Primer probe group for detecting type I African swine fever virus and application of primer probe group

Abstract

The invention discloses a primer probe group for detecting type I African swine fever virus and application of the primer probe group, and relates to the technical field of pathogen detection. The primer probe group comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a probe with a nucleotide sequence as shown in SEQ ID NO: 3. The primer probe group can be used for rapidly, efficiently and specifically detecting the type I African swine fever virus.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogen detection, and in particular to a primer probe set for detecting type I African swine fever virus and applications thereof. Background Art

[0002] African swine fever is an acute, febrile, highly contagious disease of pigs caused by the African swine fever virus (ASFV), characterized by respiratory disorders, neurological symptoms and systemic hemorrhage. The African swine fever virus is mainly transmitted by contact and can be transmitted through kitchen waste, arthropods, animal secretions, animal excrement, vehicles and personnel. Domestic pigs and wild boars of all breeds and ages can be infected, with a mortality rate of up to 100%. There are currently no drugs or vaccines available for treatment. Based on genomic characteristics, ASFV can be divided into 22 different genotypes, of which type I African swine fever virus is one of the main prevalent strains.

[0003] At present, the prevention and control of African swine fever can only rely on strengthening biosafety measures, early detection and strict culling. Since the clinical symptoms of African swine fever are very similar to those of various viral and bacterial diseases, its diagnosis must be confirmed with the help of laboratory testing. Indirect immunofluorescence test, hemocyte adsorption test, virus isolation, polymerase chain reaction (PCR), real-time fluorescence quantitative PCR, etc. are the main detection technologies used for pathogen detection. It is of great significance to provide a method that can specifically detect type I African swine fever virus. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes a primer probe set for detecting type I African swine fever virus, which can quickly, efficiently and specifically detect type I African swine fever virus.

[0005] The present invention also provides a product containing the primer probe set.

[0006] The present invention also provides application of the primer probe set.

[0007] The present invention also provides a method for detecting type I African swine fever virus for non-diagnostic purposes.

[0008] The present invention also provides a system for detecting type I African swine fever virus.

[0009] According to the first aspect of the present invention, the primer probe set for detecting type I African swine fever virus includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO:1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO:2, and a probe with a nucleotide sequence as shown in SEQ ID NO:3.

[0010] The primer probe set for detecting type I African swine fever virus according to an embodiment of the present invention has at least the following beneficial effects:

[0011] The primer probe set of the embodiment has the characteristics of high sensitivity, good repeatability and strong specificity, and can be used to specifically detect type I African swine fever virus.

[0012] According to some embodiments of the present invention, both ends of the probe are labeled with a fluorescent reporter group and a fluorescent quencher group, respectively.

[0013] According to some embodiments of the present invention, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0014] According to some embodiments of the present invention, the fluorescent reporter group is selected from FAM, JOE, VIC, HEX, ROX, CY3 or CY5; the fluorescent quencher group is selected from BHQ, TAMRA or MGB.

[0015] A product according to the second aspect of the present invention is used to detect African swine fever virus type I; it includes the primer probe set described in the first aspect of the present invention; the product is selected from a reagent, a kit or a chip. Since the product of the embodiment of the present invention adopts all the technical solutions of the primer probe set of the above embodiment, it at least has all the beneficial effects brought by the technical solutions of the above embodiment.

[0016] According to some embodiments of the present invention, the product further includes at least one of a positive control, a negative control, and a PCR premix.

[0017] According to some embodiments of the present invention, the PCR premix includes dNTP, Mg 2+ , UNG enzyme, Taq DNA polymerase, reaction buffer, and at least one of a PCR stabilizer.

[0018] According to some embodiments of the present invention, the PCR premix is ​​2×FastAmpli Premix-UNGⅣ.

[0019] According to some embodiments of the present invention, the positive control is selected from African swine fever virus type I, nucleic acid of African swine fever virus type I, a nucleic acid molecule comprising a nucleotide sequence as shown in SEQ ID NO: 4, or a recombinant vector comprising a nucleic acid molecule comprising a nucleotide sequence as shown in SEQ ID NO: 4. For example, the recombinant vector may be a PUC57 vector into which a DNA fragment having a nucleotide sequence as shown in SEQ ID NO: 4 is inserted.

[0020] According to some embodiments of the present invention, the negative control substance is nucleic acid-free water.

[0021] Use of the primer probe set according to the third aspect of the present invention in A1) or A2);

[0022] A1) Non-diagnostic detection or auxiliary detection of African swine fever virus type 1;

[0023] A2) Prepare products for detecting or assisting in the detection of type 1 African swine fever virus.

[0024] According to some embodiments of the present invention, the product is selected from a reagent, a kit or a chip.

[0025] According to a fourth aspect of the present invention, a method for detecting or assisting in detecting type I African swine fever virus for non-diagnostic purposes comprises the following steps:

[0026] The primer probe set is used to perform fluorescent PCR amplification on the nucleic acid of the sample to be tested to evaluate whether the sample to be tested contains type I African swine fever virus.

[0027] According to some embodiments of the present invention, the sample to be tested includes at least one of pig serum, lymph node, spleen, lung, oropharyngeal swab, nasopharyngeal swab, whole blood, and saliva.

[0028] According to some embodiments of the present invention, the samples to be tested may also be derived from environmental samples of a farm (including but not limited to air, water, soil, pollutants from contact with sick pigs, equipment in the farm, etc.).

[0029] According to some embodiments of the present invention, the amplification system of the fluorescent PCR amplification includes components with the following final concentrations:

[0030] The upstream primer is 100nM to 300nM; the downstream primer is 100nM to 300nM; and the probe is 50nM to 200nM.

[0031] According to some embodiments of the present invention, the amplification system of the fluorescent PCR amplification further includes 2×FastAmpli Premix-UNGⅣ with a final concentration of 1×.

[0032] According to some embodiments of the present invention, the reaction procedure of the fluorescent PCR amplification is: 95°C for 2 min; then enter the cycle stage: 95°C for 5 sec, 60°C for 30 sec (collecting fluorescence), and 45 cycles.

[0033] According to some embodiments of the present invention, the evaluating whether the sample to be tested contains type I African swine fever virus includes: judging whether the sample to be tested contains type I African swine fever virus based on the Ct value of fluorescent PCR amplification.

[0034] According to some embodiments of the present invention, the step of evaluating whether the sample to be tested contains type I African swine fever virus comprises:

[0035] If 38≤Ct≤40, the sample to be tested is judged to be suspicious; if Ct﹤38, the sample to be tested is judged to contain type I African swine fever virus; if Ct>40 or there is no specific amplification curve, it is judged that the sample to be tested does not contain type I African swine fever virus.

[0036] According to some embodiments of the present invention, the method further comprises using the primer probe set to perform fluorescent PCR amplification on the negative control and the positive control. When the negative control has no specific amplification curve and the positive control has a Ct of <38, the evaluation result is credible.

[0037] A system for detecting type I African swine fever virus according to a fifth aspect of the present invention includes:

[0038] Detection module: used to perform fluorescent PCR amplification on the nucleic acid of the sample to be tested using the above primer probe set;

[0039] Analysis module: used to evaluate whether the sample to be tested contains type I African swine fever virus.

[0040] According to some embodiments of the present invention, the system further comprises an extraction module for extracting nucleic acid from the sample to be tested.

[0041] Other features and advantages of the present invention will be set forth in the description which follows, and in part will be apparent from the description, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 The standard curve of the primer probe set provided in Example 1 of the present invention at different probe dosages; A: 50 nM; B: 100 nM; C: 150 nM; D: 200 nM;

[0043] Figure 2 The standard curve of the primer probe set provided in Example 1 of the present invention at different annealing temperatures; A: 56°C; B: 58°C; C: 60°C;

[0044] Figure 3 This is the specificity analysis result of the primer probe set provided in Example 1 of the present invention. DETAILED DESCRIPTION

[0045] The above and / or additional aspects and advantages of the present invention will become obvious and easy to understand from the description of the embodiments in conjunction with the following drawings, wherein: The following will clearly and completely describe the concept of the present invention and the technical effects produced in conjunction with the embodiments, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0046] If the specific conditions are not specified in the examples, the conventional conditions or the conditions recommended by the manufacturer shall be followed. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially. 2×FastAmpliPremix-UNGⅣ was purchased from Zhuhai Baorui Biotechnology Co., Ltd., with the item number FM2181-4. The primer and probe sequences were all commissioned to be synthesized by Bio-Tech (Shanghai) Co., Ltd.

[0047] Unless otherwise specified, nucleotide sequences are in 5' to 3' order.

[0048] Example 1

[0049] (1) Design of primers and probes:

[0050] Through a large number of literature searches and analyses, as well as GenBank database sequence searches and comparison analyses, the target gene for detection of type I African swine fever virus was finally determined. The nucleotide sequence of the target gene was systematically analyzed, a series of primers and probes were designed, and after synthesis, they were screened and verified by experiments, and the best primer and probe set was finally determined. The specific nucleotides are as follows:

[0051] Upstream primer MGF 110-1L-F: GCAGACCAAGCATGGCTAC (SEQ ID NO: 1);

[0052] Downstream primer MGF 110-R3: CATTTATTGGCTTACCCACAAG (SEQ ID NO: 2);

[0053] Probe MGF110-3L-P: HEX-AGCATTTGCTGACGAGCAGCC-BHQ1 (SEQ ID NO: 3).

[0054] (2) Construction of recombinant plasmid standards:

[0055] The nucleotide sequence of the target gene fragment is shown in SEQ ID NO: 4. After the target gene fragment was connected to the pUC57 vector, the recombinant plasmid standard pUC57-MGF_110 was obtained by sequencing verification.

[0056] GCAGACCAAGCATGGCTACTTGTGAACAAGTGGCTGCTCGTCAGCAAATAGCTGC TCGTCAGCAAATGGCTGCTCGTCAGCAAATGCTGCTTGTGGGTAAGCCAATAAATGGG CCATACCCTTGAAAGGAGAATTCAG (SEQ ID NO: 4).

[0057] (3) Detection method:

[0058] The nucleic acid sample of the sample to be tested was extracted as a template, and the PCR reaction solution (5 μL) was prepared and added to a MEMS chip (Hua Chuang Core Technology (Shenzhen) Co., Ltd.) and freeze-dried in a freeze dryer; the schematic diagram of the MEMS chip after freeze-drying is shown in Figure 1 After adding 5 μL of nucleic acid sample to the well with freeze-dried powder, the MEMS chip was placed in a fluorescence quantitative PCR instrument (Q3 Plus V2 purchased by Huachuang Core Technology (Shenzhen) Co., Ltd.) for amplification, and the corresponding Ct value was read by the software of the fluorescence quantitative PCR instrument. When there was no amplification curve (No Ct) in the negative control (DEPC water) group and Ct < 38 in the positive control (recombinant plasmid standard pUC57-MGF_110) group, the test results were credible, and the judgment criteria shown in Table 1 were further used to determine whether the sample to be tested contained type I African swine fever virus.

[0059] The PCR reaction solution (5 μL) is as follows:

[0060]

[0061] The amplification program was: 95°C for 2 min; then entered the cycling phase: 95°C for 5 sec, 60°C for 30 sec (collecting fluorescence), and 45 cycles.

[0062] Table 1

[0063] HEX Channel Result determination No Ct No African swine fever virus type 1 was found in the samples tested Ct﹤38 The sample to be tested contains African swine fever virus type 1 38≤Ct≤40 The sample to be tested is suspicious and needs to be retested Ct>40 No African swine fever virus type I was detected in the samples tested

[0064] Example 2

[0065] This example provides a kit for detecting type I African swine fever virus, which consists of 2×FastAmpli Premix-UNGⅣ, upstream primer MGF 110-1L-F, downstream primer MGF 110-R3, probe MGF 110-3L-P, negative control substance, and positive control substance;

[0066] Among them, the negative control was DEPC water;

[0067] The positive control was the recombinant plasmid standard pUC57-MGF_110 constructed in Example 1.

[0068] Comparative Example 1

[0069] This example provides a set of primer probe combinations for detecting type I African swine fever virus, referring to the patent "Dual fluorescence quantitative PCR composition and kit for identifying recombinant strains, type I and type II strains of African swine fever virus" (application number: 202311517770.9), which differs from the primer probe set in Example 1 only in that the downstream primers are different. The nucleotide sequence of the downstream primer is shown as TACCCACAAGCAGCATTTGC (SEQ ID NO: 5).

[0070] This example also provides a detection method using the primer-probe combination, which is the same as Example 1.

[0071] Experimental Example 1: Kit System Optimization

[0072] (1) Optimization of primer dosage:

[0073] The detection method in Example 1 was used, except that the final concentrations of the primers were different. The final concentrations of the upstream primer MGF 110-1L-F and the downstream primer MGF 110-R3 were 100 nM, 150 nM, 200 nM, 250 nM, and 300 nM, respectively; the positive control pUC57-MGF_110 (concentration of 3×10 6 copies / μL, 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 1 copies / μL) as nucleic acid samples. Obtain amplification curves and make standard curves to test the differences in amplification efficiency (E value).

[0074] The results are shown in Table 2.

[0075] Table 2

[0076] Final concentration of upstream primer / downstream primer E-value <![CDATA[Correlation coefficient (R 2 )]]> 100nM 93.4 0.998 150nM 92.5 0.994 200nM 99.1 0.996 250nM 84.3 0.992 300nM 94.6 0.999

[0077] Amplification curves were obtained when the primer concentration was within the range of 100nM to 300nM, and the amplification efficiency was optimal when the primer concentration was 200nM.

[0078] (2) Optimization of probe dosage:

[0079] The detection method in Example 1 was used, except that the final concentration of the probe was different. The final concentrations of the probe MGF 110-3L-P were 50 nM, 100 nM, 150 nM, and 200 nM, respectively; the positive control pUC57-MGF_110 (concentration of 3×10 6 copies / μL, 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 1 copies / μL) as nucleic acid samples. Obtain the amplification curve and make a standard curve to test the difference in amplification efficiency.

[0080] The results are as follows Figure 1 And as shown in Table 3.

[0081] Table 3

[0082] Final concentration of probe E-value <![CDATA[R 2 ]]> 50nM 94.8 0.994 100nM 104.3 0.999 150nM 112.7 0.996 200nM 98.2 0.999

[0083] There were amplification curves in the range of probe concentration from 50nM to 200nM, and the best result was obtained when the probe concentration was 100nM.

[0084] (3) Optimization of annealing temperature:

[0085] The detection method in Example 1 was used, except that the annealing temperature in the reaction procedure was different. The annealing temperature was set to 56°C, 58°C, and 60°C for gradient testing. The positive control pUC57-MGF_110 (concentration of 3×10 6 copies / μL, 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 1 copies / μL) as nucleic acid samples. Obtain the amplification curve and make a standard curve to test the difference in amplification efficiency.

[0086] The results are as follows Figure 2 And as shown in Table 4.

[0087] Table 4

[0088] Annealing temperature E-value <![CDATA[R 2 ]]> 56℃ 104.6 0.999 58℃ 103.1 0.999 60℃ 100 0.999

[0089] When the annealing temperature was 56℃~60℃, the linear detection parameters were better. Considering the nonspecific amplification, 60℃ was selected as the optimal temperature.

[0090] Experimental Example 2: Sensitivity and Repeatability Testing

[0091] The recombinant plasmid standard pUC57-MGF_110 was diluted with DEPC water in a gradient manner and detected according to the detection method in Example 1 or Comparative Example 1 (the final concentrations of the recombinant plasmid standard pUC57-MGF_110 were 30 copies / μL, 10 copies / μL, 5 copies / μL, and 1 copy / μL, respectively). Each group was repeated 30 times, and the Ct value and detection rate were calculated.

[0092] The results are shown in Table 5.

[0093] Table 5

[0094]

[0095] The sensitivity of the primer probe set of Example 1 is as low as 1 copies / μL, and the detection rate at each concentration is much higher than that of Comparative Example 1.

[0096] Experimental Example 3: Specificity Detection

[0097] The nucleic acids extracted from the African swine fever virus type 1 samples, the porcine blue ear virus samples, the porcine pseudorabies virus samples, the porcine circovirus samples, the porcine parvovirus and the porcine rotavirus (wherein the RNA needs to be reverse transcribed into cDNA) are stored for use as DNA templates for subsequent detection. Using the above DNA templates, specific detection is performed using the detection method in Example 1.

[0098] The results are as follows Figure 3 shown.

[0099] The primer probe set of Example 1 has a specific amplification curve only for type I African swine fever virus and has good specificity.

[0100] The embodiments of the present invention are described in detail above, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge scope of ordinary technicians in the relevant technical field without departing from the purpose of the present invention.

Claims

1. A primer probe set for detecting type I African swine fever virus, characterized in that: It comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO: 1, a downstream primer having a nucleotide sequence as shown in SEQ ID NO: 2, and a probe having a nucleotide sequence as shown in SEQ ID NO:

3.

2. The primer probe set according to claim 1, characterized in that: The two ends of the probe are respectively labeled with a fluorescent reporter group and a fluorescent quencher group.

3. The primer probe set according to claim 2, characterized in that: The fluorescent reporter group is selected from FAM, JOE, VIC, HEX, ROX, CY3 or CY5; the fluorescent quencher group is selected from BHQ, TAMRA or MGB.

4. A product, characterized in that The invention comprises the primer probe set according to any one of claims 1 to 3; the product is selected from a reagent, a kit or a chip.

5. The product according to claim 4, characterized in that The product also includes at least one of a positive control, a negative control, and a PCR premix; Preferably, the PCR premix includes dNTP, Mg 2+ , UNG enzyme, Taq DNA polymerase, reaction buffer, and at least one of a PCR stabilizer.

6. Use of the primer probe set according to any one of claims 1 to 3 in A1) or A2); A1) Non-diagnostic detection or auxiliary detection of African swine fever virus type 1; A2) Prepare products for detecting or assisting in the detection of African swine fever virus type 1.

7. The use according to claim 6, characterized in that: The product is selected from a reagent, a kit or a chip.

8. A method for detecting or assisting in detecting type I African swine fever virus for non-diagnostic purposes, characterized in that: The following steps are involved: The primer probe set according to any one of claims 1 to 3 is used to perform fluorescent PCR amplification on the nucleic acid of the sample to be tested to evaluate whether the sample to be tested contains type I African swine fever virus.

9. The method according to claim 8, characterized in that The amplification system of the fluorescent PCR amplification includes the following components at the final concentrations: The upstream primer is 100nM to 300nM; the downstream primer is 100nM to 300nM; the probe is 50nM to 200nM; And / or, the reaction procedure of the fluorescent PCR amplification is: 95°C for 2 min; then enter the cycle stage: 95°C for 5 s, 60°C for 30 s, 45 cycles; And / or, the step of evaluating whether the sample to be tested contains type I African swine fever virus comprises: If 38≤Ct≤40, the sample to be tested is judged to be suspicious; if Ct﹤38, the sample to be tested is judged to contain type I African swine fever virus; if Ct>40 or there is no specific amplification curve, it is judged that the sample to be tested does not contain type I African swine fever virus.

10. A system for detecting type I African swine fever virus, characterized in that: include: Detection module: used to perform fluorescent PCR amplification on the nucleic acid of the sample to be tested using the primer probe set according to any one of claims 1 to 3; Analysis module: used to evaluate whether the sample to be tested contains type I African swine fever virus.

Images