Primer group, kit and method for detecting orf virus and capripox virus and application

Abstract

The invention relates to the technical field of sheep infectious virus detection, in particular to a primer group, a kit and a method for detecting orf virus and sheep pox virus and application. The primer group comprises O1 as shown in SEQ ID NO: 1, O2 as shown in SEQ ID NO: 2, C1 as shown in SEQ ID NO: 3 and C2 as shown in SEQ ID NO: 4. The kit comprises the primer group. The method comprises the following steps: carrying out PCR (Polymerase Chain Reaction) amplification on a sample by using the primer group or the kit, carrying out electrophoresis detection on an amplified product, and detecting the orf virus and the capripox virus according to a detection strip. The method can be used for quickly identifying and detecting whether the sample to be detected is infected with the orf virus and the capripox virus, is relatively high in sensitivity and specificity, does not amplify non-capripox virus DNA (Deoxyribonucleic Acid), and is low in false positive rate.

Description

Technical Field

[0001] The present application relates to the technical field of sheep infectious virus detection, and specifically to a primer set, a kit, a method and an application for detecting sheep sore virus and sheep pox virus. Background Art

[0002] Sheeppox, also known as sheep smallpox, is an acute, febrile, highly contact zoonosis caused by capripox virus (CaPV) of the genus Capripoxvirus of the family Poxviridae. Sheeppox viruses include Goatpoxvirus (GTPV) and Sheeppox virus (SPPV). When sheep are infected with CaPV, erythema will appear in the mouth, eyes, skin and other parts, and then harden to form papules. The papules will form pustules and scabs after tissue necrosis. When the pox occurs in the respiratory tract or digestive tract, it can cause diarrhea, weight loss or coughing, and may also cause miscarriage in pregnant ewes. Sheeppox, also known as sheep infectious pustule, is an epithelial zoonosis caused by orfvirus (ORFV) of the genus Parapoxvirus of the family Poxviridae. The prevalence, transmission mode and clinical symptoms of CaPV and ORFV are very similar, and most of them are mixed infections.

[0003] Therefore, effective detection of CaPV and ORFV single or mixed infection is very necessary for determining the infection type of sheep infectious diseases and for corresponding prevention, treatment and epidemic control of infectious diseases. Summary of the invention

[0004] In view of this, the embodiments of the present application provide primer sets, kits, methods and applications for detecting goat pox virus and goat pox virus.

[0005] In a first aspect, the embodiment provides a primer set for detecting goat pox virus and goat pox virus, comprising O1 as shown in SEQ ID NO:1, O2 as shown in SEQ ID NO:2, C1 as shown in SEQ ID NO:3, and C2 as shown in SEQ ID NO:4.

[0006] In a second aspect, the embodiment discloses a kit comprising the primer set shown in the first aspect.

[0007] In the third aspect, the embodiment discloses a method for detecting goat pox virus and goat pox virus. The method comprises: using the sample to be tested as a template, and forming a PCR reaction system with the primer set described in the first aspect to perform a PCR reaction; performing electrophoresis on the PCR reaction product; and detecting goat pox virus and goat pox virus according to the electrophoresis bands.

[0008] In a fourth aspect, the embodiments disclose the use of the primer set described in the first aspect or the kit described in the second aspect in detecting goat pox virus and capripox virus.

[0009] Compared with the prior art, the primer set, kit, method and application for detecting sheep pox virus and sheep pox virus provided in the embodiment have at least the following technical effects:

[0010] The present invention can quickly identify and detect whether the sample to be tested is infected with sheep pox virus and sheep pox virus. -6 The sample to be tested at the dilution still has a high sensitivity. The application can be assembled into a double PCR detection kit for clinical detection of sheep sore virus and sheep pox virus pathogens for use in veterinary clinical and laboratory testing. The application has no amplification of non-sheep pox virus viral DNA, has high specificity, and a low false positive rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 The test results of the cell culture of goat pox virus and goat pox virus provided in the examples. Lane 1 is the water control; Lane 2 is the healthy wool control; Lane 3 is the cell culture of goat pox virus; Lane 4 is the cell culture of goat pox virus; Lane 5 is the cell culture of goat pox virus and goat pox virus; Lane 6 is the cell culture of goat pox virus and sheep pox virus; Lane M is the DNA standard 100bp Lader.

[0012] Figure 2 The specific test results provided in the embodiment. Lanes 1 to 12 are respectively the viral genomic DNA of goat pox virus, the viral genomic DNA of goat pox virus, the viral genomic DNA of sheep pox virus, the inactivated vaccine of goat septicemic streptococcus, the inactivated vaccine of goat infectious pleuropneumonia, the inactivated vaccine of goat septicemic streptococcus disease, the bivalent vaccine of foot-and-mouth disease type O / type A, the live vaccine of peste des petits ruminants, the live vaccine of Brucella, the (inactivated) diseased material infected with goat pox virus, the (inactivated) diseased material infected with sheep pox virus, and the cell mixture (after inactivation) inoculated with goat pox virus and goat pox virus.

[0013] Figure 3 The sensitivity test results provided in the embodiment. Lane 1 is normal MDCK cells, and lanes 2 to 9 are dilution ratios of 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 Dilution samples of nucleic acid from a mixture of ORFV virus and CaPV virus. DETAILED DESCRIPTION

[0014] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0015] Example By performing multiple PCR amplification on the specific fragment of goat pox virus (SEQ ID NO: 5,916 bp) and the specific fragment of goat pox virus (SEQ ID NO: 6,523 bp), goat pox virus and goat pox virus can be effectively detected.

[0016] On the one hand, the embodiment provides a primer set for detecting goat pox virus and goat pox virus, including O1 as shown in SEQ ID NO:1, O2 as shown in SEQ ID NO:2, C1 as shown in SEQ ID NO:3 and C2 as shown in SEQ ID NO:4.

[0017] O1:CAGGTATGCCAGGATGAAGATGT

[0018] O2:CGAAATCACGGCCTACATAATCG

[0019] C1:AAATCATATCCCCCTGTGTACGA

[0020] C2:ATGTTATACCAATCGTTGGTCGC

[0021] In one aspect, the embodiment discloses a kit, comprising the primer set described in the embodiment. In some embodiments, the kit further comprises a PCRmix reagent, such as a Taq PCR Mix reagent.

[0022] On the one hand, the embodiment discloses a method for detecting goat pox virus and goat pox virus. The method comprises: using the sample to be tested as a template, and forming a PCR reaction system with the primer set described in the embodiment to perform a PCR reaction; performing electrophoresis on the PCR reaction product; and detecting goat pox virus and goat pox virus according to the electrophoresis bands.

[0023] In some embodiments, the PCR reaction system comprises 25 μL of the sample to be tested, 12.5 μL of 2×TaqPCRMix, 1 μL, 5 μmol / μL of primer O1, 1 μL, 5 μmol / μL of primer O2, 1 μL, 5 μmol / μL of primer C1, 1 μL, 5 μmol / μL of primer, 1 μL, 5 μmol / μL of primer C2, and the remainder of double distilled water. In some embodiments, the PCR reaction steps include: 94°C pre-denaturation for 2 min, 95°C for 30 s, 56°C for 30 s, 72°C for 20 s, and after 40 cycles, 72°C extension for 5 min.

[0024] In addition, the examples disclose the use of the primer set described in the examples or the kit described in the examples in detecting goat pox virus and capripox virus.

[0025] The embodiments of the present application will be described in more detail below, but do not constitute a limitation on the implementation methods of the present application.

[0026] 1. Primer set

[0027] O1 as shown in SEQ ID NO: 1, O2 as shown in SEQ ID NO: 2, C1 as shown in SEQ ID NO: 3, and C2 as shown in SEQ ID NO: 4 were synthesized as a primer set.

[0028] 2. Viral genome extraction

[0029] Use Shanghai Zhijiang fully automatic nucleic acid extractor and its supporting nucleic acid kit to extract DNA from virus strains, and the obtained viral DNA can be used for detection.

[0030] 3. PCR amplification

[0031] The PCR reaction system contains 25 μL of the following: 5 μL of the sample to be tested, 12.5 μL of 2×Taq PCRMix, 1 μL, 5 μmol / μL of primer O1, 1 μL, 5 μmol / μL of primer O2, 1 μL, 5 μmol / μL of primer C1, 1 μL, 5 μmol / μL of primer, 1 μL, 5 μmol / μL of primer C2 and the remainder of double distilled water. In some embodiments, the PCR reaction steps include: pre-denaturation at 94°C for 2 min, 95°C for 30 s, 56°C for 30 s, 72°C for 20 s, and after 40 cycles, extension at 72°C for 5 min. The sample to be tested is the viral genome sample extracted in the above steps. The PCR amplification product is detected by electrophoresis. Figure 1 As shown, the target fragment can be effectively amplified.

[0032] 4. Specificity test

[0033] The viral genomic DNA of aphthous tussock virus, goat pox virus, and sheep pox virus, as well as the inactivated vaccine for sheep septicemic streptococcus (Sinopharm Qinghai Biological), the inactivated vaccine for goat infectious pleuropneumonia (Wuhan Keqian), the inactivated vaccine for sheep septicemic streptococcus (Sinopharm Qinghai Biological), the bivalent vaccine for foot-and-mouth disease type O / type A (Zhongnong Weite Biological), the live vaccine for peste des petits ruminants (Sinopharm Animal Health), the live vaccine for Brucella (Jinyu Baoling Biological), the (inactivated) diseased materials infected with aphthous tussock virus and sheep pox virus (donated by China Animal Health and Epidemiology Research Center), and the cell mixture (inactivated) inoculated with aphthous tussock virus and goat pox virus (donated by China Animal Health and Epidemiology Research Center) were amplified and detected by electrophoresis using the same PCR reaction conditions as mentioned above.

[0034] like Figure 2 As shown, ORFV virus can only amplify a 916bp band, MDCK cells inoculated with GTPV and MDCK cells inoculated with SPPV can only amplify a 523bp CaPV band, and no bands appeared in the other inoculated MDCK cells and normal MDCK cells. 5. Sensitivity test

[0035] The nucleic acid of the mixture of ORFV virus and CaPV virus and the nucleic acid of normal MDCK cells were extracted. After extraction, the nucleic acid concentration (4.05 ng / μL) was measured by spectrophotometer. 5 μL of nucleic acid of ORFV virus and CaPV virus was added to 45 μL of distilled water, and then 5 μL was taken out for multiple dilution. The dilution ratio was 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 The same PCR reaction conditions as above were used for amplification and electrophoresis detection.

[0036] like Figure 3 As shown, 10 -1 -10 -6 The mixture of ORFV virus and CaPV virus can amplify an ORFV band of 916bp and a CaPV band of 523bp, while no bands appear in normal MDCK cells.

[0037] 6. Application and comparative testing of PCR detection methods

[0038] Sample source: 46 clinical suspected disease samples

[0039] The detection method used the same PCR reaction conditions as above to amplify and electrophoretically detect 46 clinical suspected disease samples.

[0040] According to the methods of "NY / T 3235-2018 Diagnostic Technology for Sheep Infectious Pustulariae" and "NYT 576-2015 Diagnostic Technology for Sheep Pox and Goat Pox", viruses were isolated and identified from 46 clinical suspected disease samples.

[0041] As shown in Table 1, the primer set, kit and detection method provided in the embodiment are completely consistent with the results of ORFV and CaPV detection by the existing virus isolation and identification methods. In addition, ORFV and CaPV were amplified simultaneously in 8 ORFV-positive samples, and the homology with the published ORFV and CaPV gene sequences was 99.2% after sequencing, indicating that the sample was mixed with two viruses. The detection results are consistent with those of the existing virus isolation and identification methods (gold standard methods "NY / T 3235-2018 Diagnostic Technology for Sheep Infectious Pustule" and "NYT 576-2015 Diagnostic Technology for Sheep Pox and Goat Pox"). However, the traditional virus isolation and identification methods are time-consuming and have high requirements for the facility environment and the ability of the detection personnel. The PCR method in this study is very suitable for the detection work of grassroots laboratories, and ordinary detection personnel can operate it after simple training.

[0042] Table 1

[0043]

[0044]

[0045] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. A primer set for detecting goat pox virus and goat pox virus, comprising O1 as shown in SEQ ID NO: 1, O2 as shown in SEQ ID NO: 2, C1 as shown in SEQ ID NO: 3, and C2 as shown in SEQ ID NO:

4.

2. A kit comprising the primer set according to claim 1.

3. The kit according to claim 2, further comprising a PCRmix reagent.

4. A method for detecting goat pox virus and goat pox virus, comprising: Using the sample to be tested as a template and the primer set according to claim 1 to form a PCR reaction system for PCR reaction; The PCR reaction products were subjected to electrophoresis; The sheep pox virus and sheep pox virus were detected based on the electrophoresis bands.

5. The method according to claim 4, wherein the PCR reaction system comprises, in 25 μL, 5 μL of the sample to be tested, 12.5 μL of 2×Taq PCR Mix, 1 μL of 5 μmol / μL primer O1, 1 μL of 5 μmol / μL primer O2, 1 μL of 5 μmol / μL primer C1, 1 μL of 5 μmol / μL primer, 1 μL of 5 μmol / μL primer C2, and the remainder of double distilled water.

6. The method according to claim 4, wherein the PCR reaction step comprises: Pre-denaturation at 94°C for 2 min, 95°C for 30 s, 56°C for 30 s, 72°C for 20 s, after 40 cycles, extension at 72°C for 5 min.

7. The method according to claim 4, if the electrophoresis band shows a band of 916 bp, it is confirmed that the sample to be tested is a sample containing the scurvy virus; If the electrophoresis band shows a band of 523 bp, it is confirmed that the sample to be tested is a sample containing sheep pox virus; If the electrophoresis bands show bands of 916 bp and 523 bp, it is confirmed that the sample to be tested is a sample containing sheep pox virus and sheep pox virus.

8. The method according to claim 4, if the electrophoresis band shows a band as shown in SEQ ID NO: 5, it is confirmed that the sample to be tested is a sample containing scurvy virus; If the electrophoresis band shows a band shown in SEQ ID NO: 6, it is confirmed that the sample to be tested is a sample containing sheep pox virus; If the electrophoresis bands show the bands shown in SEQ ID NO: 5 and SEQ ID NO: 6, it is confirmed that the sample to be tested is a sample containing capripox virus and capripox virus.

9. Use of the primer set according to claim 1 or the kit according to claim 2 or 3 in detecting capripox virus and capripox virus.

Images