Multiplex fluorescent quantitative PCR (polymerase chain reaction) kit for detecting African swine fever viruses I and II and application of multiplex fluorescent quantitative PCR kit

Abstract

The invention discloses a multiplex fluorescent quantitative PCR (polymerase chain reaction) kit for detecting African swine fever viruses I and II and application of the multiplex fluorescent quantitative PCR kit. The multiplex fluorescent quantitative PCR detection reagent comprises a first primer probe group used for detecting a B646L gene, a second primer probe group used for detecting an MGF110 gene and a third primer probe group used for detecting an EP402R gene. The multiplex fluorescent quantitative PCR detection reagent for detecting the African swine fever viruses, provided by the invention, is high in sensitivity and good in specificity, and can be used for rapidly and sensitively detecting the African swine fever viruses I and II.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a multiplex fluorescent quantitative PCR kit for detecting African swine fever virus type I and type II and an application thereof. Background Art

[0002] African swine fever (ASF) is an acute, febrile, highly contagious, filterable virus-induced disease of pigs, characterized by a short course of disease but a mortality rate of up to 100%. Clinical manifestations of sick pigs include fever, cyanosis of the skin, and obvious bleeding in the lymph nodes, kidneys, and gastrointestinal mucosa.

[0003] At present, there is no safe and effective vaccine for the prevention of ASF, nor is there an effective drug for treatment. Once it is confirmed to be ASF, culling is the only treatment method to avoid causing more pig infections. Therefore, to achieve the control of the ASF epidemic, we can only start from monitoring and early diagnosis. Since the symptoms of ASF are similar to those of many other pig diseases, it is very difficult to differentiate clinically, and laboratory diagnosis is also needed for confirmation. In addition, the incubation period of ASFV is long, and antibodies will only appear after a certain period of viral infection. Therefore, antigen detection is currently an effective means of early screening. At present, the main methods for identifying ASFV antigens are PCR, fluorescence quantitative PCR, rosette method (HAD) and direct immunofluorescence technology (DIF). Conventional PCR methods have low sensitivity and specificity; the rosette method is prone to false negatives, and some ASFV strains that do not adsorb red blood cells will be misjudged as negative; direct immunofluorescence technology (DIF) has high sensitivity and specificity, but requires high technology and fluorescence microscopy, and is time-consuming. Fluorescence quantitative PCR technology has the advantages of high sensitivity, high specificity, easy operation, safety, pollution-free, and good repeatability. Therefore, the use of fluorescence quantitative technology for early diagnosis and rapid screening of ASFV is very necessary for the prevention and control of ASF.

[0004] However, most of the currently commercialized African swine fever fluorescent quantitative PCR detection kits are PCR amplifications of a single gene, which cannot quickly and accurately monitor the occurrence of African swine fever. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes a multiplex fluorescence quantitative PCR detection reagent for detecting African swine fever virus, which can quickly and sensitively detect African swine fever virus type I and type II.

[0006] The present invention also proposes a chip for detecting African swine fever virus

[0007] The present invention also provides a kit having the above-mentioned multiple fluorescence quantitative PCR detection reagent or chip.

[0008] The present invention also provides the application of the above-mentioned fluorescent PCR detection reagent, chip or kit.

[0009] The present invention also provides a method for detecting African swine fever virus for purposes other than disease diagnosis and treatment.

[0010] The present invention also provides a system for detecting African swine fever virus.

[0011] According to one aspect of the present invention, a multiplex fluorescent quantitative PCR detection reagent for detecting African swine fever virus is proposed, wherein the multiplex fluorescent quantitative PCR detection reagent comprises a first primer probe group for detecting the B646L gene, a second primer probe group for detecting the MGF_110 gene, and a third primer probe group for detecting the EP402R gene;

[0012] In the first primer-probe set, the sequences of the primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2; the sequence of the probe is shown in SEQ ID NO: 3;

[0013] In the second primer-probe set, the sequences of the primers are shown in SEQ ID NO:4 and SEQ ID NO:5; the sequence of the probe is shown in SEQ ID NO:6;

[0014] In the third primer-probe set, the sequences of the primers are shown in SEQ ID NO:7 and SEQ ID NO:8; the sequence of the probe is shown in SEQ ID NO:9.

[0015] According to some embodiments of the present invention, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0016] According to some embodiments of the present invention, the fluorescent reporter group includes but is not limited to any one of FAM, ROX, CY5, HEX, JOE, CY3, NED, TAMRA, TAXAS RED, VIC and TET.

[0017] According to some embodiments of the present invention, the fluorescence quenching group includes but is not limited to any one of super Quenther 1, BHQ, TAMRA, MGB and DABCYL.

[0018] According to some embodiments of the present invention, the multiplex fluorescence quantitative PCR detection reagent also includes a PCR premix.

[0019] According to some embodiments of the present invention, the PCR premix includes dNTP, Mg2+ , UNG enzyme, Taq DNA polymerase, reaction buffer, and at least one of a PCR stabilizer.

[0020] According to some embodiments of the present invention, the PCR premix is ​​2×FastAmpli Premix-UNGⅣ.

[0021] In some embodiments of the present invention, the African swine fever virus includes African swine fever virus type I and type II.

[0022] According to a second aspect of the present invention, a chip for detecting African swine fever virus is proposed, wherein the chip contains a freeze-dried powder of the above-mentioned multiplex fluorescence quantitative PCR detection reagent.

[0023] According to some embodiments of the present invention, the chip is a MEMS chip.

[0024] According to a third aspect of the present invention, a kit is proposed, which contains the above-mentioned multiplex fluorescence quantitative PCR detection reagent or the above-mentioned chip for detecting African swine fever virus.

[0025] According to some embodiments of the present invention, the kit further comprises at least one of a positive control and a negative control.

[0026] According to some embodiments of the present invention, the positive control comprises a plasmid containing the African swine fever virus gene B646L, MGF_110 or EP402R.

[0027] According to some embodiments of the invention, the negative control comprises water.

[0028] In the fourth aspect of the present invention, an application of the above-mentioned multiplex fluorescent quantitative PCR detection reagent, chip or kit is proposed, and the application is an application in the preparation of a product for detecting or assisting in the detection of African swine fever virus.

[0029] According to some embodiments of the present invention, the product is selected from a kit or a chip.

[0030] In the fifth aspect of the present invention, a method for detecting African swine fever virus for non-disease diagnosis and treatment purposes is proposed, and the method comprises the following steps: using the above-mentioned multiplex fluorescent quantitative PCR detection reagent, chip or kit to detect the DNA of the sample to be tested.

[0031] According to some embodiments of the present invention, the detection is performed using fluorescent quantitative PCR.

[0032] According to some embodiments of the present invention, the reaction system of the fluorescent quantitative PCR is:

[0033] FastAmpli Premix-UNGⅣ1×;

[0034] The forward primer sequence in the first primer probe set is 80-120 nM;

[0035] The reverse primer sequence in the first primer probe set is 80-120 nM;

[0036] The probe sequence in the first primer probe set is 40-60 nM;

[0037] The forward primer sequence in the second primer probe set is 180-220 nM;

[0038] The reverse primer sequence in the second primer probe set is 180-220 nM;

[0039] The probe sequence in the second primer probe set is 80-120 nM;

[0040] The forward primer sequence in the third primer probe set is 180-220 nM;

[0041] The reverse primer sequence in the third primer probe set is 180-220 nM;

[0042] The probe sequence in the third primer probe set is 80-120 nM.

[0043] According to some embodiments of the present invention, the reaction system of the fluorescent quantitative PCR is:

[0044] FastAmpli Premix-UNGⅣ1×;

[0045] The forward primer sequence in the first primer probe set was 100 nM;

[0046] The reverse primer sequence in the first primer probe set was 100 nM;

[0047] The probe sequence in the first primer probe set was 50 nM;

[0048] The forward primer sequence in the second primer probe set was 200 nM;

[0049] The reverse primer sequence in the second primer probe set was 200 nM;

[0050] The probe sequence in the second primer probe set was 100 nM;

[0051] The forward primer sequence in the third primer probe set was 200 nM;

[0052] The reverse primer sequence in the third primer probe set was 200 nM;

[0053] The probe sequence in the third primer probe set was 100 nM.

[0054] According to some embodiments of the present invention, the reaction system of the fluorescent quantitative PCR further includes water.

[0055] The amplification program of the fluorescent quantitative PCR is: 35-39°C for 1-3min; 94-96°C for 1-3min; then enter the cycle stage: 93-96°C for 3-7s, 55-65°C for 25-35s, 35-45 cycles, and collect fluorescence data.

[0056] In some embodiments of the present invention, the amplification program of the fluorescent quantitative PCR is: 37°C for 2 min; 95°C for 2 min; then enter the cycling stage: 95°C for 5 s, 60°C for 30 s, 40 cycles, and collect fluorescence data.

[0057] In some embodiments of the present invention, after the detection, the step of statistically analyzing the Ct value of the sample and interpreting the result is also included; the result interpretation is:

[0058] Positive: The Ct value of the sample test result is ≤35 or there is an obvious exponential growth period;

[0059] Negative: The sample test result Ct value is greater than 38 or there is no Ct value.

[0060] According to a sixth aspect of the present invention, a system for detecting African swine fever virus is provided, the system comprising:

[0061] Detection module: the above-mentioned multiplex fluorescence quantitative PCR detection reagent, chip or kit performs fluorescence PCR amplification on the nucleic acid of the sample to be tested;

[0062] Analysis module: used to evaluate whether the sample to be tested contains African swine fever virus.

[0063] According to some embodiments of the present invention, at least the following beneficial effects are achieved: the multiplex fluorescent quantitative PCR detection reagent for detecting African swine fever virus provided by the present invention has high sensitivity and good specificity, and can quickly and sensitively detect African swine fever virus type I and type II. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0065] Figure 1 This is a result diagram of the primer-probe combination dosage screening of Ratio 1 in Example 3 of the present invention;

[0066] Figure 2 This is a result diagram of the primer-probe combination dosage screening of Ratio 2 in Example 3 of the present invention;

[0067] Figure 3 This is a result diagram of the primer-probe combination dosage screening of Ratio 3 in Example 3 of the present invention;

[0068] Figure 4 This is a result diagram of the primer-probe combination dosage screening of Ratio 4 in Example 3 of the present invention;

[0069] Figure 5 This is a graph showing the detection results when the annealing temperature is 56° C. in the temperature screening in Example 3 of the present invention;

[0070] Figure 6 This is a graph showing the detection results when the annealing temperature is 58° C. in the temperature screening in Example 3 of the present invention;

[0071] Figure 7 This is a graph showing the detection results when the annealing temperature is 60° C. in the temperature screening in Example 3 of the present invention;

[0072] Figure 8 This is a diagram showing the detection results of the specificity experiment in Example 5 of the present invention. DETAILED DESCRIPTION

[0073] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0074] Example 1 Multiplex Fluorescence Quantitative PCR Detection Reagent for Detecting African Swine Fever Virus

[0075] Design of primers and probes:

[0076] The present invention compares and analyzes African swine fever virus gene sequences in large quantities and performs selection. The compared genome sequences include type I virus BA71V (GenBank KP055815), type I virus Pig-HeN-ZZ-P1-2021 (GenBank MZ945536), type I virus 47-Ss-2008 (GenBank KX354450), type I virus OURT 88-3 (GenBank AM712240), type I virus Pig-SD-DY-I-2021 (GenBank MZ945537), type II virus Georgia 2007 (GenBank FR682468.2), type II virus ASFV-SY18 (GenBank MH766894.3), type II virus Pig-HLJ-2018 (GenBank MK333180), type II virus Wuhan 2019-2 (GenBank MN393477.1), recombinant virus Pig-Henan-123014-2022 (GenBank OQ504954), recombinant virus Pig-Inner Mongolia-DQDM-2022 (GenBank OQ504955), recombinant virus Pig-Jiangsu-LG-2021 (GenBank OQ504956). The B646L, MGF-110 and EP402R genes were screened. Specific primers and specific probes were designed based on the B646L, MGF-110 and EP402R genes of African swine fever in GenBank, and commissioned to be synthesized by Bio-Tech (Shanghai) Co., Ltd.

[0077] The specific primers and specific probe sequences are shown in Table 1 below.

[0078] Table 1

[0079]

[0080]

[0081] The B646L target gene fragment is shown in SEQ ID NO: 10. After the target gene fragment was connected to the pUC57 vector, the recombinant plasmid standard B646L-pUC57 was obtained by sequencing verification. The recombinant plasmid standard was also synthesized by Bio-Tech (Shanghai) Co., Ltd.

[0082] (SEQ ID NO: 10).

[0083] The target gene fragment of MGF-110-pUC57 is shown in SEQ ID NO: 11. After the target gene fragment was connected to the pUC57 vector, the recombinant plasmid standard MGF-110-pUC57 was obtained by sequencing verification.

[0084] GCAGACCAAGCATGGCTACTTGTGAACAAGTGGCTGCTCGTCAGCAAATAGC TGCTCGTCAGCAAATGGCTGCTCGTCAGCAAATGCTGCTTGTGGGTAAGCCAATAA ATGGGCCATACCCTTGAAAGGAGAATTCAG (SEQ ID NO: 11).

[0085] The target gene fragment of EP402R-pUC57 is shown in SEQ ID NO: 12. After the target gene fragment was connected to the pUC57 vector, the recombinant plasmid standard EP402R-pUC57 was obtained by sequencing verification.

[0086] TACATGCGTCCCTCAACACAACCACTCAACCCATTTCCCTTACCTAAACCGTGTCCTCCACCCAAACCATGTCCGCCACCCAAACCATGTCCTCCACCTAAACCATGTCCTTCAGCTGAATCCTATTCTCCCAAACCACTACCTAGTATCCCGCTACTACCCA ATATCCCGCCATTATCTACCCAAAATATTTCGCTTATTCACGTAGATAGAATTATTTAA (SEQ ID NO: 12).

[0087] Example 2 A multiplex fluorescence quantitative PCR detection kit for detecting African swine fever virus

[0088] The present embodiment provides a multiplex fluorescent quantitative PCR detection kit for detecting African swine fever virus, the kit containing: 2×FastAmpli Premix-UNGⅣ (FM2181-4 purchased from Zhuhai Baorui Biotechnology Co., Ltd.), the first primer probe group, the second primer probe group and the third primer probe group prepared in Example 1, a negative control substance, and a positive control substance.

[0089] The fluorescence quantitative PCR reaction solution (5 μL) system is as follows: it contains a final concentration of 1×FastAmpli Premix-UNGⅣ, a final concentration of 100 nM primers B646L-F-2 and B646L-R-2 prepared in Example 1, a final concentration of 200 nM primers MGF_110-F and MGF_110-R3 prepared in Example 1, a final concentration of 200 nM primers EP402R-F1 and EP402R-R2 prepared in Example 1, a final concentration of 50 nM B646L-P-2, 100 nM MGF_110-P, 100 nM EP402R-P probes prepared in Example 1, and the balance is water.

[0090] Positive control: recombinant plasmid standards B646L-pUC57, MGF-110-pUC57 and EP402R-pUC57.

[0091] The negative control was DEPC water.

[0092] The method of using the kit is as follows:

[0093] The above-mentioned fluorescence quantitative PCR reaction solution (5 μL) was prepared, added to a MEMS chip (Hua Chuang Core Technology (Shenzhen) Co., Ltd.), and lyophilized. The nucleic acid sample of the sample to be tested was extracted, and 5 μL of the nucleic acid sample was added to the well of the MEMS chip with lyophilized powder. The MEMS chip was placed in a fluorescence quantitative PCR instrument (Q3 Plus V2 purchased by Hua Chuang Core Technology (Shenzhen) Co., Ltd.) for amplification, and the corresponding Ct value was read by the software provided by the fluorescence quantitative PCR instrument.

[0094] The amplification parameters of the fluorescence PCR reaction were: 37°C for 2 min; 95°C for 2 min; then entering the cycling phase: 95°C for 5 sec, 60°C for 30 sec (collecting fluorescence), and 40 cycles.

[0095] The sample detection and interpretation criteria are:

[0096] Positive: The Ct value of the specimen test result is ≤35 or there is an obvious exponential growth period;

[0097] Negative: The Ct value of the specimen test result is greater than 38 or there is no Ct value;

[0098] Suspicious: The Ct value of the sample test result is within the range of 35 to 38. At this time, the sample should be tested again. If the Ct value of the repeated test result is still within the range of 35 to 38 and there is an obvious exponential growth period, it is judged as positive, otherwise it is negative.

[0099] The channels and detection results are shown in Table 2.

[0100] Table 2

[0101]

[0102] Positive control: typical S-shaped amplification curve or Ct value ≤ 35.

[0103] Negative control: Ct value > 38 or no Ct value, the line shape is a straight line or a slightly slanted line, and there is no exponential growth period.

[0104] If the above conditions are not met, the experiment will be deemed invalid and the instruments, reagents, amplification conditions, experimental operations, etc. should be checked.

[0105] Example 3 Optimization of the kit system

[0106] This example optimizes the primers, probe amounts, and annealing temperature of the fluorescent PCR reaction system in the kit.

[0107] 1. Optimization of primer and probe dosage

[0108] Compared with the fluorescent quantitative PCR reaction solution in the kit in Example 2, the only difference is that the amount of primers and probes used is different, specifically:

[0109] Ratio 1: the final concentration of the primers B646L-F-2 and B646L-R-2 prepared in Example 1 is 50 nM, the final concentration of the primers MGF_110-F and MGF_110-R3 prepared in Example 1 is 150 nM, the final concentration of the primers EP402R-F1 and EP402R-R2 prepared in Example 1 is 100 nM, the final concentrations of the probes B646L-P-2, MGF_110-P and EP402R-P prepared in Example 1 are 25 nM, 75 nM and 50 nM respectively, and the balance is water;

[0110] Ratio 2: the final concentration of the primers B646L-F-2 and B646L-R-2 prepared in Example 1 is 100 nM, the final concentration of the primers MGF_110-F and MGF_110-R3 prepared in Example 1 is 200 nM, the final concentration of the primers EP402R-F1 and EP402R-R2 prepared in Example 1 is 150 nM, the final concentrations of the probes B646L-P-2, MGF_110-P and EP402R-P prepared in Example 1 are 50 nM, 100 nM and 75 nM respectively, and the balance is water;

[0111] Ratio 3: the primers B646L-F-2 and B646L-R-2 prepared in Example 1 with a final concentration of 100 nM, the primers MGF_110-F and MGF_110-R3 prepared in Example 1 with a final concentration of 250 nM, the primers EP402R-F1 and EP402R-R2 prepared in Example 1 with a final concentration of 200 nM, the probes B646L-P-2, MGF_110-P and EP402R-P prepared in Example 1 with final concentrations of 50 nM, 125 nM and 100 nM, respectively, and the balance is water;

[0112] Ratio 4: The final concentration of the primers B646L-F-2 and B646L-R-2 prepared in Example 1 is 100 nM, the final concentration of the primers MGF_110-F and MGF_110-R3 prepared in Example 1 is 200 nM, the final concentration of the primers EP402R-F1 and EP402R-R2 prepared in Example 1 is 200 nM, the final concentrations of the probes B646L-P-2, MGF_110-P and EP402R-P prepared in Example 1 are 50 nM, 100 nM and 100 nM respectively, and the balance is water.

[0113] The templates used for the test were the recombinant plasmid standards B646L-pUC57, MGF-110-pUC57 and EP402R-pUC57. The templates were diluted in 6 gradients (concentrations were 3×10 6 copies / μL, 3×10 5copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 1 copies / μL) and made a standard curve to test the difference in amplification efficiency.

[0114] Table 3

[0115]

[0116] The results are shown in Table 3 and Figure 1-4 As shown, it can be seen that the amplification efficiency E value of the combination of B646L, MGF2, and EP402R2 in ratio 4 is between 90-110%, and R 2 All are above 0.99, which is the optimal concentration.

[0117] 2. Optimization of annealing temperature

[0118] Compared with the fluorescence PCR reaction amplification parameters in the kit in Example 2, the only difference is that the annealing temperature is different, and the annealing temperature is set to 56°C, 58°C, and 60°C for gradient testing. The templates used for the test are the recombinant plasmid standards B646L-pUC57, MGF-110-pUC57, and EP402R-pUC57. At the same time, the templates are diluted 6 times (concentration of 3×10 6 copies / μL, 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 1 copies / μL) and made a standard curve to test the difference in amplification efficiency.

[0119] Table 4

[0120]

[0121] The results are shown in Table 4 and Figure 5-7 As shown, it can be seen that the annealing temperature is best at 60°C. In order to reduce non-specific amplification, 60°C is selected as the annealing temperature.

[0122] Example 3 Sensitivity and repeatability detection

[0123] The kit prepared in Example 2 and the method for using the kit were used to perform sensitivity and repeatability tests.

[0124] 1. Sensitivity detection

[0125] Preparation of gradient DNA template: The positive controls (B646L-pUC57, MGF-110-pUC57, EP402R-pUC57) were gradiently diluted to 1 copy / μL, 2 copies / μL, 5 copies / μL, and 20 copies / μL for sensitivity testing. Each group was repeated 24 times, and the Ct value and detection rate were calculated.

[0126] The above gradient DNA template was used to perform sensitivity detection using the kit prepared in Example 2 and the method for using the kit.

[0127] Table 5

[0128]

[0129]

[0130] The results are shown in Table 5. It can be seen from Table 5 that the sensitivity can reach 1 copies / μL.

[0131] 2. Repeatability test

[0132] Preparation of gradient DNA template: The positive control (B646L-pUC57, MGF-110-pUC57, EP402R-pUC57) was diluted in a gradient manner (concentration of 3×10 6 copies / μL, 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 1 copies / μL), and the CT values ​​of different templates were obtained according to the kit prepared by Example 2 and the method for using the kit, and templates with high copy Ct values ​​of 20-25, medium copy Ct values ​​of 25-30, and low copy Ct values ​​of 30-35 were selected for corresponding detection.

[0133] A template with a high copy Ct value of 20-25, a medium copy Ct value of 25-30, and a low copy Ct of 30-35 was used, and the kit prepared in Example 2 and the method for using the kit were used for detection. Four replicates were performed in each group to obtain an amplification curve, and a standard curve was made to test the difference in amplification efficiency (E value).

[0134] Table 6

[0135]

[0136]

[0137] The results are shown in Table 6. It can be seen from the table that the detection effect of the kit prepared in Example 2 of the present invention is high in accuracy and small in error.

[0138] Example 4 Accelerated Experiment

[0139] The reagents in the kit of Example 2 were prepared into corresponding fluorescent quantitative PCR reaction solutions for acceleration experiments, with 4 replicates per group, and aged for 15 days and 30 days respectively under the conditions of measuring temperature 37°C and humidity 60%, and the detection sensitivity of the aged fluorescent quantitative PCR reaction solution to the detection template was tested. The test was performed using the kit prepared in Example 2 and the method for using the kit. At the same time, the amplification curve was obtained and made into a standard curve to test the difference in its amplification efficiency (E value).

[0140] The detection templates were positive controls (B646L-pUC57, MGF-110-pUC57, EP402R-pUC57).

[0141] At the same time, the detection template was gradiently diluted, and the concentration after dilution was 3×10 6 copies / μL, 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 1 The sensitivity test was performed with the aged fluorescence quantitative PCR reaction solution. Each group was repeated 6 times, and the Ct value and detection rate were calculated.

[0142] Table 7

[0143]

[0144]

[0145] Table 8

[0146]

[0147] Table 9

[0148]

[0149] Table 10 LOD

[0150]

[0151]

[0152] The accelerated results are shown in Tables 7-10. It can be seen from the table that the fluorescent quantitative PCR reaction solution of the present application scheme has good stability, and can still achieve good detection results after acceleration for 30 days, and can be stably stored for more than one year.

[0153] Example 5 Specificity Test

[0154] The nucleic acid samples of African swine fever virus type 1, African swine fever virus type 2, recombinant swine fever virus, circovirus type 2, pseudorabies virus and porcine reproductive and respiratory syndrome virus were extracted using a nucleic acid extraction kit. The above samples were obtained from the China Animal Disease Prevention and Control Center.

[0155] The detection was performed using the kit prepared in Example 2 and the method for using the kit.

[0156] Test results such as Figure 8 As shown in the figure, it can be seen that in the experiment, ASFV-R is a rearranged sample nucleic acid, in which all three channels have amplification curves; ASFV-2 is a type II African swine fever virus nucleic acid, only FAM and ROX channels have amplification curves, and ASFV-1 is a type I African swine fever virus sample nucleic acid, only FAM and HEX channels have amplification curves, and the other nucleic acid samples have no amplification curves. The results show that the primer probe set of Example 1 has a specific amplification curve only for African swine fever virus, and has good specificity.

[0157] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A multiplex fluorescence quantitative PCR detection reagent for detecting African swine fever virus, characterized in that: The multiplex fluorescence quantitative PCR detection reagent includes a first primer probe group for detecting the B646L gene, a second primer probe group for detecting the MGF_110 gene, and a third primer probe group for detecting the EP402R gene; In the first primer-probe set, the sequences of the primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2; the sequence of the probe is shown in SEQ ID NO: 3; In the second primer-probe set, the sequences of the primers are shown in SEQ ID NO:4 and SEQ ID NO:5; the sequence of the probe is shown in SEQ ID NO:6; In the third primer-probe set, the sequences of the primers are shown in SEQ ID NO:7 and SEQ ID NO:8; the sequence of the probe is shown in SEQ ID NO:

9.

2. The multiplex fluorescence quantitative PCR detection reagent according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; Preferably, the fluorescent reporter group includes but is not limited to any one of FAM, ROX, CY5, HEX, JOE, CY3, NED, TAMRA, TAXAS RED, VIC and TET; Preferably, the fluorescence quenching group includes but is not limited to any one of super Quenther 1, BHQ, TAMRA, MGB and DABCYL.

3. The multiplex fluorescence quantitative PCR detection reagent according to claim 1, characterized in that: The multiplex fluorescence quantitative PCR detection reagent also includes a PCR premix.

4. A chip for detecting African swine fever virus, characterized in that: The chip contains the freeze-dried powder of the multiplex fluorescence quantitative PCR detection reagent according to any one of claims 1 to 3.

5. A kit, characterized in that: The kit comprises the multiplex fluorescent quantitative PCR detection reagent according to any one of claims 1 to 3 or the chip according to claim 4.

6. The kit according to claim 5, characterized in that The kit further comprises at least one of a positive control and a negative control.

7. Use of the multiplex fluorescent quantitative PCR detection reagent according to any one of claims 1 to 3, the chip according to claim 4, or the kit according to any one of claims 5 to 6 in the preparation of products for detecting or assisting in the detection of African swine fever virus.

8. A method for detecting African swine fever virus for purposes other than disease diagnosis and treatment, characterized in that: The method comprises the following steps: using the multiplex fluorescent quantitative PCR detection reagent according to any one of claims 1 to 3, the chip according to claim 4, or the kit according to any one of claims 5 to 6 to detect the DNA of the sample to be tested; Preferably, the detection is performed using fluorescent quantitative PCR; More preferably, the amplification program of the fluorescent quantitative PCR is: 35-39°C for 1-3 min; 94-96°C for 1-3 min; then enter the cycling stage: 93-96°C for 3-7 s, 55-65°C for 25-35 s, 35-45 cycles, and collect fluorescence data.

9. The method according to claim 8, characterized in that The reaction system of the fluorescent quantitative PCR contains: FastAmpli Premix-UNGⅣ1×; The forward primer sequence in the first primer probe set is 80-120 nM; The reverse primer sequence in the first primer probe set is 80-120 nM; The probe sequence in the first primer probe set is 40-60 nM; The forward primer sequence in the second primer probe set is 180-220 nM; The reverse primer sequence in the second primer probe set is 180-220 nM; The probe sequence in the second primer probe set is 80-120 nM; The forward primer sequence in the third primer probe set is 180-220 nM; The reverse primer sequence in the third primer probe set is 180-220 nM; The probe sequence in the third primer probe set is 80-120 nM.

10. A system for detecting African swine fever virus, characterized in that: The system comprises: Detection module: used to perform fluorescent PCR amplification on the nucleic acid of the sample to be tested using the fluorescent PCR detection reagent according to any one of claims 1 to 3, the chip according to claim 4, or the kit according to any one of claims 5 to 6; Analysis module: used to evaluate whether the sample to be tested contains African swine fever virus.

Images