Fluorescence-enhanced G-rich-DNA protected silver nanocluster, preparation method thereof and application thereof in ATP (adenosine triphosphate) detection

Abstract

The invention belongs to the technical field of analytical chemistry, and provides a fluorescence enhanced G-rich-DNA (deoxyribonucleic acid) protected silver nano-cluster, a preparation method thereof and application of the fluorescence enhanced G-rich-DNA protected silver nano-cluster in ATP (adenosine triphosphate) detection in order to overcome the defect of low sensitivity of ATP detection by using a fluorescent silver nano-cluster. An ATP aptamer specifically recognized by ATP is used as a recognition element, DNA-Ag NCs is used as a signal report molecule, and fluorescence enhanced ATP detection is achieved. The lowest detection limit of ATP is 2.8 [mu] M, the ATP has good selectivity, and common interferents (GTP, UTP and CTP) almost have no influence on detection. The ATP in an actual sample diluted fetal calf serum is detected, and the recovery rate is 99.5-101.7%. Fluorescence enhancement is achieved, and the defects that a fluorescence quenching type method is sensitive to error signals, large in background change, limited in signal change and the like are overcome. The cost is low, the operation is simple, the toxicity is small, and the biocompatibility is good.

Description

Technical Field

[0001] The invention belongs to the technical field of analytical chemistry, and in particular relates to a fluorescence-enhanced G-rich-DNA-protected silver nanocluster and a preparation method thereof and an application thereof in ATP detection. Background Art

[0002] ATP is an energy molecule in the body and plays an important role in regulating intracellular metabolism and biochemical pathways in different tissues and organs. In addition, ATP provides energy for most biochemical reactions in organisms and is also a potential marker for ischemia, hypoglycemia, Parkinson's disease, Alzheimer's disease, hypoxia and some malignant tumors. Therefore, various types of ATP detection methods have been constructed, including colorimetric method, electrochemical analysis method, fluorescence analysis method and liquid chromatography analysis method. However, the disadvantages of these methods are that they are time-consuming and require time-consuming and laborious modification of electrodes and fluorescent probes. In recent years, we have constructed fluorescent probes for ATP detection based on DNA-Ag NCs and DNA-Cu / Ag NCs based on the principle that two weakly fluorescent DNA-Ag NCs (or DNA-Cu / Ag NCs) are close to each other through complementary chains to enhance fluorescence. Although these probes have simple operation, high sensitivity and selectivity, some performance parameters such as the minimum detection limit are still unsatisfactory. Therefore, it is very urgent to establish an ATP detection method with better performance.

[0003] Metal nanoclusters (Cu NCs, Ag NCs and Au NCs) are composed of several to hundreds of atoms and are less than 2nm in size. They have been used in fluorescent nanoprobes due to their excellent water dispersibility, adjustable size and unique optical properties, such as discrete energy levels, electron Fermi wavelength, high quantum yield and good photostability. DNA-Ag NCs protected by DNA have the advantages of low toxicity, biocompatibility, adjustable light emission wavelength, large Stokes shift and easy synthesis compared with quantum dots and organic fluorophores, and are widely used in the detection of metal ions, small molecules, enzymes, DNA and proteins.

[0004] Aptamers are single-stranded DNA or RNA sequences that can specifically bind to a variety of target molecules, such as small molecules, metal ions, proteins, and even viruses and cells. Aptamers have the advantages of stronger binding than antibodies, better chemical stability, easy preparation, and low molecular weight. Aptamers are widely used in diagnosis, tumor recognition, molecular imaging, drug delivery and treatment. Summary of the invention

[0005] In order to solve the shortcoming of low sensitivity of detecting ATP by using fluorescent silver nanoclusters, the present invention provides a fluorescence-enhanced G-rich-DNA-protected silver nanocluster and a preparation method thereof and an application in ATP detection; an ATP aptamer that specifically recognizes ATP is used as a recognition element and DNA-Ag NCs are used as a signal reporter molecule to establish a fluorescence-enhanced G-rich-DNA-protected silver nanocluster.

[0006] The present invention is realized by the following technical scheme: a fluorescence-enhanced G-rich-DNA-protected silver nanocluster, the fluorescence-enhanced G-rich-DNA-protected silver nanocluster comprises: ATP, a DNA template with a C-rich nucleation sequence and a G-rich sequence, a PBS buffer, and an AgNO3 and NaBH4 solution; wherein: the sequence of the DNA template is: 5'- cccttaatcccc ttttt aacctgggggagtattgcggaggaagg ttttt gggtggggtgggg-3´, wherein the first 12 nucleotides at the 5´ end are the C-rich nucleation sequence, the 18th to 44th nucleotides in the middle are the ATP aptamer, i.e., the oligonucleotide specifically recognized by ATP, and the 50th to 62nd nucleotides at the 3´ end are the G-rich sequence; the 13th to 17th and 45th to 49th nucleotides are the connecting parts of the ATP aptamer, the G-rich sequence, and the C-rich nucleation sequence; The concentrations of DNA template and ATP were 3 μM and 0-57 mM, respectively; The PBS buffer concentration is 20 mM, pH = 7.0; Control DNA template, AgNO 3、 The final concentration ratio of NaBH4 was 1:6:6.

[0007] The present invention also provides a method for preparing the fluorescence enhanced G-rich-DNA protected silver nanoclusters, comprising the following steps: (1) Mix the DNA oligonucleotide with 20 mM PBS buffer (pH 7.0) and stir evenly; the sequence of the DNA oligonucleotide is: 5´-cccttaatcccc ttttt aacctgggggagtattgcggaggaagg ttttt gggtggggtgggg-3´; (2) Add AgNO3 solution to the solution obtained in step (1), mix well, react in the dark at 4°C for 20 minutes, then add freshly prepared NaBH4 solution, stir thoroughly for 1 minute, react in the dark at 4°C for 1 hour, and obtain DNA-Ag NCs solution; wherein: DNA template, AgNO 3、The final concentration ratio of NaBH4 was 1:6:6.

[0008] Furthermore, the average particle size of the DNA-Ag NCs is about 2 nm.

[0009] The present invention also provides the use of the fluorescence-enhanced G-rich-DNA protected silver nanoclusters obtained by the method in ATP detection, comprising the following steps: (1) adding different concentrations of ATP to the DNA-Ag NCs solution at room temperature, measuring the fluorescence spectra of the sample solutions at different concentrations, and drawing a standard curve according to the maximum fluorescence intensity of the emission wave; (2) Adding the sample solution to be tested into the DNA-Ag NCs solution, measuring its fluorescence spectrum, and calculating the concentration of ATP.

[0010] The DNA template of the present invention, also called DNA oligonucleotide, was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. and has the sequence: 5´- ccc tta atc ​​ccc ttt tt aacctgggggagtattgcggaggaagg ttttt gggtggggtgggg-3´, consists of 62 bases, of which the 5´ end is the C-rich nucleating sequence part (italic part), the middle is the ATP adaptor part (bold part), that is, the oligonucleotide that specifically recognizes ATP, the 3´ end is the G-rich sequence part (red font part), and the underlined part ttttt is the connecting part between the ATP adaptor, the G-rich sequence and the C-rich nucleating sequence.

[0011] Ag in AgNO3 solution + Combined with the C base in the C-rich sequence. NaBH4 combines the Ag + Reduced to Ag.

[0012] like Figure 1 As shown, the detection principle of the present invention is as follows: the DNA template includes a C-rich nucleating sequence at the 5' end, an ATP aptamer portion in the middle, and a G-rich sequence portion at the 3' end. When ATP is added, since ATP has high selectivity and binding force for the ATP aptamer, ATP specifically binds to the ATP aptamer to form a U-shaped structure, so that the G-rich sequence at the 3' end is close to the DNA-Ag NCs with weaker fluorescence, resulting in a significant enhancement of its fluorescence, and ATP is detected.

[0013] It is reported that when the G-rich sequence is close to the DNA-Ag NCs with weaker fluorescence, the fluorescence of the DNA-Ag NCs will be significantly enhanced. Based on this principle, the present invention designs a fluorescence-enhanced G-rich-DNA-protected silver nanocluster and its application in ATP detection. The G-rich-DNA template consists of a nucleation-rich C sequence located at the 5' end, an ATP aptamer located in the middle, and a 3' end G-rich sequence. When ATP is added, the specific binding of ATP and its aptamer causes the conformational change of the ATP aptamer, causing the 3' end G-rich sequence to approach the DNA-Ag NCs with weaker fluorescence, resulting in a significant enhancement of the fluorescence of the DNA-Ag NCs, so that ATP is detected. This detection method has the advantages of high sensitivity, easy operation, fluorescence enhancement and green environmental protection.

[0014] The present invention uses an ATP aptamer that specifically recognizes ATP as a recognition element, designs a DNA template, and uses DNA-AgNCs as a signal reporter molecule to detect ATP, which belongs to a fluorescence enhanced probe. The linear range is 18-54mM, and the minimum detection limit of ATP is 2.8μM, which is lower than the minimum detection limit of other detection methods. The present invention has the characteristics of low cost, simple operation, high sensitivity, strong selectivity, low toxicity, good biocompatibility, etc. The detection method of the present invention provides a promising method for ATP detection in the biological field. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is the principle diagram of the ATP detection method of the present invention; Figure 2 The graph shows the changes in the fluorescence spectrum of DNA-Ag NCs when different concentrations of ATP are added; Figure 3 is the relationship between the fluorescence intensity of DNA-Ag NCs and ATP concentration at the maximum emission wavelength of 647 nm, and the inset is the linear relationship between the fluorescence intensity of DNA-Ag NCs at ATP concentrations of 18-54 mM; Figure 4 is the TEM image of DNA-Ag NCs, and the inset is the size distribution bar graph of DNA-Ag NCs; Figure 5 The relative fluorescence intensity of DNA-Ag NCs after adding 10 mM ATP and other interfering substances (GTP, UTP, CTP). F 0 and F The maximum fluorescence emission intensity of DNA-Ag NCs without and with the test substance added, respectively; Figure 6Middle: (A) is the XPS spectrum of ATP-DNA-Ag NCs; (B) is the Ag 3d region of the XPS spectrum of ATP-DNA-Ag NCs. DETAILED DESCRIPTION

[0016] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments; based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0017] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and the disclosure and materials cited therein are hereby incorporated by reference.

[0018] Technical equivalents to the specific embodiments described that are apparent to those skilled in the art using no more than routine experimentation are intended to be encompassed by this application.

[0019] The experimental methods in the following examples are all conventional methods unless otherwise specified. The instruments and equipment used in the following examples are all conventional laboratory instruments and equipment unless otherwise specified; the experimental materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified.

[0020] Example 1: The steps of measuring ATP concentration in PBS solution using fluorescence enhanced G-rich-DNA protected silver nanoclusters are as follows: (1) Mix the DNA oligonucleotide (3 μM) and PBS (20 mM, pH = 7.0) buffer. The sequence of the DNA oligonucleotide is: 5´- cccttaatcccc ttttt aacctgggggagtattgcggaggaagg ttttt gggtggggtgggg-3´; (2) Add AgNO3 solution to the solution obtained in step (1), mix well, react in the dark at 4°C for 20 minutes, then add freshly prepared NaBH4 solution, stir thoroughly for 1 minute, react in the dark at 4°C for 1 hour, and obtain DNA-Ag NCs solution; wherein: DNA template, AgNO 3、 The final concentration ratio of NaBH4 was 1:6:6.

[0021] (3) adding different concentrations of ATP to the DNA-Ag NCs solution at room temperature, measuring the fluorescence spectra of the sample solutions at different concentrations, and drawing a standard curve according to the maximum fluorescence intensity of the emission wave; Figure 2 is the fluorescence spectrum of different concentrations of ATP. Figure 2 It can be seen that the method of the present invention has a good fluorescence response to ATP; Figure 3 As shown in the figure, the fluorescence intensity of DNA-Ag NCs has a good linear relationship when the ATP concentration is 18-54 mM. Figure 4 It can be seen that the average particle size of DNA-Ag NCs is about 2 nm.

[0022] Example 2: Sensitivity is an important parameter for an effective sensor. Therefore, under optimal conditions, ATP (0-57 mM) was detected using the proposed sensor. Figure 6 A and Figure 6 B It can be seen that with the increase of ATP concentration, the emission intensity of ATP-DNA-Ag NCs gradually increases. Figure 3 It has a good linear relationship in the range of 18-54 mM (R2 = 0.9889, the linear regression equation is F = −163821.5 + 9979.2CATP), and the detection limit (LOD) is as low as 2.8 μM, which is based on 3 0 / k (the value of 0 is obtained by the background standard deviation, and k is the slope of the calibration line). The sensor has high sensitivity.

[0023] In addition, rhodamine derivatives, labeled aptamers, and magnetic nanoparticles have been used to analyze ATP with good sensitivity and selectivity compared to the fluorescence detection method based on diphenylbenzene (1) with two-arm diaminomethyl groups at the center of the benzene ring and its zinc complex (1-Zn). However, the first two probes require complex organic synthesis, while the latter requires labeling 6-carboxyfluorescein on the aptamer. These operations are not only complicated but may also affect the detection effect. In addition, the biocompatibility of organic probes is also poor. Therefore, the performance of this method is better than other methods.

[0024] At an emission wavelength of 647 nm, the fluorescence lifetime of ATP-DNA-AgNCs was studied by adding 0, 5, 10, 15 and 20 mM ATP, respectively. The fluorescence transient of ATP-DNA-Ag NCs showed a haploid exponential time constant with an average lifetime of 3.48ns. With the increase of ATP concentration, the lifetime of ATP-DNA-Ag NCs fluctuated slightly around 3.50 ns. Therefore, the interaction between ATP-DNA-Ag NCs and ATP is the result of a static process.

[0025] Example 3: Determination of reaction time: The reaction time of ATP-ATP-DNA-Ag NCs and 10 mM ATP was determined because it has a certain effect on ATP detection. The fluorescence intensity of ATP-ATP-DNA-Ag NCs first gradually increased, reached the maximum after 5 minutes, and remained unchanged within 1 hour, so 5 minutes was selected as the most appropriate reaction time for subsequent experiments.

[0026] Example 4: The steps of measuring ATP in diluted fetal bovine serum using fluorescence-enhanced G-rich-DNA protected silver nanoclusters are as follows: (1) Mix a DNA oligonucleotide (3 μM) with PBS (20 mM, pH = 7.0) buffer. The sequence of the DNA oligonucleotide is: 5´-cccttaatcccc ttttt aacctgggggagtattgcggaggaagg ttttt gggtggggtgggg-3´; (2) Add AgNO3 solution to the solution obtained in step (1) and mix well. Incubate the mixture in a dark place at 4°C for 20 minutes. Then add freshly prepared NaBH4 solution and stir thoroughly for 1 minute. Incubate the mixture in a dark place at 4°C for 1 hour. 3、 The final concentration ratio of NaBH4 was 1:6:6; (3) adding different concentrations of ATP added to 100-fold diluted fetal bovine serum to the DNA-Ag NCs solution prepared in (2) at room temperature, measuring its fluorescence spectrum, and drawing a standard curve based on the maximum fluorescence intensity of the emission wave; (4) The sample solution to be tested (different concentrations of ATP solution added to 100-fold diluted fetal bovine serum) is added to the DNA-Ag NCs prepared according to the steps of (1) and (2) and its fluorescence spectrum is measured to calculate the concentration of ATP.

[0027] Table 1 shows the detection of different concentrations of standard ATP added to fetal bovine serum diluted 100 times by the method of the present invention. The data in Table 1 show that the recovery rate of ATP in fetal bovine serum diluted 100 times by the method of the present invention is 99.5-101.7%, and the relative standard deviation is 1.05-1.95%.

[0028] Table 1 Detection of different concentrations of standard ATP solution added to diluted fetal bovine serum using the method of the present invention ( N = 3) a The average of three measurements; b Standard deviation.

[0029] Example 5: Selective Detection: To investigate the selectivity of the method for determining ATP based on fluorescence-enhanced G-rich-DNA silver nanoclusters, a comparative experiment was conducted according to the following steps: (1) Mix DNA oligonucleotide (3 μM) and PBS (20 mM, pH = 7.0) buffer; the sequence of DNA oligonucleotide is: 5´- cccttaatcccc ttttt aacctgggggagtattgcggaggaagg ttttt gggtggggtgggg-3´; (2) Add AgNO3 solution to the solution in (1) and mix well. Incubate the mixture in a dark place at 4°C for 20 minutes. Then add freshly prepared NaBH4 solution and stir thoroughly for 1 minute. Incubate the mixture in a dark place at 4°C for 1 hour. 3、 The final concentration ratio of NaBH4 was 1:6:6; (3) Add the interfering substances GTP, UTP, CTP and the reference substance ATP to the solution prepared in (2) at room temperature, and measure the fluorescence spectrum of the added sample solution. Figure 5 Figure 2 is a diagram for selective detection of ATP.

[0030] Depend on Figure 5 It can be seen that the addition of GTP, CTP and UTP has little effect on the fluorescence intensity of DNA-Ag NCs, indicating that the method has very good selectivity for detecting ATP. Since human serum contains ATP, the method of the invention can selectively simulate the detection of ATP in fetal bovine serum.

[0031] Compared with the fluorescence detection method using fluorescent organic small molecules and fluorophores labeled on aptamers, the synthesis process of fluorescent organic small molecules is complicated, and labeling fluorophores is also time-consuming and laborious. These processes are not only complicated but also affect the detection effect. In addition, this detection method has high sensitivity, with a minimum detection limit of 2.8 μM, which is lower than the minimum detection limit of the fluorescence detection method using DNA-Cu / Ag NCs and core-shell Ag@SiO2 nanosheets. Therefore, this detection method is superior to other methods.

[0032] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A fluorescence-enhanced G-rich-DNA protected silver nanocluster, characterized in that: The fluorescence enhanced G-rich-DNA protected silver nanocluster comprises: ATP, DNA templates with rich C nucleation sequence and rich G sequence, PBS buffer, AgNO3 and NaBH4 solution; wherein: the sequence of the DNA template is: 5´- cccttaatcccc ttttt aacctgggggagtattgcggaggaagg ttttt gggtggggtgggg-3´, wherein the first 12 nucleotides at the 5´ end are the C-rich nucleation sequence, the 18th to 44th nucleotides in the middle are the ATP aptamer, i.e., the oligonucleotide specifically recognized by ATP, and the 50th to 62nd nucleotides at the 3´ end are the G-rich sequence; the 13th to 17th and 45th to 49th nucleotides are the connecting parts of the ATP aptamer, the G-rich sequence, and the C-rich nucleation sequence; The concentrations of DNA template and ATP were 3 μM and 0-57 mM, respectively; The PBS buffer concentration is 20 mM, pH = 7.0; Control DNA template, AgNO 3、 The final concentration ratio of NaBH4 was 1:6:

6.

2. A method for preparing the fluorescence-enhanced G-rich-DNA protected silver nanoclusters according to claim 1, characterized in that: The steps include: (1) Mix the DNA oligonucleotide with 20 mM PBS buffer (pH 7.0) and stir evenly; the sequence of the DNA oligonucleotide is: 5´-cccttaatcccc ttttt aacctgggggagtattgcggaggaagg ttttt gggtggggtgggg-3´; (2) Add AgNO3 solution to the solution obtained in step (1), mix well, react in the dark at 4°C for 20 minutes, then add freshly prepared NaBH4 solution, stir thoroughly for 1 minute, react in the dark at 4°C for 1 hour, and obtain DNA-Ag NCs solution; wherein: DNA template, AgNO 3、 The final concentration ratio of NaBH4 was 1:6:

6.

3. The preparation method according to claim 2, characterized in that: The average particle size of the DNA-Ag NCs is about 2 nm.

4. The use of the fluorescence-enhanced G-rich-DNA protected silver nanoclusters obtained by the method of claim 2 in ATP detection, characterized in that: The steps include: (1) adding different concentrations of ATP to the DNA-Ag NCs solution at room temperature, measuring the fluorescence spectra of the sample solutions at different concentrations, and drawing a standard curve according to the maximum fluorescence intensity of the emission wave; (2) Adding the sample solution to be tested into the DNA-Ag NCs solution, measuring its fluorescence spectrum, and calculating the concentration of ATP.

Images