNaMTP were added to the amplification reaction system, and the original signal of the DNA double-stranded template Sanger sequencing, both the positive and antisense chains, suddenly terminated at the non-natural base site. In the control group, dTPT3TP and dNaMTP were not added to the amplification reaction, and the original sequencing signal did not suddenly terminate or decay due to the mismatch of natural bases. This suggests that the NaM-TPT3 base pair has high fidelity in the DNA replication process and can be used for in vitro transcription reactions. The original peak diagram of Sanger sequencing is shown in Figure 6 .

[0149] 2. Gel detection of RNA transcription products

[0150] Using the TPT3-containing double-stranded DNA template obtained in the previous step, large-scale transcription was performed in the presence of rm3TTP. After the transcription was completed, three transcription systems were randomly selected for denaturing polyacrylamide gel detection. After gel imaging, clear full-length RNA product-specific bands were visible ( Figure 7 ), the RNA product produced was significantly increased compared to the DNA template. The RNA product system was purified by polyacrylamide gel for subsequent operations.

[0151] 3. Reverse transcription of RNA products and cDNA sequencing

[0152] In the previous step, medium-chain RNA transcription products containing m3T at specific sites have been obtained. However, compared with short-chain RNA, the fidelity of m3T in medium-chain RNA cannot be accurately evaluated using nucleoside composition analysis and mass spectrometry identification. Therefore, a reverse transcription sequencing and evaluation method for m3T in medium-chain RNA was established using commercial reverse transcriptase.

[0153] (1) Reverse transcriptase XL (AMV): The RNA obtained in the previous step was reverse transcribed using reverse transcriptase XL (AMV) and specific reverse transcription primers in the presence of dTPT3P to obtain a cDNA product containing TPT3 at the site corresponding to m3T in the RNA. In order to eliminate the interference of residual DNA transcription template in the RNA product, an equal amount of RNA product was subjected to the same reaction process as a control except that reverse transcriptase was not added. The reaction system was directly PCR amplified using sequencing primers on cDNA (sense chain) in the presence of dTPT3TP and dNaMTP without purification. The cDNA amplification product was detected by 1.5% agarose gel. The results showed that reverse transcriptase XL (AMV) can use RNA products to produce cDNA. After amplification, a specific amplification band was generated at a size of 250 bp. Lane 1 is the amplification of the RNA reverse transcription product obtained in the presence of rm3TTP, and lane 3 is the amplification of the RNA reverse transcription product obtained in the absence of rm3TTP. In the control group (lane 3 and lane 4), there was no specific amplification band at the 250 bp position, and only primer dimers were observed, which ruled out the interference of residual DNA transcription template in the RNA product. Figure 8 .

[0154] The cDNA amplification products were extracted and purified using a column agarose gel DNA extraction kit and then used for Sanger sequencing. The sequencing results showed that the Sanger sequencing raw signal of the cDNA amplification products of RNA obtained under the condition of rm3TTP suddenly terminated at the site corresponding to m3T in RNA. However, the Sanger sequencing raw signal of the cDNA amplification products of RNA obtained under the condition of rm3TTP deficiency did not observe a sudden termination and obvious attenuation of the sequencing signal at the corresponding site ( Fig. 9 ). The above results suggest that reverse transcriptase XL (AMV) can recognize dTPT3TP and pair with m3T in RNA to form m3T-TPT3 base pairs, converting m3T in RNA into TPT3 in cDNA, and then into NaM-TPT3 base pairs in double-stranded DNA.

[0155] (2) In addition to using reverse transcriptase XL (AMV) for reverse transcription sequencing, we also investigated whether reverse transcriptase M (MLV) could reverse transcribe the RNA obtained in the previous step in the presence of dTPT3 to obtain a cDNA product containing TPT3 at the site corresponding to m3T in RNA. When using reverse transcriptase M (MLV) for reverse transcription, the control RNA only underwent the same reaction conditions and process but no reverse transcriptase was added to the reaction system to eliminate the interference of residual DNA transcription template in the RNA product. The reaction system directly used sequencing primers to PCR amplify cDNA (sense chain) in the presence of dTPT3TP and dNaMTP. The cDNA amplification product was detected by 1.5% agarose gel. The results showed that reverse transcriptase M (MLV) could use RNA products to produce cDNA, and after amplification, a specific amplification band was generated at a size of 250 bp. Lane 1 was the amplification of the RNA reverse transcription product obtained in the presence of rm3TTP, and lane 3 was the amplification of the RNA reverse transcription product obtained in the absence of rm3TTP. In the control group (lane 3 and lane 4), there was no specific amplification band at the 250 bp position, and only primer dimers were observed, which ruled out the interference of residual DNA transcription template in the RNA product. Fig.10 .

[0156] The cDNA amplification product was purified and used for Sanger sequencing verification. Similar to the results of reverse transcriptase XL (AMV), reverse transcriptase M (MLV) can catalyze the pairing of dTPT3TP with m3T in RNA to form m3T-TPT3 base pairs, generating cDNA products containing TPT3. cDNA was amplified in the presence of dTPT3TP and dNaMTP, converting m3T in RNA into NaM-TPT3 base pairs in the DNA double strand, causing the Sanger sequencing raw signal of the cDNA amplification product to decay and terminate at the site corresponding to m3T in RNA. However, the Sanger sequencing raw signal of the cDNA amplification product of RNA obtained under the condition of rm3TTP deficiency did not observe a sudden termination and obvious decay of the sequencing signal at the corresponding site ( Fig.11 ).

[0157] Example 8

[0158] This example analyzes the universality of the m3T unnatural base in vitro RNA transcription sequence according to the steps in Example 5, and the specific steps are as follows:

[0159] 1. Analysis of transcription in the context of random m3T nucleoside sequences

[0160] (1) DNA template amplification

[0161] In order to observe the sequence universality of m3T transcription in RNA, a single-stranded DNA template (5'-NNNXNNN-3') with three random bases upstream and downstream of the TPT3 site was designed (X represents a non-natural base, and N represents a random sequence). This template was amplified in the presence of dTPT3TP and dNaMTP to obtain a double-stranded DNA template with a random sequence environment. The resulting template was amplified by sequencing primers and Sanger sequenced to verify the fidelity of the NaM-TPT3 base pair in the DNA double-stranded template. The sequencing results show that in the experimental group, dTPT3TP and dNaMTP were added to the amplification reaction system, and the original signal of the DNA double-stranded template Sanger sequencing, both the positive and antisense chains, suddenly terminated at the non-natural base site. In the control group, dTPT3TP and dNaMTP were not added to the amplification reaction, and the original sequencing signal did not suddenly terminate or decay due to the mismatch of the natural base. This suggests that the NaM-TPT3 base pair has high fidelity in the DNA replication process and can be used for in vitro transcription reactions. The original peak diagram of Sanger sequencing is shown in Fig.12 .

[0162] (2) m3T nucleotide random sequence environmental transcription

[0163] Large-scale transcription was performed under the conditions of a final concentration of T7 RNA polymerase of 5 U / μL, a transcription temperature of 37°C, a transcription time of 6 hours, and a final concentration of rm3TTP of 1 mM. The transcription products were gel-detected and purified as described above for reverse transcription verification and other subsequent operations. When used for reverse transcription sequencing, the RNA obtained without adding rm3TTP was used as a control. The transcription products were analyzed by polyacrylamide gel electrophoresis ( Fig.13 ).

[0164] 2. Reverse transcription of RNA containing random sequence of m3T nucleoside

[0165] The random sequence RNA containing m3T nucleoside purified in the previous step was reverse transcribed to convert m3T in RNA into TPT3 in cDNA. The cDNA product was verified by PCR amplification. The results showed that both reverse transcriptase XL (AMV) and reverse transcriptase M (MLV) could reverse transcribe random sequence RNA into cDNA. After amplification, the target band appeared at the 250bp position. No suspicious bands were observed in the control group without adding reverse transcriptase, eliminating the interference of residual DNA template. Representative gel images are shown in Fig.14 .

[0166] The cDNA amplification products were verified by Sanger sequencing. The results showed that the original signal of the cDNA amplicon Sanger sequencing of RNA obtained in the presence of rm3TTP suddenly terminated at the non-natural base site. However, the original signal of the cDNA amplicon Sanger sequencing of RNA obtained in the absence of rm3TTP did not suddenly terminate. This suggests that the RNA transcription of m3T nucleoside still maintains high fidelity in a random sequence environment. The sequencing results are shown in Fig.15 , Fig.16 .

[0167] 3. cDNA amplicon replaces PCR

[0168] cDNA amplicon sequencing has confirmed that m3T can be transcribed into RNA with high fidelity in a random sequence environment, but the corresponding site of its cDNA amplicon is converted into a NaM-TPT3 base pair. Due to the orthogonality of the NaM-TPT3 base pair, the sequence after the non-natural base site of the cDNA amplicon cannot be replicated on the universal sequencing platform, so it is not directly compatible with the high-throughput sequencing platform and cannot be analyzed for sequence universality. Therefore, the cDNA amplicon is only amplified by replacement PCR using dNaMTP, and the NaM-TPT3 base pair is replaced with a TA base pair by using the property that NaM mainly mismatches with the natural A base to be compatible with the universal sequencing platform. According to the above results, both reverse transcriptase M (MLV) and reverse transcriptase XL (AMV) can effectively recognize the pairing of dTPT3TP with m3T in RNA and convert m3T in RNA into TPT3 in cDNA. Therefore, in this step, only the cDNA obtained by reverse transcriptase M (MLV) is selected for replacement PCR amplification. The Sanger sequencing results showed that the cDNA amplicon was re-amplified under the conditions where both dTPT3TP and dNaMTP were present, and the original signal and normalized signal of the Sanger sequencing results were interrupted at the non-natural base site. However, when the cDNA was amplified by conversion PCR only in the presence of dNaMTP, NaM lacked its specific pairing base and mainly mismatched with the natural A base. After multiple rounds of PCR amplification, the NaM-TPT3 base pairs in the cDNA amplicon were gradually converted to TA base pairs. The site in the positive chain was the NaM base, which was converted to the T base after conversion PCR, and the site in the antisense chain was the TPT3 base, which was converted to the A base after conversion PCR, which was consistent with the expected results. The normalized map of the positive chain Sanger sequencing is shown in Fig.17 , the original Sanger sequencing map is not shown in the article.

[0169] 4. Deep sequencing and sequence universality analysis

[0170] (1) General description

[0171] Sequence extraction was performed according to the standard of 5’-TCCCG(N-3N-2N-1T0N1N2N3)CGT-3’ from the purified deep sequencing data of the sense strand. An average of 1.45×106 readings were obtained from three independent replicates. A total of 4,096 unique read-through sequence combinations were obtained from the three independent replicates, covering all possible sequence combinations. The median read frequency of all sequence combinations was 296 times, the minimum read frequency was 5 times (5’-GGTTATY-3’, Y = G, T), and the maximum read frequency was 1,981 times (5’-ACGTTAA-3’). Frequency distribution analysis showed that the read frequencies of each sequence combination were positively skewed around the median. The read frequencies of some sequence combinations were less than 100 or greater than 1,000, indicating that m3T nucleoside transcription had abnormal preferences in a few sequence environments ( Fig.18 ). This suggests that although m3T nucleoside RNA site-directed transcription has sequence preferences to a certain extent, it still has good generality.

[0172] (2) Nucleoside distribution at each random site

[0173] Subsequently, the mononucleoside distribution at three random sites upstream and downstream of the unnatural base was statistically analyzed. It was found that there was an obvious sequence preference at the +1 site downstream of the unnatural base. The proportion of T base in its nucleoside composition reached 42.95%, indicating that m3T nucleoside had an obvious transcriptional advantage in the sequence environment of 5’-NNNXTNN-3’ (X represents the unnatural base, N represents the random sequence). All 143 sequence combinations with a read frequency > 1,000 times had the combination characteristics of 5’-NNNXTNN-3’. The proportions of other bases at the +1 site were A 15.41% < G 18.89% < C 22.75%, indicating that the RNA transcription ability of m3T nucleoside was weak in the sequence environment of 5’-NNNXANN-3’. For example, the proportion of sequence combinations with the combination characteristics of 5’-NNNXANN-3’ among those with a read count < 100 times reached 50.34%. Among the single-base distributions at the +2 site downstream of the unnatural base, the proportion of A base was 32.54%, showing a weak sequence preference. The proportions of other bases were distributed between 21.51% and 23.34%, with no obvious difference. The proportions of each base at the downstream +3 site were distributed between 22.38% and 27.32%, with no sequence preference.

[0174] The nucleoside proportions at the -1 site upstream of the unnatural base site were A 20.56%, T 23.23%, G 23.22%, and C 32.99%, showing a weak sequence preference. The proportions of each nucleoside at the -2 site were between 20.39% and 27.96%, with no obvious sequence preference. More peculiarly, the nucleoside proportion distribution at the upstream -3 site was quite different, between 17.64% and 32.00%.

[0175] From the above results, it can be seen that m3T nucleosides do have a certain degree of sequence dependence in the RNA transcription process. The sequence environment of the downstream +1 site of the non-natural base site has the greatest impact on the RNA transcription performance of m3T nucleosides. The sequence environment of the downstream +2 site and the upstream -1 site also has a certain impact on its transcription activity, while the distal sequence has no obvious effect on its transcription activity. This suggests that the influence of the sequence environment of the downstream +1 site should be fully considered in the future application of RNA transcription technology based on m3T. The distribution statistics of nucleosides at each random site and the sequence identification diagram are shown in Fig.19 .

[0176] (3) Analysis of single nucleoside combinations upstream and downstream of non-natural base sites (5'-NXN-3')

[0177] In order to obtain more detailed sequence universality information of m3T transcription, the single nucleotide combinations upstream and downstream of the non-natural base site were further analyzed based on the analysis of single nucleotide distribution. After analysis, it was found that the total read frequencies of the 16 combinations were quite different, among which the 5'-NNGXANN-3' combination accounted for the lowest proportion, with 2.22×104 reads per million. The proportions of other combinations such as 5'-NNGXGNN-3', 5'-NNAXANN-3' and 5'-NNTXANN-3' were also low, with 2.92×104 reads per million, respectively. 4 , 3.14×10 4 and 3.45×10 4 , indicating that the RNA transcription performance of m3T is low in this sequence environment, which may lead to its low efficiency in the transcription process. The read frequencies of 5'-NNGXTNN-3', 5'-NNCXTNN-3', 5'-NNTXTNN-3' and 5'-NNAXTNN-3' were the highest, reaching 13.86×10 5 , 11.69×10 5 ,9.62×10 4 and 7.78×10 4 , suggesting that m3T can achieve higher transcription efficiency in the context of 5'-NNNXTNN-3' sequence. The heat map of the read frequency of single nucleotide combinations is shown in Fig. 20 .

[0178] (4) Analysis of dinucleoside combinations upstream and downstream of non-natural base sites (5'-NNXNN-3')

[0179] Based on the analysis of single nucleoside combinations, the upstream and downstream dinucleoside combinations of non-natural bases were further analyzed. The analysis found that among the 5'-NNGXTNN-3' combination with the greatest transcriptional advantage, the 5'-NNGXTAN-3' sequence combination obtained a higher read-through frequency, while the read-through frequencies of the 5'-NNGXTTN-3', 5'-NNGXTGN-3' and 5'-NNGXTCN-3' sequence combinations decreased in turn. Among the 5'-NNGXTAN-3' sequence combinations, 5'-NCGXTAN-3' (1.64×104), 5'-NGGXTAN-3' (1.15×104), 5'-NTGXTAN-3' (1.42×104) and 5'-NAGXTAN-3' (1.18×104) all obtained higher read-through frequencies, suggesting that the upstream -2 site of the 5'-NNGXTAN-3' sequence combination would not have a significant effect on the transcription efficiency of m3T. In addition, the 5'-NNCXTAN-3' sequence combination form 5'-NCCXTAN-3' (1.36×10 4 )、5'-NACXTAN-3'(1.19×10 4 )、5'-NTCXTAN-3'(1.02×10 4 ) and 5'-NGCXTAN-3'(0.95×10 4 ) also achieved considerable read-through frequency.

[0180] In the 5'-NNGXANN-3' sequence combination with lower read-through efficiency, its read-through frequency is low regardless of the base distribution at the upstream -2 site. Although the read-through efficiency of 5'-NNAXANN-3' and 5'-NNTXANN-3' combinations is improved, it is still lower than other sequence combinations. The read-through frequency of the 5'-NNCXANN-3' sequence combination is significantly improved regardless of the nucleotide distribution at the upstream -2 site. In addition, the 5'-NNGXGNN-3' sequence combination is similar to the 5'-NNGXANN-3' sequence combination. No matter what base distribution is at the upstream-2 site, its read-through frequency is low. However, the 5'-NNAXGNN-3', 5'-NNTXGNN-3' and 5'-NNCXGNN-3' sequence combinations show obvious improvement regardless of the base distribution at the upstream-2 site. In particular, the 5'-NNCXGNN-3' sequence combination can reach the read-through level of the 5'-NNGXTAN-3' sequence combination with different combinations of bases at the upstream-2 site. The read-through frequency heat map of the dinucleoside combination is shown in Fig.21 .

[0181] (5) Analysis of the upstream and downstream trinucleoside combination of the non-natural base site (5'-NNNXNNN-3')

[0182] Finally, the three nucleoside combinations upstream and downstream of the non-natural base site were analyzed, and it was found that in the 5'-GGNXNNN-3' sequence combination, no matter what base combination was at the downstream 1 to 3 sites, the read-through frequency was low. The more special ones were the 5'-GGCXTAN-3' (N = A, T, C) and 5'-GGCXTTN-3' (N = T, C) combinations, which had higher read-through frequencies. This suggests that the GG combination at the N-3N-2 site upstream of the non-natural base site will have a greater impact on the transcription efficiency of m3T. In the 5'-NNNXTAN-3' sequence combination, most sequence combinations at the upstream N-3N-2N-1 site can obtain higher read-through frequencies except for the above-mentioned 5'-GGNXTAN-3'. The heat map of the read-through frequency of the three nucleoside sequence combinations can be seen in Fig. 22 .

[0183] Through sequence dependency analysis, we found that m3T nucleoside transcription has sequence universality. We read all 4096 possible sequence combinations in three random sequence environments upstream and downstream. By analyzing the upstream and downstream nucleoside combinations of non-natural base sites, we found the 5'-NNNXTAN-3' sequence combination with the greatest transcriptional advantage, and also found the 5'-GGNXNNN-3' sequence combination that may affect the transcription efficiency. The above results are helpful to guide the design of template sequences with higher transcription efficiency during the site-specific transcription and modification of m3T nucleoside RNA, or to evaluate the feasibility of transcription in a specific sequence environment, and provide a detailed basis for the site-specific transcription of m3T nucleoside RNA.

[0184] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An in vitro transcription method containing m3T unnatural base, characterized in that: The in vitro transcription method containing the m3T non-natural base includes an in vitro transcription method of a short-chain RNA containing the m3T non-natural base and an in vitro transcription method of a medium- and long-chain RNA containing the m3T non-natural base; The in vitro transcription method of short-chain RNA containing m3T non-natural base comprises the following steps: mixing a non-natural base transcription template containing TPT3 with a T7 promoter to obtain a double-stranded transcription template DNA; using T7 RNA polymerase to catalyze the double-stranded transcription template DNA to perform an in vitro transcription reaction, and after the transcription reaction is completed, digesting the transcription template DNA to obtain a short-chain RNA transcription product containing m3T non-natural base; The in vitro transcription method of medium-length RNA containing m3T non-natural base comprises the following steps: obtaining a double-stranded transcription template DNA containing NaM / TPT3 non-natural base pairs by PCR amplification; performing an in vitro transcription reaction on the double-stranded transcription template DNA by T7 RNA polymerase catalyzed, and after the transcription reaction is completed, digesting the transcription template DNA to obtain a medium-length RNA transcription product containing m3T non-natural bases.

2. The in vitro transcription method according to claim 1, characterized in that The reaction reagents for in vitro transcription include Transcription Buffer, NTPs, RNase inhibitor, inorganic pyrophosphatase, enzyme-free sterile water, and rm3TTP.

3. The in vitro transcription method according to claim 1, characterized in that The in vitro transcription reaction is carried out at 35-37° C. for 5-8 hours.

4. The in vitro transcription method according to claim 1, characterized in that The in vitro transcription method further comprises detecting the short-chain RNA transcription product or the medium-chain RNA transcription product using 5% denatured polyacrylamide gel containing 8M urea.

5. An RNA transcription product containing the m3T unnatural base obtained by the in vitro transcription method according to any one of claims 1 to 4.

6. A method for evaluating and analyzing RNA transcription products containing m3T unnatural bases according to claim 5, characterized in that: The evaluation and analysis methods include a fidelity evaluation method for transcription products containing m3T non-natural bases and a fidelity evaluation method for medium- and long-chain RNA transcription products containing m3T non-natural bases.

7. The evaluation and analysis method according to claim 6, characterized in that: The fidelity evaluation method of the short-chain RNA transcription product containing the m3T non-natural base comprises the following steps: purifying the obtained short-chain RNA transcription product, digesting the purified short-chain RNA transcription product into single nucleosides by using a nucleic acid digestion enzyme; detecting the digestion product by using a high performance liquid chromatography method, correcting the peak areas of A, T / U, G, C, and m3T nucleoside detection peaks by using a single-point molar concentration correction method, and calculating the nucleoside composition of the transcription product by the ratio of the peak areas of each nucleoside; and calculating the fidelity of the transcription product of the m3T nucleoside by the ratio of the actual detection ratio of m3T to the theoretical ratio.

8. The evaluation and analysis method according to claim 6, characterized in that: The fidelity evaluation method of the medium-chain RNA transcription product containing the m3T non-natural base comprises the following steps: purifying the obtained medium-chain RNA transcription product, reverse transcribing the purified medium-chain RNA transcription product using a reverse transcriptase to obtain a reverse transcription PCR product, performing Sanger sequencing on the reverse transcription PCR product, and judging the fidelity of the m3T non-natural base medium-chain RNA transcription product using the feature of the sudden termination of the original sequencing signal of TPT3 in Sanger sequencing.

9. The evaluation and analysis method according to claim 6, characterized in that: The evaluation and analysis method also includes a universal analysis of in vitro transcribed sequences containing the m3T non-natural base.

Images