Application of HIF-1alpha protein in promoting formation of tunnel nanotubes among bladder tumor cells

Abstract

The invention provides application of HIF-1alpha protein in promoting formation of tunnel nanotubes among bladder tumor cells, and belongs to the technical field of biomedicine, and the application comprises the following steps: constructing an overexpression vector of HIF-1alpha, and transfecting the overexpression vector of HIF-1alpha into T24 cells. According to the invention, the formation of the TNTs between the bladder tumor cells T24 can be artificially regulated and controlled, so that the formation of the TNTs between the T24 cells is relatively stable, the quantity of the TNTs is enough, and the research difficulty of the TNTs can be greatly reduced. Standard data can be provided for identification of the TNTs by collecting TNTs structures for genomics analysis or proteomics analysis, and a basis is provided for researching a specific mechanism for formation of the TNTs. In combination with the promotion function of TNTs on tumor cells, a research direction is provided for targeted therapy of tumors. Meanwhile, the TNTs have the function of transferring cell components to repair target cells, and how to promote the formation of the TNTs in normal tissues can be researched, so that the effect of repairing damaged cells is achieved.

Description

Technical Field

[0001] The invention belongs to the field of biomedical technology, and more specifically, relates to the application of HIF-1α protein in promoting the formation of tunnel nanotubes between bladder tumor cells. Background Art

[0002] The formation of tunneling nanotubes (TNTs) between bladder cancer cells helps to improve the invasive ability of bladder cancer. The formation of TNTs mainly occurs between T24 cells or from T24 cells to RT4 cells.

[0003] At present, there are few studies on TNTs, and the research is not in-depth enough. There are no clear markers or standard data such as ingredient lists for the identification of TNTs, and the mechanism of TNT formation is unclear. Research on TNTs is mainly focused on the cell level, that is, passive observation and detection of TNTs formed between cells. However, the formation of TNTs between cells is very random. Some cells may form multiple TNTs, and some cell regions may not have TNTs formed. This characteristic makes research on TNTs difficult.

[0004] If the formation of TNTs can be artificially regulated so that the formation of TNTs between cells is relatively stable and sufficient in number, the difficulty of studying TNTs can be greatly reduced. Summary of the invention

[0005] The purpose of the present invention is to provide an application of HIF-1α protein in promoting the formation of tunnel nanotubes between bladder tumor cells, so as to artificially regulate the formation of TNTs, make the formation of TNTs between cells relatively stable, and the number is sufficient, thereby reducing the difficulty of TNTs research.

[0006] To achieve the above object, the present invention provides the use of HIF-1α protein in promoting the formation of tunnel nanotubes between bladder tumor cells, comprising the following steps: constructing an overexpression vector of HIF-1α, and transfecting the HIF-1α overexpression vector into T24 cells.

[0007] Furthermore, the method for constructing the HIF-1α overexpression vector comprises the following steps:

[0008] The HIF-1α protein gene was synthesized and constructed into the eukaryotic overexpression vector pcDNA3.1.

[0009] Furthermore, the culture medium used in the transfection process is Culture medium.

[0010] Furthermore, the transfection reagent used in the transfection process is

[0011] Furthermore, the transfection process comprises the following steps:

[0012] 1) Before transfection, seed T24 cells in serum-containing medium without antibiotics;

[0013] 2) Dilute the transfection reagent using culture medium;

[0014] 3) diluting the HIF-1α overexpression vector using culture medium;

[0015] 4) adding the diluted HIF-1α overexpression vector to the diluted transfection reagent, incubating at 20-35° C. for 3-10 min to obtain a DNA-liposome complex;

[0016] 5) Add the DNA-liposome complex to the T24 cells in step 1) and incubate at 36-37° C. for 20-36 h.

[0017] Compared with the prior art, the present invention has the following technical effects:

[0018] The present invention can artificially regulate the formation of TNTs between bladder tumor cells T24 cells by constructing an overexpression vector of HIF-1α and transfecting the overexpression vector of HIF-1α into T24 cells, so that the formation of TNTs between T24 cells is relatively stable and the number is sufficient, which can greatly reduce the difficulty of studying TNTs. By collecting TNTs structure for genomic analysis or proteomics analysis, standard data can be provided for the identification of TNTs, and a basis can be provided for studying the specific mechanism of TNTs formation. Combined with the promotion function of TNTs on tumor cells, a research direction is provided for the targeted treatment of tumors. At the same time, TNTs have the function of transferring cell components to repair target cells, and it can be studied how to promote the formation of TNTs in normal tissues to achieve the effect of repairing damaged cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0020] Figure 1 A comparison chart of the expression of HIF-1α and the number of TNTs formed in T24 cells and RT4 cells provided in Example 1 of the present invention;

[0021] Figure 2A comparison chart of the results of the scratch test, Transwell test, and the number of TNTs formed by T24 cells and HIF-1α-T24 cells provided in Example 2 of the present invention;

[0022] Figure 3 A comparison chart of the expression levels of genes related to TNTs formation in T24 cells and HIF-1α-T24 cells provided in Example 3 of the present invention;

[0023] Figure 4 Comparison of the results of the scratch test, Transwell test, and the number of TNTs formed by T24 cells and si-HIF-1α-T24 cells provided in Example 4 of the present invention;

[0024] Figure 5 This is a comparison chart of the expression levels of genes related to TNTs formation in T24 cells and si-HIF-1α-T24 cells provided in Example 5 of the present invention. DETAILED DESCRIPTION

[0025] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0026] It should be understood that in various embodiments of the present invention, the size of the serial number of each process does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present invention.

[0027] The terms used in the embodiments of the present invention are only for the purpose of describing specific embodiments, and are not intended to limit the present invention. The singular forms "a", "said" and "the" used in the embodiments of the present invention and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0028] Example 1

[0029] Bladder tumor cells T24 cells and RT4 cells were used as research objects to detect the expression of HIF-1α and the number of TNTs formed in T24 cells and RT4 cells respectively:

[0030] (1) T24 cells and RT4 cells were cultured in confocal dishes at 37°C and 5% CO. 2The cells were cultured in an incubator for 24 h, and then the mitochondria were labeled with Mito-Tracker Red, the cytoskeleton protein fibrous actin (F-actin) was labeled with Actin-Tracker Green, and the nucleus was stained with DAPI. The formation and number of intercellular TNTs were observed under a laser confocal microscope.

[0031] Observation results such as Figure 1 As shown in A, the white arrow in the figure points to the TNTs structure. Figure 1 As shown in A, TNTs were observed to form between T24 cells, but not between RT4 cells.

[0032] (2) T24 cells and RT4 cells were cultured in confocal dishes at 37°C and 5% CO. 2 The cells were cultured in an incubator until the logarithmic growth phase and then collected. RNA was extracted using the Shanghai Feijie RNAfast20 kit and real-time fluorescence quantitative PCR was used to detect the expression of intracellular HIF-1α.

[0033] Test results such as Figure 1 As shown in B, Figure 1 As shown in B, the expression of HIF-1α in T24 cells was significantly higher than that in RT4 cells.

[0034] Example 2

[0035] Overexpression of HIF-1α gene in T24 cells to detect changes in cell invasion ability and the number of TNTs between T24 cells:

[0036] (1) The HIF-1α gene was synthesized in vitro and constructed into the eukaryotic overexpression vector pcDNA3.1 to form an HIF-1α overexpression vector. The gene sequence of the synthesized HIF-1α gene was:

[0037] ATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAAAGATAAGTTCTG

[0038] AACGTCGAAAAGAAAAGTCTCGAG

[0039] ATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTTTTTTATGAG

[0040] CTTGCTCATCAGTTGCCACTTCC

[0041] ACATAATGTGAGTTCGCATCTTGATAAGGCCTCTGTGATGAGGCTTAC

[0042] CATCAGCTATTTGCGTGTGAGG

[0043] AAACTTCTGGATGCTGGTGATTTGGATATTGAAGATGACATGAAAGC

[0044] ACAGATGAATTGCTTTTATTTGA

[0045] AAGCCTTGGATGGTTTTGTTATGGTTCTCACAGATGATGGTGACATGA

[0046] TTTACATTTCTGATAATGTGAA

[0047] CAAATACATGGGATTAACTCAGTTTGAACTAACTGGACACAGTGTGT

[0048] TTGATTTTACTCATCCATGTGAC

[0049] CATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAA

[0050] AAAGGGTAAAGAACAAAACACAC

[0051] AGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACTAGCCGAGGA

[0052] AGAACTATGAACATAAAGTCTGC

[0053] AACATGGAAGGTATTGCACTGCACAGGCCACATTCACGTATATGATAC

[0054] CAACAGTAACCAACCTCAGTGT

[0055] GGGTATAAGAAACCACCTATGACCTGCTTGGTGCTGATTTGTGAACCC

[0056] ATTCCTCACCCATCAAATATTG

[0057] AAATTCCTTTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATA

[0058] TGAAATTTTCTTATTGTGATGA

[0059] AAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCC

[0060] GCTCAATTTATGAATATTATCAT

[0061] GCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTTACTA

[0062] AAGGACAAGTCACCACAGGAC

[0063] AGTACAGGATGCTTGCCAAAAAGAGGTGGATATGTCTGGGTTGAAACT

[0064] CAAGCAACTGTCATATATAACAC

[0065] CAAGAATTCTCAACCACAGTGCATTGTATGTGTGAATTACGTTGTGAG

[0066] TGGTATTATTCAGCACGACTTG

[0067] ATTTTCTCCCTTCAACAAACAGAATGTGTCCTTAAACCGGTTGAATCT

[0068] TCAGATATGAAATGACTCAGC

[0069] TATTCACCCAAAGTTGAATCAGAAGATACAAGTAGCCTCTTTGACAAA

[0070] CTTAAGAAGGAACCTGATGCTTT

[0071] ACATTTGCTGGCCCCAGCCGCTGGAGACACAATCATATCTTTAGATTT

[0072] TGGCAGCAACGACACAGAAACT

[0073] GATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTC

[0074] CCCTCACCCAACGAAAAATTAC

[0075] AGAATAAAATTTGGCAATGTCTCCATTACCCACCGCTGAAACGCCAA

[0076] AGCCACTTCGAAGTAGTGCTGA

[0077] CCCTGCACTCAATCAAGAAGTTGCATTAAAATTAGAACCAAATCCAG

[0078] AGTCACTGGAACTTTCTTTTACC

[0079] ATGCCCCAGATTCAGGATCAGACACCTAGTCCTTCCGATGGAAGCAC

[0080] TAGACAAAGTTCACCTGAGCCTA

[0081] ATAGTCCCAGTGAATATTGTTTTTATGTGGATAGTGATATGGTCAATGA

[0082] ATTCAAGTTGGAATTGGTAGA

[0083] AAAACTTTTTGCTGAAGACACAGAGCAAAAGAACCCATTTTCTACTC

[0084] AGGACACAGATTTAGACTTGGAG

[0085] ATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCCT

[0086] TCGATCAGTTGTCACCATTAG

[0087] AAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCACAGT

[0088] TACAGTATTCCAGCAGACTCAAAT

[0089] ACAAGAACCTACTGCTAATGCCACCACTACCACTGCCACCACTGATG

[0090] AATTAAAAACAGTGACAAAAGAC

[0091] CGTATGGAAGACATTAAAATATTGATTGCATCTCCATCTCCTACCCACA

[0092] TACATAAAGAAACTACTAGTG

[0093] CCACATCATCACCATATAGATACTCAAAGTCGGACAGCCTCACCA

[0094] AACAGGCAGGAAAAGGAGTCAT

[0095] AGAACAGACAGAAATCTCATCCAAGAAGCCCTAACGTGTTATCTG

[0096] TCGCTTTGAGTCAAAGAACTACA

[0097] GTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGC

[0098] TCAGAGAAAGCGAAAAATGGAAC

[0099] ATGATGGTTCACTTTTTCAAGCAGTAGGAATTGGAACATTACAGC

[0100] AGCCAGACGATCATGCAGCTAC

[0101] TACATCACTTTCTTGGAAACGTGTAAAAGGATGCAAATCTAGTGAAC

[0102] AGAATGGAATGGAGCAAAAGACA

[0103] ATTATTTTAATACCCTCTGATTTAGCATGTAGACTGCTGGGGCAATCAA

[0104] TGGATGAAAGTGGATTACCAC

[0105] AGCTGACCAGTTATGATTGTGAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACTGCAGGGTGAAGA

[0106] ATTACTCAGAGCTTTGGATCAAGTTAACTGA。

[0107] It should be noted here that the HIF-1α gene can also be purchased.

[0108] (2) The HIF-1α overexpression vector was transfected into T24 cells using the Lipofectamine 2000 kit (Invitrogen). The specific steps are as follows:

[0109] 1) 24 h before transfection, inoculate 1×10 5 T24 cells;

[0110] 2) Use 50 μL 5 μL of culture medium dilution Transfection reagents;

[0111] 3) Use 250 μL Dilute 5 μg DNA (DNA is the HIF-1α overexpression vector in step (1)) with culture medium;

[0112] 4) Add the diluted DNA to the diluted Incubate in transfection reagent (volume ratio 1:1) at room temperature (20-35°C) for 5 minutes to obtain DNA-liposome complexes;

[0113] 5) Add the DNA-liposome complex to the T24 cells in step 1) (50 μL / well of DNA-liposome complex in a 24-well plate) and incubate at 37° C. for 24 h.

[0114] (3) After incubation for 24 h, the cells were collected and extracted for scratch test, Transwell test, and detection of the number of TNTs formed. The test results were as follows: Figure 2 As shown, Figure 2 In the figure, HIF-1α-T24 represents T24 cells that overexpress the HIF-1α gene.

[0115] exist Figure 2 In the figure, a, b, c, and d are the results of the scratch experiment: a and b are the cell scratch images of T24 cells and HIF-1α-T24 cells taken under a microscope at 0 hours, respectively; c and d are the cell scratch images of T24 cells and HIF-1α-T24 cells taken under a microscope after 24 hours, respectively. The scale bar in the figure is 50 μm.

[0116] exist Figure 2 In the figure, e and f are Transwell experimental images of T24 cells and HIF-1α-T24 cells, respectively. The results show that the number of HIF-1α-T24 cells passing through Matrigel is significantly greater than that of T24 cells. The scale bar in the figure is 50 μm.

[0117] The results of scratch assay and Transwell assay confirmed that the invasive ability of HIF-1α-T24 cells was significantly enhanced compared with that of T24 cells.

[0118] exist Figure 2 In the figure, g and f are images of T24 cells and HIF-1α-T24 cells cultured in a confocal dish for 24 hours, respectively, with Mito-Tracker Red used to label the mitochondria and Actin-Tracker Green used to label the cytoskeleton, and then with DAPI to stain the nucleus. The images were taken under a fluorescence confocal microscope to observe the number of TNTs formed between T24 cells. The scale bar in the figure is 25 μm. The results showed that the number of TNTs formed between HIF-1α-T24 cells was significantly higher than that of T24 cells ( Figure 2 In g and 2f, the white arrows point to the TNTs structure).

[0119] Example 3

[0120] Overexpression of HIF-1α gene in T24 cells, detection of changes in genes related to TNTs formation in cells: ACTN3, EHD1, M-sec, N-Cadherin, β-catenin:

[0121] T24 cells and HIF-1α-T24 cells were cultured in confocal dishes, and 1 μg of total RNA was extracted from each sample using Trizol reagent (Invitgen). cDNA was prepared using a reverse transcription system (PROMEGA). The relative mRNA expression level was detected using SYBR PreMix (TakaraBio, RR420A) real-time quantitative polymerase chain reaction and Thermo Fisher QSDX real-time quantitative polymerase chain reaction system. The test results are shown in Figure 3 shown.

[0122] exist Figure 3In the figure, a is the expression of ACTN3 detected by real-time fluorescence quantitative PCR in T24 cells and HIF-1α-T24 cells, and the results showed that the expression of ACTN3 in HIF-1α-T24 cells was significantly higher than that in T24 cells (p=0.0002); b is the expression of EHD1 detected by real-time fluorescence quantitative PCR in T24 cells and HIF-1α-T24 cells, and the results showed that the expression of EHD1 in HIF-1α-T24 cells was significantly higher than that in T24 cells (p<0.0001); c is the expression of M-sec detected by real-time fluorescence quantitative PCR in T24 cells and HIF-1α-T24 cells, and the results showed that M-sec was expressed in HIF-1α-T24 cells. The expression of IF-1α-T24 cells was significantly higher than that of T24 cells (p=0.0002); d is the expression of N-Cadherin in T24 cells and HIF-1α-T24 cells detected by real-time fluorescence quantitative PCR, and the results showed that the expression of N-Cadherin in HIF-1α-T24 cells was significantly higher than that of T24 cells (p<0.0001); e is the expression of β-catenin in T24 cells and HIF-1α-T24 cells detected by real-time fluorescence quantitative PCR, and the results showed that the expression of β-catenin in HIF-1α-T24 cells was significantly higher than that of T24 cells (p<0.0001).

[0123] Figure 3 The detection results showed that after HIF-1α was overexpressed, the expression of TNTs formation-related genes (ACTN3, EHD1, M-sec, N-Cadherin, β-catenin) was significantly increased.

[0124] Example 4

[0125] Silencing the HIF-1α gene in T24 cells and detecting changes in cell invasion ability and the number of TNTs between cells:

[0126] (1) The HIF-1α siRNA gene was synthesized in vitro and constructed into the eukaryotic overexpression vector pcDNA3.1 to form a si-HIF-1α vector. The sequence of the HIF-1α siRNA gene is:

[0127] 5′-GAACGTCGAAAAGAACGTT-3′;

[0128] Antisense: 5'-AACGTTCTTTTCGACGTTC-3'.

[0129] (2) The si-HIF-1α vector was transfected into T24 cells using the Lipofectamine 2000 (Invitrogen) kit. The specific steps are as follows:

[0130] 1) 24 h before transfection, inoculate 1×10 5 T24 cells;

[0131] 2) Use 50 μL 2 μL of culture medium dilution Transfection reagents;

[0132] 3) Use 250 μL 5 μg of si-RNA (i.e., si-HIF-1α vector) was diluted in culture medium;

[0133] 4) Add the diluted si-RNA to the diluted The cells were incubated in a transfection reagent (volume ratio 1:1) at room temperature for 5 min to obtain si-RNA-liposome complexes;

[0134] 5) Add the si-RNA-liposome complex to T24 cells (100 μL / well of si-RNA-liposome complex in a 24-well plate) and incubate at 37° C. for 24 h.

[0135] (3) After incubation for 24 h, the cells were collected and extracted for scratch test, Transwell test, and detection of the number of TNTs formed. The test results were as follows: Figure 4 As shown, Figure 4 In the figure, si-HIF-1α-T24 represents T24 cells with silenced HIF-1α gene.

[0136] exist Figure 4 In the figure, a, b, c, and d are the results of the scratch experiment: a and b are the cell scratch images of T24 cells and si-HIF-1α-T24 cells taken under a microscope at 0 hours, respectively; c and d are the cell scratch images of T24 cells and si-HIF-1α-T24 cells taken under a microscope after 24 hours, respectively. The scale bar in the figure is 100 μm.

[0137] exist Figure 4 In the figure, e and f are Transwell experimental images of T24 cells and si-HIF-1α-T24 cells, respectively. The results show that the number of T24 cells passing through Matrigel is significantly greater than that of si-HIF-1α-T24 cells. The scale bar in the figure is 100 μm.

[0138] The results of scratch assay and Transwell assay confirmed that the invasive ability of si-HIF-1α-T24 cells was significantly weakened compared with T24 cells.

[0139] exist Figure 4In the figure, g and f are images of T24 cells and si-HIF-1α-T24 cells cultured in a confocal dish for 24 hours, respectively, with Mito-Tracker Red used to label the mitochondria and Actin-Tracker Green used to label the cytoskeleton, and then with DAPI to stain the nucleus. The images were taken under a fluorescence confocal microscope to observe the number of TNTs formed between T24 cells. The scale bar in the figure is 25 μm. The results showed that the number of TNTs formed between T24 cells was significantly greater than that between si-HIF-1α-T24 cells ( Figure 4 g, 4f, the white arrows point to the TNTs structure).

[0140] Example 5

[0141] Silencing the HIF-1α gene in T24 cells, detecting the changes in genes related to TNTs formation in cells: ACTN3, EHD1, M-sec, N-Cadherin, and β-catenin:

[0142] T24 cells and si-HIF-1α-T24 cells were cultured in confocal dishes, and 1 μg of total RNA was extracted from each sample using Trizol reagent (Invitgen). cDNA was prepared using a reverse transcription system (PROMEGA). The relative mRNA expression level was detected using SYBR PreMix (Takara Bio, RR420A) real-time quantitative polymerase chain reaction and Thermo Fisher QSDX real-time quantitative polymerase chain reaction system. The test results are shown in Figure 5 shown.

[0143] exist Figure 5In the figure, a is the expression of ACTN3 detected by real-time fluorescence quantitative PCR in T24 cells and si-HIF-1α-T24 cells, and the results showed that the expression of ACTN3 in T24 cells was significantly higher than that in si-HIF-1α-T24 cells (p=0.0004); b is the expression of EHD1 detected by real-time fluorescence quantitative PCR in T24 cells and si-HIF-1α-T24 cells, and the results showed that the expression of EHD1 in T24 cells was significantly higher than that in si-HIF-1α-T24 cells (p<0.0001); c is the expression of M-sec detected by real-time fluorescence quantitative PCR in T24 cells and si-HIF-1α-T24 cells, and the results showed that M-sec in T The expression of N-Cadherin in T24 cells was significantly higher than that in si-HIF-1α-T24 cells (p<0.0001); d is the expression of N-Cadherin detected by real-time fluorescence quantitative PCR in T24 cells and si-HIF-1α-T24 cells, and the results showed that the expression of N-Cadherin in T24 cells was significantly higher than that in si-HIF-1α-T24 cells (p<0.0001); e is the expression of β-catenin detected by real-time fluorescence quantitative PCR in T24 cells and si-HIF-1α-T24 cells, and the results showed that the expression of β-catenin in T24 cells was significantly higher than that in si-HIF-1α-T24 cells (p=0.0001).

[0144] Figure 5 The detection results showed that after HIF-1α was silenced, the expression of TNTs formation-related genes (ACTN3, EHD1, M-sec, N-Cadherin, β-catenin) was significantly reduced.

[0145] The examples of the present invention show that HIF-1α is highly expressed in bladder cancer tissues and is involved in the occurrence and invasion of bladder cancer; and HIF-1α has the function of promoting the invasion and metastasis of bladder cancer cells, and its mechanism of occurrence is related to HIF-1α promoting the expression of genes related to TNTs formation (ACTN3, EHD1, M-sec, N-Cadherin, β-catenin), thereby inducing the formation of tunnel nanotubes between bladder tumor cells. Therefore, HIF-1α can be used as a biomarker for the diagnosis, treatment and / or prognosis evaluation of bladder cancer.

[0146] The above embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several modifications and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the attached claims.

Claims

1. The use of HIF-1α protein in promoting the formation of tunnel nanotubes between bladder tumor cells, characterized in that: The following steps are involved: A HIF-1α overexpression vector was constructed and transfected into T24 cells.

2. The use of HIF-1α protein in promoting the formation of tunnel nanotubes between bladder tumor cells according to claim 1, characterized in that: The method for constructing the HIF-1α overexpression vector comprises the following steps: The HIF-1α protein gene was synthesized and constructed into the eukaryotic overexpression vector pcDNA3.

1.

3. The use of HIF-1α protein in promoting the formation of tunnel nanotubes between bladder tumor cells according to claim 1, characterized in that: The culture medium used in the transfection process was Culture medium.

4. The use of HIF-1α protein in promoting the formation of tunnel nanotubes between bladder tumor cells according to claim 1, characterized in that: The transfection reagent used in the transfection process is 5. Use of the HIF-1α protein according to any one of claims 1 to 4 in promoting the formation of tunnel nanotubes between bladder tumor cells, characterized in that: The transfection process comprises the following steps: 1) Before transfection, seed T24 cells in serum-containing medium without antibiotics; 2) Dilute the transfection reagent using culture medium; 3) diluting the HIF-1α overexpression vector using culture medium; 4) adding the diluted HIF-1α overexpression vector to the diluted transfection reagent, incubating at 20-35° C. for 3-10 min to obtain a DNA-liposome complex; 5) Add the DNA-liposome complex to the T24 cells in step 1) and incubate at 36-37° C. for 20-36 h.

Images