Genetic engineering strain for directionally producing PoTeMs compound and application thereof

Abstract

The invention discloses a gene engineering strain for directionally producing a PoTeMs compound and application of the gene engineering strain. The gene engineering strain 306A is characterized in that the gene engineering strain 306A is obtained by deleting an interference gene segment in a mutant strain delta BC306 of streptomyces sp. ZJ306 through a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated protein 9) gene editing method, and the interference gene segment is positioned between ika A and orf (-1). According to the invention, a gene segment (about 11.1 kb, including an ikaD gene) between ikaA and Orf (-1) in an engineering strain delta BC306 (Chinese patent of invention ZL202010086255. X) constructed at an earlier stage is further knocked out by a CRISPR-Cas9 method, only the ikaA for producing a common polyene precursor 1 is reserved, a new chassis host 306A is obtained, and the polyene precursor compound polyene precursor 1 can be efficiently prepared from a fermentation culture of the new chassis host 306A.

Description

Technical Field

[0001] The invention belongs to the field of industrial microorganisms, and specifically relates to a preparation method and application of a genetic engineering strain for directed production of polycyclic tetra mate macrolactam (PoTeMs) compounds. Background Art

[0002] Polycyclic tetramate macrolactams (PoTeMs) are natural products with unique chemical structures. Their macrolactam rings contain a pyrrolidine-2,4-dione (tetramate) and a fused polycyclic carbon ring structural unit. According to the types of polycyclic carbon rings, PoTeMs are mainly divided into 5 / 6 / 5 ring type, 5 / 5 / 6 ring type and 5 / 5 ring type. Among them, 5 / 5 / 6 ring and 5 / 5 ring polycyclic carbon rings are reported to have a variety of cyclization and stereo configuration types. Pharmacological studies have shown that PoTeMs have antibacterial, antifungal, antiviral, antitumor and antiprotozoal activities, and have great potential for application in agriculture and medicine. Among them, HSAF (Dihydromaltophilin) ​​of type 5 / 5 / 6 has been developed as a new type of biopesticide, which inhibits plant pathogenic fungi by specifically interfering with the synthesis of pathogenic sphingolipids, has no side effects on mammals and plants, and is expected to become a new generation of fungicides or antifungal drugs; pactamide C and aburabubolactam E of type 5 / 5, pactamide A and maltophilins of type 5 / 5 / 6, and ikarugamycin of type 5 / 6 / 5 all show tumor cell toxicity and selectivity similar to that of the positive drug cisplatin; ikarugamycin also has significant antiprotozoal and anti-methicillin-resistant Staphylococcus aureus (MRSA) activity. Due to the complex chiral centers and functional groups of PoTeMs, especially the polycyclic carbon rings with complex stereo configurations, the chemical total synthesis of PoTeMs has many steps and low yields; at the same time, the fermentation production of PoTeMs of wild-type strains faces the problem of silencing of biosynthetic gene clusters and the production of only one PoTeM polycyclic carbon ring skeleton by a single strain, which limits the high-yield and directional production of PoTeMs-type drug-derived compounds.

[0003] The biosynthesis of PoTeMs compounds has a characteristic: their biosynthesis starts from the same polyene precursor catalyzed by PKS / NRPS, and then 1-3 flavin cyclases catalyze the linear polyene precursor to form 5-type, 5 / 5-type and 5 / 6-type ring systems, and 1 alcohol dehydrogenase further catalyzes the internal 6-membered or 5-membered ring to form 5 / 5 / 6-type and 5 / 6 / 5-type ring systems. Based on this concise and conservative biosynthetic feature, different types of PoTeMs can be customized through the combination strategy of PoTeMs biosynthetic gene clusters with different polybasic skeletons. However, there is still a lack of efficient and clean chassis hosts for heterologous expression of PoTeMs gene clusters. In the early stage, we constructed a chassis host ΔBC306 by knocking out the cyclase genes ikaB and ikaC in the ikarugamycin production host Streptomyces sp. ZJ306, and proved through the combination of downstream genes that the biosynthesis of different ring-type PoTeMs originated from the same polyene precursor. However, the cytochrome P450 enzyme gene ikaD is retained in the ΔBC306 chassis host, which causes unnecessary oxidative modification of PoTeMs biosynthetic intermediates. Summary of the invention

[0004] The first object of the present invention is to provide a genetically engineered strain 306A for the directional production of a polyene precursor for the biosynthesis of PoTeMs, which is a genetically engineered strain 306A obtained by deleting an interfering gene fragment in a mutant strain ΔBC306 of Streptomyces sp. ZJ306 by a CRISPR-Cas9 method, wherein the interfering gene fragment is located between ikaA and orf(-1) and has a size of 11.158 kb, as shown in the attached Figure 2 shown.

[0005] Preferably, the CRISPR-Cas9 knockout plasmid pCSG8006 is digested with nucleases BamHI and HindIII to obtain two fragments pCas9F1 and pCas9F2, and the fragments sgRNA, UHA, DHA, pCas9F1 and pCas9F2 are connected end to end to obtain the CRISPR-Cas9 knockout plasmid pCSG7021 of the clean chassis host 306A, and the plasmid pCSG7021 is transformed into Escherichia coli E.coliET12567 / pUZ8002 to obtain E.coli ET12567 / pUZ8002 / pCSG7021, that is, used as the donor strain for conjugation transfer, and the ikaB and ikaC double gene deletion mutant clean chassis host Streptomyces sp.△BC306 is used as the recipient strain for conjugation transfer, and conjugation transfer is performed to obtain the genetically engineered strain 306A, and the nucleotide sequences of the sgRNA, UHA, and DHA are as shown in SEQ ID Shown as NO.1, 2 and 3.

[0006] The second object of the present invention is to provide the use of the genetically engineered strain 306A in the preparation of the polyene tetramate precursor compound polyene tetramate precursor 1 for the co-biosynthesis of PoTeM compounds;

[0007] The structure of the polyene tetramate precursor 1 of the PoTeM compound co-biosynthesized

[0008] The formula is shown in formula (1);

[0009]

[0010] The third object of the present invention is to provide a production strain 306A::ptmB1B2C, which is obtained by inserting the gene fragment ptmB1B2C into the genetically engineered strain 306A, and the nucleotide sequence of the gene fragment ptmB1B2C is shown in SEQ ID NO.4.

[0011] Preferably, the gene fragment ptmB1B2C and the promoter gene fragment ermE*p are connected to the vector pSET152 linearized with restriction endonucleases XbaI / BcuI to obtain plasmid pCSG7022, and the plasmid pCSG7022 is transformed into Escherichia coli E.coli ET12567 / pUZ8002 to obtain E.coli ET12567 / pUZ8002 / pCSG7022, which is used as the donor bacteria for conjugative transfer, and the genetically engineered strain 306A is used as the recipient bacteria for conjugative transfer to obtain the production strain 306A::ptmB1B2C. The nucleotide sequence of the promoter gene fragment ermE*p is shown in SEQ ID NO.8.

[0012] The fourth object of the present invention is to provide a method and application of producing strain 306A::ptmB1B2C in preparing 5-membered ring, 5 / 5 ring and 5 / 5 / 6 ring pactamides PoTeM compounds;

[0013] The structural formula of the 5-membered ring type, 5 / 5 ring type and 5 / 5 / 6 ring type pactamides PoTeM compounds is as shown in formula (2):

[0014] As shown in compound 2-4;

[0015]

[0016] The fifth object of the present invention is to provide a production strain 306A::flaB1B2CD, which is obtained by inserting the gene fragment flaB1B2CD into the genetically engineered strain 306A, and the nucleotide sequence of the gene fragment flaB1B2CD is shown in SEQ ID NO.9.

[0017] Preferably, the gene fragment ptmB1B2C and the promoter gene fragment ermE*p are connected to the vector pSET152 linearized with restriction endonucleases XbaI / BcuI to obtain plasmid pCSG7022, and the plasmid pCSG7022 is transformed into Escherichia coli E.coli ET12567 / pUZ8002 to obtain E.coli ET12567 / pUZ8002 / pCSG7022, which is used as the donor bacteria for conjugative transfer, and the genetically engineered strain 306A is used as the recipient bacteria for conjugative transfer to obtain the production strain 306A::ptmB1B2C. The nucleotide sequence of the promoter gene fragment ermE*p is shown in SEQ ID NO.8.

[0018] The sixth object of the present invention is to provide a method and application of the production strain 306A::flaB1B2CD in the preparation of 5 / 5 cyclic and 5 / 5 / 6 cyclic PoTeM compounds with oxidation modification at the C14 position;

[0019] The structural formula of the 5 / 5-ring and 5 / 5 / 6-ring PoTeM compounds with oxidation modification at the C14 position is as shown in formula (3):

[0020] As shown in compound 5-9;

[0021]

[0022] The original strain Streptomyces sp. ZJ306 of the present invention is a marine streptomyces derived from the sediments of the Pearl River Estuary, which contains a mycotoxin biosynthetic gene cluster (Genbank accession number: KF954540) and can efficiently produce 5 / 6 / 5-cyclic mycotoxin-type PoTeM compounds, wherein the mycotoxin biosynthetic gene cluster has been applied for authorized patent ZL20141020626.6. The biosynthesis principle of Ikarugamycin and other Potemin compounds shows that the different polycyclic carbocyclic types of Potemin compounds are derived from the same polyene precursor 1 formed by PKS / NRPS catalysis (References: Zhang, G.; Zhang, W.; Zhang, Q.; Shi, T.; Ma, L.; Zhu, Y.; Li, S.; Zhang, H.; Zhao, Y.L.; Shi, R.; Zhang, C. Mechanistic insights into polycycle formation by reductive cyclization inikarugamycin biosynthesis. Angew Chem Int Ed Engl 2014, 53, 4840-4844. Jin, H.; Zhang, W.; Zhang, G.; Zhang, L.; Liu, W.; Zhang, C. Engineered Biosynthesis of 5 / 5 / 6Type Polycyclic Tetramate Macrolactams in an Ikarugamycin(5 / 6 / 5Type)-Producing Chassis. Org Lett 2020, 22, 1731-1735.), 1-3 flavin cyclases catalyze the linear polyene precursor 1 to form 5-type, 5 / 5-type and 5 / 6-type ring systems, and 1 alcohol dehydrogenase further catalyzes the internal 6-membered or 5-membered ring to form 5 / 5 / 6-type and 5 / 6 / 5-type ring systems. This concise and conservative biosynthetic logic is the theoretical basis of the present invention.

[0023] The present invention further knocks out the gene fragment (about 11.1 kb, including the ikaD gene) between ikaA and Orf(-1) in the previously constructed engineered strain ΔBC306 (Chinese invention patent ZL202010086255.X) by the CRISPR-Cas9 method, retaining only ikaA for producing the common polyene precursor 1, thereby obtaining a new chassis host 306A, from which the fermentation culture can efficiently prepare the above-mentioned compound polyene precursor compound polyene tetramate precursor (1) ( Figure 3). The original ΔBC306 chassis host retained the cytochrome P450 enzyme gene ikaD, which would perform unnecessary oxidative modifications on the PoTeMs synthesized by gene combination in the next step (references: Jiang, P.; Jin, HB; Zhang, GT; Zhang, WJ; Liu, W.; Zhu, YG; Zhang, CS; Zhang, LPA Mechanistic Understanding of the Distinct Regio-and Ch emoselectivity of Multifunctional P450s by Structural Comparison of IkaD and CftA Compl exed with Common Substrates. Angew Chem IntEd 2023, 62. e202310728), interfering with the directed biosynthesis of PoTeMs-like compounds. The new chassis host 306A solved this problem by deleting the gene fragment where ikaD is located. By sequentially assembling flavin cyclase, alcohol dehydrogenase and cytochrome P450 enzymes from different types of PoTeM biosynthetic gene clusters into the genetically engineered strain 306A for heterologous expression, different types of PoTeM compounds can be produced in a directed manner. In the application case of the genetically engineered strain 306A listed in the present invention, the first flavin cyclase gene ptmB2, the second flavin cyclase gene ptmB1 and the alcohol dehydrogenase gene ptmC from the ptm gene cluster of S.pactum SCSIO 02999 are sequentially introduced to obtain 5-membered ring type, 5 / 5 ring type and 5 / 5 / 6 ring type pactamides PoTeM compounds ( Figure 4 ); the first flavin cyclase gene flaB2, the second flavin cyclase gene flaB1, the alcohol dehydrogenase gene flaC and the P450 enzyme gene flaD from the PoTeMs gene cluster fla (Gen bank accession number: PP539903) in the South China Sea actinomycete Streptomyces flavogriseusSCSIO 40032 were sequentially introduced to obtain pactamide E, 5 / 5 cyclic and 5 / 5 / 6 cyclic PoTeM compounds 5-9 with oxidation modification at C14 position, respectively ( Figure 5 The structure of the compound is determined based on the HPLC reference and characteristic UV absorption value of the standard, combined with our previous research experience on this series of compounds in patents and papers.

[0024] The invention also provides the use of cytochrome P450 oxidase FlaD in the PoTeMs biosynthetic gene cluster fla (Genbank accession number: PP539903) from Streptomyces flavogriseus SCSIO 40032 in the directed production of 5 / 5 annular and 5 / 5 / 6 annular PoTeM compounds with oxidation modification at the C14 position.

[0025] The nucleotide sequence provided by the present invention or at least part of the nucleotide sequence can be modified or mutated in vivo or in vitro, including insertion, substitution or deletion, polymerase chain reaction, error-mediated polymerase chain reaction, site-specific mutation, reconnection of different sequences, directed evolution of different parts of the sequence or homologous sequences from other sources, or mutagenesis by ultraviolet light or chemical reagents, etc.

[0026] The cloned gene containing the nucleotide sequence provided by the present invention or at least a part of the nucleotide sequence can be expressed in an exogenous host through a suitable expression system to obtain the corresponding enzyme or other higher biologically active substances or yields. These exogenous hosts include Escherichia coli, Streptomyces, Micromonospora, Pseudomonas, Bacillus, yeast, plants and animals, etc.

[0027] The amino acid sequence provided by the present invention can be used to separate the desired protein and can be used for the preparation of antibodies.

[0028] The DNA fragments or genes can be used to construct mutant strains that produce PoTeMs or their derivatives in a targeted manner. The present invention provides a method for targeted use in genetically engineered microorganisms.

[0029] The starting strain Streptomyces sp. ZJ306 of the present invention was deposited in China Center for Type Culture Collection (CCTCC) on March 13, 2014, address: Wuhan University, Wuhan, China, and its deposit number is: CCTCC NO. M2014081. The strain is disclosed in patent number: CN201410120626.6, and the invention name is a patent for a biosynthetic gene cluster of japonin and its application. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 is a schematic diagram of plasmid pCSG7021.

[0031] Figure 2The following is a schematic diagram of the construction and verification of the clean chassis host Streptomyces sp. 306A. (A) Schematic diagram of the genome of 306A obtained from △BC306; (B) Schematic diagram of gene knockout of △BC306; (C) The genotype of 306A was verified using primers 306A-UHA-F and 306A-DHA-R. The fragment with a size of 2040 bp represents the size of homologous arms UHA and DHA. This fragment was detected in 306A, indicating that the gene fragment located from ikaA to Orf(-1) was successfully knocked out; (D) The genotype of 306A was verified using primers ika D-28a-F / R. The fragment size was 1262 bp. This fragment was not detected in 306A, indicating that ikaD was successfully knocked out.

[0032] Figure 3 It is the HPLC detection result of 306A fermentation extract sample of clean chassis host Streptomyces sp.306A.

[0033] Figure 4 It is the high performance liquid chromatography detection result of the fermentation extract sample of the pactamide A producing strain.

[0034] Figure 5 It is the HPLC test result of the fermentation extract sample of the 10-epi-FI-2 production strain. DETAILED DESCRIPTION

[0035] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0036] Example 1: Construction of a clean chassis host Streptomyces sp. 306A (i.e. ΔBC306::pCSG7021, hereinafter referred to as 306A)

[0037] 1. Construction of conjugative transfer donor strain

[0038] Three pairs of primers 306A-sgRNA-F / R, 306A-UHA-F / R and 306A-DHA-F / R (primer sequences are shown in Table 1) were used to amplify three nucleic acid fragments sgRNA, UHA and DHA (see SEQ ID NO. 1, 2, 3 in the sequence list) from the genome of Streptomyces sp. ZJ306 by PCR. Our published CRISPR-Cas9 knockout plasmid pCSG8006 (references: Tan, B.; Zhang, Q.; Zhu, Y.; Jin, H.; Zhang, L.; Chen, S.; Zhang, C., Deciphering Biosynthetic Enzymes Leading to 4-Chlor o-6-Methyl-5,7-Dihydroxyphenylglycine, a Non-Proteinogenic Amino Acid in Totopotensamide s. ACS Chem. Biol. 2020, 15, 766-773.) was digested with nucleases BamHI and HindIII to obtain two fragments pCas9F1 (191 bp in size) and pCas9F2 (12.5 kb in size). Then, the fragments sgRNA, UHA, DHA, pCas9F1 and pCas9F2 were linked end to end using a multi-fragment one-step cloning kit (manufacturer: Nanjing Novozyme Biotechnology Co., Ltd.) to obtain the CRISPR-Cas9 knockout plasmid pCSG7021 of the clean chassis host 306A (plasmid map as shown in Figure 1 The plasmid pCSG7021 was transformed into E. coli ET12567 / pUZ8002 to obtain E. coli ET12567 / pUZ8002 / pCSG7021, which was used as the donor bacterium for conjugative transfer.

[0039] Table 1. Primers used in the present invention

[0040]

[0041]

[0042] 2. Obtaining a clean chassis host Streptomyces sp.306A by conjugation transfer

[0043] The ikaB and ikaC double gene deletion mutant strain △BC306 constructed by us in the early stage was used as the recipient strain for conjugative transfer (reference: Jin, H.; Zhang, W.; Zhang, G.; Zhang, L.; Liu, W.; Zhang, C., Engineered bio synthesis of 5 / 5 / 6type Polycyclic Tetramate Macrolactams in anIkarugamycin(5 / 6 / 5Type)-Producing chassis. Org.let.2020, 22, 1731–1735.). The specific description of the conjugation transfer process is as follows: the ikaB and ik aC double gene deletion mutant strain △BC306 was streaked and cultured in a SFM medium (medium formula: 15g soybean powder, 15g mannitol, 2g sodium chloride, 5g calcium carbonate, water was added to 1L, pH7.4, preparation: each component of the medium was dissolved in water, stirred to dissolve, and sterilized to obtain) for 5-7 days, and the grown spores were collected with a sterile cotton swab in a TSB medium (formula: take 100g of purchased TSB medium powder, add water to 1L, pH7.4, preparation: dissolve TSB medium powder in water, stir to dissolve, sterilize to obtain), and vortexed to disperse the spores. The mycelium and spores were separated by filtration, and the spores were suspended in 5mL of TSB medium, heat-shocked at 50°C for 10min, and then germinated at 28°C for 2h to serve as the recipient bacteria for conjugation transfer. The donor bacterium E. coli ET12567 / pUZ8002 / pCSG7021 was grown in 50 mL LB liquid medium containing 50 μg / mL apramycin at 37°C until OD 600The value is about 0.8. Take 400 μL of the above-mentioned recipient bacteria and 100 μL of the donor bacteria, mix them evenly, and spread them on the ISP4 solid culture medium without any antibiotics (culture medium formula: 10g soluble starch, 1g bacteriological peptone, 0.5g yeast extract powder, 1g potassium dihydrogen phosphate, 1g magnesium sulfate, 2g ammonium sulfate, 1g sodium chloride, 30g sea salt, 2g calcium carbonate, 18g agar powder, add water to 1L, pH 7.4, preparation: dissolve each component of the culture medium in water, stir to dissolve, sterilize, and obtain), blow dry, and culture at 28°C for 18-20h. Then take out the plate and cover the plate with water containing antibiotics. The final concentration of antibiotics is 50μg / mL apramycin, 100μg / mL trimethoprim and 25μg / Ml thiostrepton. After blowing dry, place it in a 28°C incubator and observe after 5-7 days of culture. When colonies grow on the conjugation transfer plate, they are transferred to SFM plates containing 15 μg / mL 5-fluorocytosine and 15 μg / mL 5-fluorocytosine with a sterile toothpick to detect whether the pCSG7021 plasmid is lost. After culturing at 28°C for 3 days, single colonies that grow only on SFM plates containing 15 μg / mL 5-fluorocytosine are selected as candidate strains for genotype verification. Genomic DNA of each candidate strain was extracted, and positive clones were obtained by PCR detection using primers 306A-UHA-F and 306A-DHA-R (Table 1). Figure 2 C, fragment size is 2040bp), and the positive clone also meets the requirement that the ikaD gene fragment band cannot be detected using primers ikaD-28a-F / R ( Figure 2 D, fragment size is 1262bp), thus obtaining a clean chassis host Streptomyces sp.306A.

[0044] 3. Fermentation test of clean tray host Streptomyces sp.306A

[0045] The Streptomyces sp. 306A strain growing on the SFM solid plate was selected and placed in 50 ml of A1 medium (10 g soluble starch, 4 g yeast extract, 2 g bacterial peptone, 10 g sea salt, and water was added to 1 L, pH 7.0-7.4. Preparation: Dissolve the components of the medium in water, stir to dissolve, and sterilize to obtain the fermentation liquid). The fermentation liquid was grown for 5 days at 28°C and 200 rpm in a shaking incubator to obtain the fermentation liquid. 5 ml of the fermentation liquid was ultrasonically extracted and centrifuged (3500 r·min) with 5 ml of butanone. -1, 8min), 1.6ml of the upper organic solvent phase was evaporated to dryness to obtain the fermentation extract of 306A, and 120μl of methanol was used to dissolve the fermentation extract sample of 306A. The fermentation extract sample of 306A was detected by high performance liquid chromatography. High performance liquid chromatography (HPLC) conditions: chromatographic column is phenomex 150×4.6 mm (SphereClone SAX), mobile phase includes phase A and phase B, mobile phase A: 10% (volume fraction) acetonitrile + 0.08% (volume fraction) formic acid, solvent is water, mobile phase B: 90% (volume fraction) acetonitrile, solvent is water; injection program: 0-18 min, mobile phase ratio is phase A / phase B (volume ratio): 95:5-0:100, 18-23 min, mobile phase ratio is phase A / phase B (volume ratio): 0:100, 23-25 ​​min, mobile phase ratio is phase A / phase B (volume ratio): 0:100-95:5, 25-30 min, mobile phase ratio is phase A / phase B (volume ratio): 95:5, detection wavelength is 360 nm, flow rate is 1 mL / min. The high performance liquid chromatogram of the 306A fermentation extract sample is shown in Figure 3 shown.

[0046] Example 2: Construction of a strain producing the active metabolite pactamide A (306A::pSET152-ermEp*-ptm B1B2C)

[0047] 1. Construction of conjugative transfer donor strain

[0048] The gene fragment ptmB1B2C (SEQ ID NO. 4) (the gene fragment ptmB1B2C contains the sequences of three genes ptmB1, ptmB2 and ptmC, see SEQ ID NOs. 5, 6 and 7 in the sequence table) was amplified from the genome of Streptomyces pac tum SCSIO 02999 (disclosed in CN106434702, a patent on a biosynthetic gene cluster of pacteramide and its application) by PCR method using a pair of primers 152-ptmB1B2C-F / R (primer sequences are shown in Table 1) and the gene fragment ptmB1B2C (SEQ ID NO. 5, 6 and 7) was amplified from the genome of Streptomyces pac tum SCSIO 02999 (disclosed in CN106434702, a patent on a biosynthetic gene cluster of pacteramide and its application) by PCR method using a pair of primers ErmF / R. The promoter gene fragment ermE*p (see SEQ ID NO.8 in the sequence list) was amplified from the promoter gene fragment ermE*p (see SEQ ID NO.8 in the sequence list). Subsequently, the fragments ptmB1B2C and ermE*p were ligated to the vector pSET152 linearized with restriction endonucleases XbaI / BcuI (references: Bierman, M.; Logan, R.; O'Brien, K.; Seno, ET; Rao, RN; Schoner, BE, Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 1992, 116, 43-9.) using a multi-fragment one-step cloning kit (manufacturer: Nanjing Novogene Biotechnology Co., Ltd.) to obtain plasmid pCSG7022 (pSET152-ermEp*-ptmB1B2C). The plasmid pCSG7022 was transformed into E. coli ET12567 / pUZ8002 to obtain E. coli ET12567 / pUZ8002 / pCS G7022, which served as the donor bacterium for conjugative transfer.

[0049] 2. Obtaining the pactamide A production strain (306A::pSET152-ermEp*-ptmB1B2C) by conjugation transfer

[0050] 306A was used as the recipient strain for conjugation transfer. The conjugation transfer process was specifically described as follows: 306A was streaked and cultured in SFM medium (medium formula: 15g soybean powder, 15g mannitol, 2g sodium chloride, 5g calcium carbonate, water was added to 1L, pH7.4, preparation: each component of the medium was dissolved in water, stirred to dissolve, and sterilized to obtain) for 5-7 days, and the grown spores were collected with a sterile cotton swab in TSB medium (formula: take 100g of purchased TSB medium powder, add water to 1L, pH7.4, preparation: dissolve TSB medium powder in water, stir to dissolve, and sterilize to obtain), and vortexed to disperse the spores. Mycelium and spores were separated by filtration, and the spores were suspended in 5mL of TSB medium, heat-shocked at 50℃ for 10min, and then germinated at 28℃ for 2h to serve as the recipient strain for conjugation transfer. The donor bacterium E. coli ET12567 / pUZ8002 / pCSG7022 was grown in 50 mL LB liquid medium containing 50 μg / mL apramycin at 37°C until OD 600 The value is about 0.8. Take 400 μL of the above-mentioned recipient bacteria and 100 μL of the donor bacteria, mix them evenly, and spread them on the ISP4 solid culture medium without any antibiotics (culture medium formula: 10g soluble starch, 1g bacteriological peptone, 0.5g yeast extract powder, 1g potassium dihydrogen phosphate, 1g magnesium sulfate, 2g ammonium sulfate, 1g sodium chloride, 30g sea salt, 2g calcium carbonate, 18g agar powder, add water to 1L, pH 7.4, preparation: dissolve each component of the culture medium in water, stir to dissolve, sterilize, and obtain), blow dry, and culture at 28°C for 18-20h. Then take out the plate and cover the plate with water containing antibiotics. The final concentration of antibiotics is 50μg / mL apramycin and 100μg / mL trimethoprim. After blowing dry, place it in a 28°C incubator and observe after 5-7 days of culture. When colonies grow on the conjugation transfer plate, they are simultaneously transferred to SFM plates containing 50 μg / mL apramycin with a sterile toothpick to detect whether the pCSG7022 plasmid is introduced. After culturing at 28°C for 3 days, single colonies growing on SFM plates containing 50 μg / mL apramycin are selected as candidate strains for genotype verification. Genomic DNA of each candidate strain is extracted, and positive clones are obtained by PCR detection using primers ErmF and 152-ptmB1B2C-R (Table 1), that is, pactamide A production strain (306A::pSET152-ermEp*-ptmB1B2C) is obtained.

[0051] 3. Fermentation detection of pactamide A production strain (306A::pSET152-ermEp*-ptmB1B2C)

[0052] The pactamide A producing strain (306A::pSET152-ermEp*-ptmB1B2C) growing on a SFM solid plate containing 50 μg / mL apramycin was selected and placed in 50 ml of A1 medium (10 g soluble starch, 4 g yeast extract, 2 g bacterial peptone, 10 g sea salt, and water was added to 1 L, pH 7.0-7.4. Preparation: Dissolve the components of the medium in water, stir to dissolve, and sterilize to obtain), and grow for 5 days at 28°C and 200 rpm shaking conditions to obtain a fermentation broth. Take 5 ml of the fermentation broth and use 5 ml of butanone for ultrasonication, extraction, and centrifugation (3500 r·min -1 , 8min), take 1.6ml of the upper organic solvent phase and evaporate to dryness to obtain the fermentation extract of the pactamide A production strain, and dissolve it with 120μl of methanol to obtain the fermentation extract sample. The fermentation extract sample is detected by high performance liquid chromatography. High performance liquid chromatography (HPLC) conditions: the chromatographic column is phenomex 150×4.6 mm (SphereCloneSAX), the mobile phase includes phase A and phase B, mobile phase A: 10% (volume fraction) acetonitrile + 0.08% (volume fraction) formic acid, the solvent is water, mobile phase B: 90% (volume fraction) acetonitrile, the solvent is water; injection program: 0-18min, mobile phase ratio is phase A / phase B (volume ratio): 95:5-0:100, 18-23min, mobile phase ratio is phase A / phase B (volume ratio): 0:100, 23-25min, mobile phase ratio is phase A / phase B (volume ratio): 0:100-95:5, 25-30min, mobile phase ratio is phase A / phase B (volume ratio): 95:5, detection wavelength 360nm, flow rate 1mL / min. The high performance liquid chromatogram of the fermentation extract sample of the pactamide A production strain is shown in Figure 4 shown.

[0053] Example 3: Construction of a production strain for the active metabolite 10-epi-FI-2 (306A::pSET152-ermEp*-flaB1B2CD)

[0054] 1. Construction of conjugative transfer donor strain

[0055] The gene fragment flaB1B2CD (SEQ ID NO. 9) was amplified from the genome of Streptomyces falvogriseus SCSIO 40032 by PCR using primers 152-flaB1B2-F and 152-flaB1B2CD-R (primer sequences are shown in Table 1) (the gene fragment flaB1B2CD contains the sequences of four genes flaB1, flaB2, flaC and flaD, see SEQ ID NO. 10, 11, 12, 13 in the sequence table). Subsequently, the fragment flaB1B2CD was ligated to the vector pSET152 linearized with restriction endonucleases NdeI / BcuI and carrying the ermE*p promoter using a multi-fragment one-step cloning kit (manufacturer: Nanjing Novogene Biotechnology Co., Ltd.) to obtain plasmid pCSG7026 (pSET152-ermEp*-flaB1B2CD). The plasmid pCSG7026 was transformed into E. coli ET12567 / pUZ8002 to obtain E. coli ET12567 / pUZ8002 / pCSG7026, which served as the donor bacterium for conjugative transfer.

[0056] 2. Obtaining the production strain of 10-epi-FI-2 (306A::pSET152-ermEp*-flaB1B2CD) by conjugation transfer

[0057] 306A was used as the recipient strain for conjugation transfer. The conjugation transfer process was specifically described as follows: 306A was streaked and cultured in SFM medium (medium formula: 15g soybean powder, 15g mannitol, 2g sodium chloride, 5g calcium carbonate, water was added to 1L, pH7.4, preparation: each component of the medium was dissolved in water, stirred to dissolve, and sterilized to obtain) for 5-7 days, and the grown spores were collected with a sterile cotton swab in TSB medium (formula: take 100g of purchased TSB medium powder, add water to 1L, pH7.4, preparation: dissolve TSB medium powder in water, stir to dissolve, and sterilize to obtain), and vortexed to disperse the spores. Mycelium and spores were separated by filtration, and the spores were suspended in 5mL of TSB medium, heat-shocked at 50℃ for 10min, and then germinated at 28℃ for 2h to serve as the recipient strain for conjugation transfer. The donor bacterium E. coli ET12567 / pUZ8002 / pCSG7026 was grown in 50 mL LB liquid medium containing 50 μg / mL apramycin at 37°C until OD 600The value is about 0.8. Take 400 μL of the above-mentioned recipient bacteria and 100 μL of the donor bacteria, mix them evenly, and spread them on the ISP4 solid culture medium without any antibiotics (culture medium formula: 10g soluble starch, 1g bacteriological peptone, 0.5g yeast extract powder, 1g potassium dihydrogen phosphate, 1g magnesium sulfate, 2g ammonium sulfate, 1g sodium chloride, 30g sea salt, 2g calcium carbonate, 18g agar powder, add water to 1L, pH 7.4, preparation: dissolve each component of the culture medium in water, stir to dissolve, sterilize, and obtain), blow dry, and culture at 28°C for 18-20h. Then take out the plate and cover the plate with water containing antibiotics. The final concentration of antibiotics is 50μg / mL apramycin and 100μg / mL trimethoprim. After blowing dry, place it in a 28°C incubator and observe after 5-7 days of culture. When colonies grow on the conjugation transfer plate, they are simultaneously transferred to SFM plates containing 50 μg / mL apramycin with a sterile toothpick to detect whether the pCSG7022 plasmid is introduced. After culturing at 28°C for 3 days, single colonies growing on SFM plates containing 50 μg / mL apramycin are selected as candidate strains for genotype verification. Genomic DNA of each candidate strain is extracted, and positive clones are obtained by PCR detection using primers ErmF and 152-flaB1B2CD-R (Table 1), that is, the production strain of 10-epi-FI-2 (306A::pSET152-ermEp*-flaB1B2CD) is obtained.

[0058] 3. Fermentation test of 10-epi-FI-2 production strain (306A::pSET152-ermEp*-flaB1B2CD)

[0059] The 10-epi-FI-2 production strain growing on the SFM solid plate containing 50 μg / mL apramycin was selected and placed in 50 ml of A1 medium (10 g soluble starch, 4 g yeast extract, 2 g bacterial peptone, 10 g sea salt, and water was added to 1 L, pH 7.0-7.4. Preparation: Dissolve the components of the medium in water, stir to dissolve, and sterilize to obtain the result), and grow for 5 days at 28°C and 200 rpm in a shaking incubator to obtain a fermentation broth. Take 5 ml of the fermentation broth and use 5 ml of butanone for ultrasonication, extraction, and centrifugation (3500 r·min -1, 8min), take 1.6ml of the upper organic solvent phase and evaporate to dryness to obtain the fermentation extract of the 10-epi-FI-2 production strain, and dissolve it with 120μl of methanol to obtain a fermentation extract sample. The fermentation extract sample was detected by high performance liquid chromatography. High performance liquid chromatography (HPLC) conditions: the chromatographic column is phenomex 150×4.6 mm (SphereClone SAX), the mobile phase includes phase A and phase B, mobile phase A: 10% (volume fraction) acetonitrile + 0.08% (volume fraction) formic acid, the solvent is water, mobile phase B: 90% (volume fraction) acetonitrile, the solvent is water; injection program: 0-18 min, the mobile phase ratio is phase A / phase B (volume ratio): 95:5-0:100, 18-23 min, the mobile phase ratio is phase A / phase B (volume ratio): 0:100, 23-25 ​​min, the mobile phase ratio is phase A / phase B (volume ratio): 0:100-95:5, 25-30 min, the mobile phase ratio is phase A / phase B (volume ratio): 95:5, the detection wavelength is 360 nm, and the flow rate is 1 mL / min. The HPLC chromatogram of the fermentation extract sample of the 10-epi-FI-2 production strain is shown in Figure 5 shown.

[0060] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

[0061] SgRNA nucleic acid sequence (SEQ ID NO.1)

[0062] GATGGAGGCCGCCGGGTCCC

[0063] Homologous arm UHA nucleic acid sequence (SEQ ID NO.2)

[0064] CCACGACTTCTTCGAGACCGGCGGCAGCTCCATCCGGCTGATCGAGCTGATCTACCACC

[0065] TGCAGGCCGAGTTCGGGATCTCCATCCCGGTCAGCCGGCTGTTCCAGGTGACGACGCTG

[0066] CACGGCATGGCCAAGACGGTCGAGCGGATCGTCACCGGGGAGATCGAGGGGTCGCTGC

[0067] CGTATCTGCGGTTCAACGAGAACGCCGCGGCGGGCACGGTGTTCTGCTTCCCGCCGGCC

[0068] GGTGGCCACGGCCTGGTCTACCGGGAGTTCGCGGCGCGGCTGCCGGAGTTCGAGTTCC

[0069] TCGCCTTCAACTACCTGATGGGCGAGGACAAGGTGAGCGGGTACGCCGATCTGGTGGCC

[0070] GGGCACCGGCCGGAGGGCGAGATCGACCTGCTCGGCTACTCGCTGGGCGGCAATCTCG

[0071] CCTTCGAGGTCGCCAAGGAGCTGGAGCGGCGCGGCCGCACCGTGCGGCACGTCGTCAT

[0072] CATCGACTCGCTGCGGGTGACGGAGTCCTACGAGCTGGGTCCGGAGCACCTGGCCGTCT

[0073] TCGAGCGCGAGCTGGCCGGGCATCTGCGCAAGCACACCGGCTCGGCACTGGTCGCGGA

[0074] GAAGACGCGGGAACAGGCCAAGGACTACCTGGAGTTCACCGGCCGCACCGCCAACCCC

[0075] GGGACCACCGGCGCCCGGATCGCGGTGATCAGCGACGAGGAGAACGCCGCCGCGTACG

[0076] ACAGCGGCGCCGAGGGCAGCTGGCACGGCGCCTCCCGTACCGGAACCGAAGTGCTGCG

[0077] CGGGGTGGGCCGGCACGCCGACATGCTCGATCCGGGGACGGTCGAGCACAACGCGCGC

[0078] CTGGCGCGCGGCATTCTCACCGGCGGTGATGGCGAGGTATGA

[0079] Homologous arm DHA nucleic acid sequence (SEQ ID NO.3)

[0080] CTCCGACGGTGCCTGCTGTTCCTGCTGTCCGGGCATGGGGGCGGTGTTGCCTTTCGTGG

[0081] CTGGGACATGGTGAGGGCGTGTGCCGGCCGGCACGGTGGCGGAGGGGGAGGGGCGCC

[0082] GGTGCCCGTGGGACGACGGGCCGGCTGGGTGCCGGGCGGCACACGCCCTGTCCAGCAT

[0083] GCGGTTCCGGGCACCGCCGACGGGCACCCGGACCATCAAGATCACTCCATTGAGCGAG

[0084] CGTGCGCCTACATTGCGTTATGCGCGCCGGTGCTTCACAGTCCTATTTCCCGCCCGGCGC

[0085] GCACATAGCCGGGGAACTCCTGCGGCCCGCACCGCACTTCACGCCAGCCCGGCCCCGT

[0086] CAGGGAGCCCTTGCCCAGCAGTTGCCGCCACTCCCCCGGCGGCACGTACAGATCGCGG

[0087] CGCCCGCCCCGCTCCAGCACCGGGGCCACCAGCACGTCAGGACCGAGCAGGTACTGCA

[0088] ACTGCGCGTCGCGGGCGCACCGGTCCTCGGGGAAGGCGAGCGGCATCGGCCGCATGAG

[0089] GGGCATCCCGCCCTCCCTGGTGGCCTCGGCGGCGCAGCCGGCGATGTACGGGGCGAGC

[0090] CGGTGCCGCAGCCGGCACGCCGCGATGGCGGCCGACCGTACCGGCTCGGGGTAGGCGG

[0091] TCGGCTCCCTGCGCCCCATCCCGTGGAACCGCATGATCGGGGAGAACGCCGCCCACTGC

[0092] GCCCACCGCCCGTACAACTCGGGCTCCACGTCCGCGGGTACGGCGTCCGGTGTCATCCG

[0093] CTGCCGCACCACGTAGGCGGCTTCGAAGGACTGGGGCGTGTAGTAGCCGCCCGCGTCG

[0094] TGGGTGACCACCGAGCAGCCGCTGAGCGCCATGGACTCCACGGCGCGCACCGTGGACG

[0095] CCAGTCCGCTCCAGCTGGAGGGCATGTCACCCGCCCAGTGCGCCGGGTTGCGCTGCGA

[0096] GCCCGCCGTGCCCGAGCGGGCGATCGCCGTGAAGTCCCCGGCGCGGGCGCGCAGTCCC

[0097] GCCTCGCGCA

[0098] Nucleic acid sequence of gene fragment ptmB1B2C (sequence containing three genes ptmB1, ptmB2 and ptmC) (SEQ ID NO. 4)

[0099]

[0100] Nucleic acid sequence of gene ptmB1 (SEQ ID NO.5)

[0101] GGCGTGCGTGACGGCGGGCCCCGTTGGGAGGCCCGGCCCCCCGGCGGGCGGCCCCGG

[0102] GTGATCATCATCGGCGCGGGCATGTCCGGTCTGGCCGCCGGCTGCTACGCGCAGATGAG

[0103] TGGGCTGGAGAGCCGGATCTTCGAGAAGCACGTGCTGCCAGGGGGCTGCTGCACCGCC

[0104] TGGGCCCGGCAGGGCTACCTCTTCGACTACTGCATCGACTGGCTGATCGGCACGGCACC

[0105] CGGGACCGGGGCGAACGACGTGTGGCGCGAGCTCGGGGCGCTGGACGGGAAGCGGAT

[0106] CACCCGTTTCGACCAGTTCAACCGGGTGGTGGCGGAGGACGGCCGGTCCGTCACGTTCT

[0107] ACAACGACCCGGACCGGCTCCAGAACCACCTGCTGGAGCTCTCGCCCGGCGACGGGCG

[0108] CCTGATCCGGGCGTTCTGCCGGGACCTCAGGCGCTTCGCGGGACTCGCCCCGCACTGGG

[0109] AGCTGAAGCCGCCGCCACTGAAGTCCCTGACGGAGAAGGCGCGAACGCTGCTCGCGAT

[0110] CCTGCCGGCGTTCCGGCTGTACTGGCGCACCGCGGCCACGCCGATGCGCCGGTTCGCGG

[0111] ACCGCTTCGAGGACCCGCTGCTGCGCCAGGCGTTCCCGAACATGTTCCTCCAGGAGCTG

[0112] ACCGGCTTCCCGCTGCTCCCCTTCCTCTTCACGATGTCCTGCGCCTTCAACGGCAACGC

[0113] GGGCTTCCCGGAGGGCGGTTCGCTGGGTCTGGCCCGGTCGGTGGAGGAGCGGTACACG

[0114] GGGCTCGGCGGGCACGTCGGCTACCGCGCCCGGGTGGAGCGGATCCTCGTCGAGGACG

[0115] GGCGGGCGGTCGGCGTACGGCTGCGGGACGGGCAGGAGCACTTCGCCGACCATGTGAT

[0116] CGCCGCCTGCGACGGGCCGACGGTGCTGGACCGGCTGCTGGAGGGGCGGTGGAGCAG

[0117] CCCGCACACCGAGCGGCTGTACACGGAGCTGCTGGACCGGCCGGACAACCTGTACCCG

[0118] GCGGTGGTCTCCGCGTTCGTCGGGATCGACGGCCCGCTGCCCGCCGGTGAGCCGCACA

[0119] GCACGACGTACCTCCTCGGTCCGGAGCGGGGCGCGGCGCTGCCGGGGAGCCTCCAGCA

[0120] CAGTCTGGTGGTGCAGCGGCGGTCCGACTACGCCGACGGCTTCGCGCCGGCCGGGAAG

[0121] TCGGTGCTGCACTGCACGTACTTCACCGACCACCGGTCCTGGCAGGAACTGCGGAAGG

[0122] CGGACCGGCGGGCGTACCGGGAGCGCAAGCAGGAGGTCGTCGACTTCCTGCGGGGCTT

[0123] CCTGGCCGAGCGTCATCCGGGCATCGAGGAGCGGATCGAGCTGGTGGACGTGGCGACG

[0124] CCGGCGACGACGGAGCGGTACACCGGCAACACCTACGGCAGCATCCTGGCCTGGAAGG

[0125] CGTTCTCCGAGGCCGACGACGTGTCGACCGCGCTGGTGGACCGGGGCCGGATGCGGCT

[0126] GCCGGGGCTGAGCGGCTTCTCGATGGCCGGGCAGTGGACCGGGATGGGCGGCCTGATC

[0127] CGGGCCGCGACCAGCGGCCGGTACGCGGTCCAATTCCTCTGCGACGAACTGGGCCGGG

[0128] AGTTCCGGGCCTGGCCGAGCGAGGGTGCCGGGCCGTGGCATCCCGGGAAGCTGGGCCG

[0129] GCTGCCACGACTCGAACAGCGGGGCGACGCCGGGAAGGCGGCGGTGGCCGAATGA Nucleotide sequence of gene ptmB2 (SEQ ID NO.6)

[0130] ATGCTGATCGTCGGCGGAGGGCTCGGCGGGCTCTCCACCGGCTGCTACGCCCAGATGAA

[0131] CGGCTATCGCAGCAGGGTGCTGGAGATGCACGAGATCCCGGGCGGCTCCTGCACTGCCT

[0132] GGGACCGGGGCGACTTCACCCTCGACTGCTGTGTGAGCTGGCTGCTCGGCAGCGGGCC

[0133] GGGCAACGAGATGCACCAGATCTGGCTGGAGCTCGGCGCGCTCCAGGGCAAGCGGATG

[0134] CGCAACTTCGACGTGTTCAACACGGTGCGCGGCCGGGACGGGCGGGCGGTCCACTTCT

[0135] ACTCCGATCCGGACCGCCTCGAAGCGCACCTGCTCGCCCTCTCCCCCGGCGACGCCCGG

[0136] GTGATCCGCGACTTCTGCGCCGGGCTGCGGACCTTCCGCAAGGCACTGGCCCGCTACCC

[0137] GTTCCTCACCCCGGTCGGGCTCATGGGCCGTCTGGAGCGCTGGCGGATGCTGGCGTCCC

[0138] TGGTCCCCTACTTCAACGTGATCCGGCGCTCCATCGGCACGCTGATGCGGGACTACTCG

[0139] CAGCGCTTCCGGGACCCGCTGCTGCGCGAGGCGTTCAACTTCATCCTGTACGAGAAGCA

[0140] TCCCAACTTCCCCGTGCTGCCGTTCTACTTCCAGCTCGCGGCGCACGCCGACGCCTCGG

[0141] CCGGTGTCCCCGAGGGCGGCTCGCTGGGCCTGGCCCGCTCGGTCGAGGAGCGCTACCG

[0142] GGGGCTCGGCGGCGAGGTCGTGTACAACGCCAGGGTCGTGGAGATCCTGGTGGAGAAC

[0143] GACCGGGCGGCCGGCGTCCGGCTGAGCGACGGCACGGAGCTGCGGGCGGACATCGTG

[0144] GTCTCCGCCTGCGACGGGCGCACCACGCTCCTCGACCTGCTGAAGGGCCGCTACCTCAC

[0145] CGACACGTACCGGGAGCTGTACACCCGGACCATCACGGAACCCGACATGGTCTTCCCCG

[0146] GCTACCTCACGGTCTTCCTGGGGCTGCGACGGCCCTTCCCGGACGGCGAGCCCTGTACC

[0147] ACGTACCTCCTGGAGGACGCGGTCGCGGAACGGCTCACCGGCATCCGGCACCCCAGCG

[0148] TCAACGTGCAGTTCCGCAGCCGCCACTACCCGGAGCTGTCGCCGCCGGGCACCTCCGTG

[0149] GTGTACGCCACGTACTTCTGCGACATCGCGCCGTGGCGGGAGCTGAGCACCGGTCCCGA

[0150] GCAGTTCACCCGGATCCGCCGCGGCGAGGAGCTGCACACGCTGCCGGTCGGGCGCGGT

[0151] CGCGACTACCAGCGGGCCAAGCGGCAGGTGCGGGACACGATCGTGGACTTCCTCGACG

[0152] AGCGGCACCCCGGGCTGCGGGACGCGATCGTGGTGCGGGACGTGTCCACCCCGCTCAC

[0153] CCAGGTCCGCTACACCGGCAACTACGACGGCACGGTGCTCGGCTGGCAGCCGTTCGTG

[0154] GACAGCGGCGAGACCGTGGAGCAGGAGGTCAAGCGACACGGTCCGGGACTGCCGGGG

[0155] CTCGCGGACTTCTATCTGTCCGGCGTCTGGGCCACCACCGGCGGCCTGATCCGGGCCGC

[0156] GGCCTCGGGACGGCACGTCATGCACTTCGTCTGCCGCGACGACGGGCGGCCGTTCACC

[0157] GCCTCCGTCGACGACAGCTCCCCTCTCCCCGTACAACTCATCGAACCCGCAGGAGCGGC

[0158] CCCATGA

[0159] Nucleotide sequence of gene ptmC (SEQ ID NO.7)

[0160] ATGAAGACCGAGAAGTGGATCGTCAGCGAGCACAACGAGGGCGTGCCGGACGTGGAC

[0161] CGGATGTACGTGAAGGTGGTGGAGGAGCTCGACACCGACCTGGCCGAGGACGAGATGC

[0162] TGCTGCGCACGCGGTACGTCTCCGTCGACCCGTACCTCCACGGGATCGCCCTGGACACC

[0163] CCGGCGGGCGACCACATGGGCGCCGACTCGATCATGGAGGTGCTGGCGGCCGGACCAC

[0164] GGGCGATGTTCGGCGTCGGGGACCTCGTGCAGGGCTTCGGCGGCTGGCGCACCCACCT

[0165] GGTCAGCAACGGCGCGGAGGCGCTGTGGCAGACCGGCACGTTCCCGATGGTCTTCCCC

[0166] GCGTACCGGAAGCTGGACCCGGCCCACTACGACGAGGCGCTGCCGCTGAGCACCGCGC

[0167] TCGGCATCCTCGGCGGCGCCGGGATGACCGCGTGGGGCACCCTCACCACCTTCCTGGCC

[0168] GTACGGCCCGGCGACACGGTCCTGATCAGCGGCGCGTCCGGCGCGATCGGCACGCTGG

[0169] TCGGGCAGCTGGCCAAGCGGGCGGGCGCGCGGGTGGTGGGCACGACGGGTTCGCCGG

[0170] AGAAGGCGGCGCGACTGACGGCGCTCGGCTTCGACGCCGTCGTCGTCTTCCGGCACGG

[0171] CGGGGACCCGGCGCAGCTCGGCGAGGACCTGGCGAAGGCGGCTCCCGGCGGCGTCGA

[0172] CCGGTACTTCGACAACCTCGGCGGGGTCATGACCGACACCGTCTTCACGATGCTCACCG

[0173] TGGACAGCCGGGTCGCGGTGTGCTGGCAGTGGGCGAGCCAGGTCGGCGGCGAGTGGA

[0174] CCGGGCCCCGGCTGCTGCCGTACATCATGTTCCCGCGCACGACGATCCGCGGGATCTTC

[0175] GCGCTGGAGTGGTTCACCGAGGACAACTGGGCGGCGCTGCACGCCGAGCTGGGGCCGC

[0176] TGGTGCGCGCCGGCGAGATCCGCTACCAGCAGACCGTGCACCACGGCTTCGACTCCATT

[0177] CCCGCCGCCTACCGCAGCCTGTACACCGACCGGGCGGCGTCCTTCGGCAAGGTGCTGGT

[0178] CGAGCTGTGA

[0179] Promoter ermE*p nucleic acid sequence (SEQ ID NO.8)

[0180] CAGGCGGTACCAGCCCGACCCGAGCACGCGCCGGCACGCCTGGTCGATGTCGGACCGG

[0181] AGTTCGAGGTACGCGGCTTGCAGGTCCAGGAAGGGGACGTCCATGCGAGTGTCCGTTC

[0182] GAGTGGCGGCTTGCGCCCGATGCTAGTCGCGGTTGATCGGCGATCGCAGGTGCACGCGG

[0183] TCGATCTTGACGGCTGGCGAGAGGTGCGGGGAGGATCTGACCGACGCGGTCCACACGT

[0184] GGCACCGCGATGCTGTTGTGGGCACAATCGTGCCGGTTGGTAGGATCGACGGTATCGAT

[0185] AAGCTTGATATCGAATTCGAGCTCGGCCGCCCGTGCGCCGGGGCCGACGAACCATGAG

[0186] AGGAGAGCGGGCGAACCATGGGCCATCATCATCATCATCATCATCATCATCACAGCAGCG

[0187] GCCATATCGAAGGTCGTCATATG

[0188] Gene flaB1B2CD nucleic acid sequence (comprising the sequences of four genes flaB1, flaB2, flaC and flaD) (SEQ ID NO.9)

[0189]

[0190] Nucleic acid sequence of gene flaB1 (SEQ ID NO.10)

[0191] ATGCCCGGTGACATGGGCGGCGACCGGGGCGCCGGCGGACGGGGGACCGACGGCGGC

[0192] CCCCGGGTCATCGTGATCGGCGCCGGGGTCGCCGGACTCTCCACCGGCTGCTACGCGCA

[0193] GATGAACGGGATGCGCTCGCACATCTTCGAGAAGCACGTGCTCCCCGGCGGCTGCTGCA

[0194] CCGCCTGGTCGCGCGACGGCTACATCTTCGACTACTGCATCGAGTGGCTGATCGGCACG

[0195] GCCGAGGGCAACGAGGCCCACCAGGTGTGGCGGGAACTGGGCGCACTCGACGGCAAG

[0196] ACCGTCACCAACTTCGAGATGTTCAACCGCGTCGTCGACGAGACCGGCCGCTCGGTGG

[0197] TCTTCTACAACGACCCGGACCGGCTGGAGCGGCACCTGCTCGGACTGTCGCCCGCCGA

[0198] CGCCCGGCTGATCCGCTCGTTCTGCCGCGACCTGCGGCGGTTCACCGCCATCGAGCTCT

[0199] ACCCGTTCCTCACCGCCCCCGCCCTGCGGACCGTACGCGAGAAACTGGCGACACTGCG

[0200] CACCGTGCTGCCCGCGTTCCGCCTGTTCTGGCGCACCGCGTCGACGCCGATGCACGAGT

[0201] TCGCCGACCGGTTCCAGGACCCGCTGCTGCGCCGGGCGTTCCGGAACATCTTCTTCCAG

[0202] GACCCGGACGGCTTCCCCCTGCTGCCGTACCTGTTCAACATGGCCAGCGCCCACCACGG

[0203] CAACGCGGGCTTCCCGCAAGGGGGGTCGCTGGGCCTGGCCCGGTCGGTCGAGGAGCGG

[0204] TACACGTCCCTGGGCGGCGAGATCACCTACCGGGCACGCGTCGAGCGGGTCCTGGTCG

[0205] AGGACGGACGCGCCGTCGGCATCGAACTGCGCAACGGCAAGCGGTACTACGCCGACCA

[0206] CGTCGTCTCGGCCTGCGACGGGCACACCACCATCCACGGCCTCCTCCAGGGCCGGTACA

[0207] CCGGACCCCGGATCGACAAGCTGTACAACGACCTGCTGCACCGCCGCGGCACCCTCTTC

[0208] CCGGCCGTGGTCTCCGCCTTCGTCGGCATCCGCGGGGACCTCGGCGGCGACCGGGCCC

[0209] ACAGCACCACCTACCTGCTCACCCCCGAGGAGGCCGCACGGCTGCCGGGATCGCTCCA

[0210] GAGCAGCCTGGTGGTCCAGCTGCGCTCCGACTACTCGGACGGTTTCGCCCCGCCCGGAC

[0211] GGTCGGTGATCCACTGCACCTACTTCAGCGACTTCGCCCACTGGAAGGAACTGCGCGCC

[0212] GCCGACCGCAAGGCGTACCGGGCACAGAAGCGCCAGGTCGCCGACTTCGTCCGCGACT

[0213] TCCTGGGACGCCGGATCCCCGGTACCGCCGAACACGTCGAACTCGTCGACGTCGCGAC

[0214] CCCCGCGACGACCCGCCGCTACACCGGCAACCACGACGGCTCCATCCTCGCCTGGAAG

[0215] GCGTTCTCCGAGGCCGACGACGTCGCGACGGCACTCGTCGGCAAGGACCGCATGCGCC

[0216] TGCCCGGCCTGCGCGGCTTCTCCATGGCCGGGCAGTGGGTCGGGATGGGAGGTCTCATC

[0217] CGCGCCGCGTCCACCGGCCGCTTCGTCGTCCAGTACCTCTGCGACGAGCTCGGACGCGG

[0218] GTTCACCGCGTCCGAGAGCCCGGGCTCCGAACCCTGGCACCCCGGGAAGCTGGGCCGG

[0219] CTGCCCCAGCTCGACCGATGGTCCGCCCGGGGGGACACCCGCACATGA

[0220] Nucleic acid sequence of gene flaB2 (SEQ ID NO.11)

[0221] ATGATCATCATCGGCGCAGGGCTCGGCGGTCTGTCCACCGGCTGCTACGCCCGGATGAA

[0222] CGGCTACCGCACCCATGTCCTGGAGATGCACGAACTGCCGGGCGGCTGCTGCACGGCGT

[0223] GGGACCGCGGCGACTTCACCCTGGACCCCTGCGTCAGCTGGCTGCTCGGCAGCGGCCC

[0224] CGGCAACGAGATGCACCAGATCTGGCTGGAGCTGGGCGCACTGCAGGGAAAGGAGATC

[0225] CGGCACTTCGACGTCTTCAACGTGGTGCGCGGCCGGTGCGGCCGGTCCGTGTACTTCTA

[0226] CTCCGACCCCGACCGGCTCCAGGCACACCTGACGGACATCTCGCCCGCCGATTCCGCCC

[0227] TGATCCGGAAGTTCTGCAAGCAACTGCGGGCCTTCCGCAAGGCCCTGGCCGTCTACCCG

[0228] TTCCTCAAACCGGTCGGGCTGATGCCGGTACGGGAACGCTGGCGCATGCTCGCCTCGTT

[0229] CGTCCCGTACTTCAACGCCGTCCGCACCTCCATCGGTGTGCTGATGACCGACTACTCGG

[0230] CGCGGTTCAAGGACCCCCTGCTGCGCGAGGCGTTCAACTTCATCCTGTACGAGAAGCAC

[0231] CCCGCCTTCCCCGTGCTGCCGTTCCACTTCCAGCTCGCCTCGCACGCCAACCTGTCCGC

[0232] GGGCGTCCCCGAGGGCGGATCGCTCGGACTCGCCGAGTCCATCGAACGCCGCTACCGC

[0233] AAGCTGGGCGGTGAGGTCACCTACAACGCCAAGGTCGAGGAAGTGCTCGTCGAGGACG

[0234] ACCGGGCGGTCGGGGTCCGGCTGAGCAGCGGGGAGGAACTGCGCGCCGACATCGTCGT

[0235] CTCGGCCTGCGACGGCCGCACCACGATGATGGACCTCCTCGGCGGCCGCTACCTCGACG

[0236] ACGCCTACCGCAGGCTCTACACCCGCACGATCCGCGAACCGGGAATGGTGTTCCCCGGC

[0237] TACTTCATCCTCTTCCTCGGCCTGCGCCGCGAATTCCCCGACGCCGACCCCTGCACCACG

[0238] TACCTGCTCGACGAGGACGTGGCGTCCGAGCTGACCGGTATCCGCCACCCCAGCGTCAA

[0239] CGTCCAGTTCCGCAACCGGCACTACCCGGAACTCTCGCCCCGCGGGACGAGCATCGCCT

[0240] ACGTCACCTACTTCTGCGACATCGAGCCCTGGCGGGCCCTGGACGAGGGGCCGGAGCA

[0241] GGCGACCCGCAGCCGTGGCGGCCAGGAACTCCACACCCTGCCGGTGCGGCACGGCCGC

[0242] GGATACTACGCCGCGAAGAAACGGGCCCGCGAGGCGCTCGTCGCCTTCCTGGAACGGC

[0243] ACCACCCGGGCATCTCCGAGGCGATCGCCGTCCGCGACGTGTCGAGCCCCCTCACCCAG

[0244] GTCCGCTACACGGGCAACTACAACGGCACCGTGCTCGGCTGGCAGCCGTTCGTGGAGA

[0245] GCGGGGAGACGCTGGAGACGCTCGTCAAGAAGCACGGCCCCGGGCTTCCGGGACTGC

[0246] GCAACTTCTACCAGTCCGGTGTGTGGGCGACGACGGGCGGCCTGATCCGGGCCGCGGC

[0247] GGCCGGCCGGCACGTCATGCAGTTCGTCTGCCGGGACGACGGGCTGGCGTTCACCGCC

[0248] TCGGTGGACGGGAGTGGCCCGCCGCCGACCCATCTCGTCATCCCGGTCGGGCCCCGGG

[0249] CGGAGGAGCGGCCCGGCACAGGAGCAGGACGTTCGTCCCTCGCGGACGGGAAGGGAA

[0250] TGCGATGA

[0251] Nucleic acid sequence of gene flaC (SEQ ID NO.12)

[0252] ATGAGGACCAGGAAGTGGGTCGTGCGCGAGCACATCGAGGGGGTGCCCGACGTCGGG

[0253] AAGGTCTACGAGATGGTCGAGGAGGACCTCGACACGGACCTCGCCCCCGACGAGATGC

[0254] TGCTGAGGACGCGTTACATCTCGGTGGACCCCTACCTGCAGGGCATCGCCCTCGACACC

[0255] CCGCTCGGTGCCCACATGGGTGCCGACTCGATCATGGAAGTGCTGGACGCCGGGCCACT

[0256] GGCCGCCCACCGGCCCGGTGACCTGGTGCAGGGCTTCGGGGGCTGGCGCACCCACCTC

[0257] GTCAGCACCGGCGCGGCGACCCCCTGGCAGACCGGGACCTTCCCCATGGTCTTCCCCGC

[0258] CTTCCGCCGCCTGGACCCCGGCTGGTACGACGACGACCTGCCGCTGCCCACCGCGCTGA

[0259] GCGTCATGGGCGGTCCCGGTATGACCGCGTGGGGAACGCTCACCAAGTTCATGTCGGTC

[0260] CGCCCCGGGGACACCGTCGTGATCAGCGGTGCCTCCGGTTCGGTGGGCTCACTCGTCGG

[0261] ACAGCTCGCCAAGCTCGCCGGAGCACGGGTGGTGGGCACCACCTCGACCGTCGAGAAG

[0262] GCGGACTACCTGGACGAGCTGGGCTTCGACGCGGTCGTCCTCTACCGCCACGGGGACA

[0263] GCTGGGAGTCGGTGCGCGAGGCGCTCGGCTGGGTCGCGCCCGACGGGGTCGACAAGTA

[0264] CTTCGACAACCTCGGCGGCACCGTCACGGACGCCGTGTTTTCCATGCTCAACGTGGGCA

[0265] GCCAGGTCGCCGTGTGCTGGCAGTGGTCCACCCAGGTCGGCCGCGAGGCCACCGGGCC

[0266] GCGCCTGCTGCCCTACATCATGTTCCCGCGCACCTGTGTGCGCGGGATCTTCTCCCTGGA

[0267] ATGGTTCACGGAGGAGAACTGGCGCTCGCTCCACCACGAACTGGGAGGCAGGGTGCGA

[0268] CGGGGCGAGATCCGGTTCGGGCACACCGTCCACCACGGCTTCGAGAACATCCCGGACG

[0269] CCTACCGGAGCCTCTACCGGGGCACCGCGGCCAACCGAGGAAAGGTGCTGGTCGAGCT

[0270] CTGA

[0271] Nucleic acid sequence of gene flaD (SEQ ID NO.13)

[0272] GTGCCCCTTCCCGACGACAACGACGTGACGACCGCCACCCCGTTGCCCCCGCTGCACG

[0273] CCTCGGAGTTCGAGCCGTCCGGGCCGCCCGGACCGGTCGAGCTGCCCGACGGCACGCT

[0274] GGCCTGGCGGGTGAGCCGCTACTGCGATGTGCGCAAGGTCCTCACCGATCCCCGGTTCG

[0275] GACGCGCCCAGCTGCACGTTCCGGACACCGTGCCCCTGACCGGCCAGTCCGGACTCGT

[0276] GGCCAGCGCGGACCTCATGTTCAACCAGGACGGCGAGGACCATCTGCGGCTGCGCCGC

[0277] ACCCTGCGCCGGGCGTTCACCCCGAGGACGGTCGCCCGCTGGCGTCCCTGGATCGCCTC

[0278] GATCGTGGAGCAGCGCCTCGACGCGCTCGCCGAGGGCACACCCCCGGTGGACCTGGTG

[0279] GCCGGTTACACCCTGCCGCTCCCGGTCGACGTGATCAGCAGACTCATGGGCCTCGACAA

[0280] CGCGGCACGGGAGCGGCTGCGCCACTGGACCGAGTACGCCTTCTCCGACGGCTCCCAC

[0281] CCCGAGGAGGACATGGAGCCCGCGCTCGCCGAGTTCGCCGCGTTCGGAGCCGCGCTCC

[0282] TGGCCGAGCGGCGCAAGGACCCCGGCGACGACCTGACCAGCATGCTCGTCGGGGCGGC

[0283] CGACGAGGAGGGCGGCATCCCCGAGGGCCAGCTCGTCGACCTCGTGTGCGGGCTGGTG

[0284] GTGGGCGGTCACGACAGCACCATGACGATGCTCGGCAACGCGCTGCTCTACCTGCTCGG

[0285] TGAGCGCCGGGAGTGCTGGAGCCGCATCGGGGCGGACGAGGAGGCCGCGGGGGCGGC

[0286] CGCCGAGCGCCTGCTGCACCTCGTCCCGCTCGGCGACGACCGCGGGACCGCGCGCCAC

[0287] GCCGCCGTGGACACCGAGGTCGGCGGCGTCGTCATTCCGGCGGGTTCGGTGGTCCTGG

[0288] CGGACTGCGGCGCCGCCAACCGCGACCCCGACGTGTTCCCGCCCCGGCCGCTGGACGA

[0289] CCTGTTCGCCCCCCTGGCGGCCCCCACCCTGTCGTTCGGCGCGGGCCCGCACTACTGCC

[0290] TCGGCGCGTGGCTCGCGCGGCTGGAGCTCCAGCTCTCGCTGCACCGGCTCGCCGCCCG

[0291] CCTCCCCGGCCTTCGCCTCGCCCACCCCGCCGACGAGGTCGAGTGGCGGAACGGGACG

[0292] ACGTCCCGCAGTCCCGAACACATCCTGGTCACCTGGTAG

Claims

1. A genetically engineered strain 306A, characterized in that: It is a genetically engineered strain 306A obtained by deleting an interfering gene fragment in a mutant strain ΔBC306 of Streptomyces sp. ZJ306 by a CRISPR-Cas9 gene editing method, wherein the interfering gene fragment is located between ikaA and orf(-1).

2. The genetically engineered strain 306A according to claim 1, characterized in that: The CRISPR-Cas9 knockout plasmid pCSG8006 was digested with nuclease BamHI and HindIII to obtain two fragments pCas9F1 and pCas9F2. The fragments sgRNA, UHA, DHA, pCas9F1 and pCas9F2 were connected end to end to obtain the CRISPR-Cas9 knockout plasmid pCSG7021 of the clean chassis host 306A. The plasmid pCSG7021 was transformed into Escherichia coli E. coli ET12567 / pUZ8002 to obtain E. coli ET12567 / pUZ8002 / pCSG7021, which was used as a donor strain for conjugative transfer. The clean chassis host Streptomyces sp. △BC306, a double gene deletion mutant strain of ikaB and ikaC, was used as a recipient strain for conjugative transfer to perform conjugative transfer to obtain the genetically engineered strain 306A. The nucleotide sequences of the sgRNA, UHA, and DHA are shown in SEQ ID NOs. 1, 2, and 3.

3. Use of the genetically engineered strain 306A according to claim 1 in the preparation of a polyene tetramate precursor compound 1 for the co-biosynthesis of a PoTeM compound; The structure of the polyene tetramate precursor 1 synthesized by the PoTeM compound is shown in formula (1); 4. A production strain 306A::ptmB1B2C, characterized in that The gene fragment ptmB1B2C is inserted into the genetically engineered strain 306A in claim 1 or 2 to obtain the production strain 306A::ptmB1B2C, and the nucleotide sequence of the gene fragment ptmB1B2C is shown in SEQ ID NO.

4.

5. The production strain 306A::ptmB1B2C according to claim 4, characterized in that The gene fragment ptmB1B2C and the promoter gene fragment ermE*p were connected to the vector pSET152 linearized with restriction endonucleases XbaI / BcuI to obtain plasmid pCSG7022, and the plasmid pCSG7022 was transformed into Escherichia coli E.coli ET12567 / pUZ8002 to obtain E.coliET12567 / pUZ8002 / pCSG7022, which was used as a donor bacterium for conjugative transfer. The genetically engineered strain 306A was used as a recipient bacterium for conjugative transfer to obtain the production strain 306A::ptmB1B2C. The nucleotide sequence of the promoter gene fragment ermE*p is shown in SEQ ID NO.

8.

6. The method and use of the production strain 306A::ptmB1B2C according to claim 4 or 5 in preparing 5-membered ring type, 5 / 5 ring type and 5 / 5 / 6 ring type pactamides PoTeM compounds; The structural formulas of the 5-membered ring type, 5 / 5 ring type and 5 / 5 / 6 ring type pactamides PoTeM compounds are shown in compound 2-4 in formula (2); 7. A production strain 306A::flaB1B2CD, characterized in that The genetically engineered strain 306A in claim 1 or 2 is inserted with the gene fragment flaB1B2CD to obtain the production strain 306A::flaB1B2CD, and the nucleotide sequence of the gene fragment flaB1B2CD is shown in SEQ ID NO.

9.

8. The production strain 306A::ptmB1B2C according to claim 7, characterized in that The gene fragment ptmB1B2C and the promoter gene fragment ermE*p were connected to the vector pSET152 linearized with restriction endonucleases XbaI / BcuI to obtain plasmid pCSG7022, and the plasmid pCSG7022 was transformed into Escherichia coli E.coli ET12567 / pUZ8002 to obtain E.coliET12567 / pUZ8002 / pCSG7022, which was used as a donor bacterium for conjugative transfer. The genetically engineered strain 306A was used as a recipient bacterium for conjugative transfer to obtain the production strain 306A::ptmB1B2C. The nucleotide sequence of the promoter gene fragment ermE*p is shown in SEQ ID NO.

8.

9. The method and use of the production strain 306A::ptmB1B2C according to claim 7 or 8 in preparing 5 / 5 cyclic and 5 / 5 / 6 cyclic PoTeM compounds with oxidation modification at C14 position; The structural formula of the 5 / 5 cyclic and 5 / 5 / 6 cyclic PoTeM compounds with oxidation modification at the C14 position is shown as compound 5-9 in formula (3);

Images