Capture probe group, kit, library construction method and application of Marfan syndrome related genes

Abstract

The invention discloses a Marfan syndrome related gene capture probe group, a kit, a library construction method and application, and belongs to the technical field of gene detection. The sequence of the capture probe set is shown as SEQ ID No.1-149 and SEQ ID No.150-238, target genes FBN1 and FBN2 can be captured in a targeted mode, sequencing is carried out, the target genes are accurately sequenced, and the sequencing cost is reduced. The kit comprising the capture probe group can effectively capture the target gene, the detection cost can be reduced, and the detection sensitivity can be improved. According to the library construction method using the capture probe set, target genes are enriched through a sequence capture technology based on liquid phase hybridization, the target genes can be effectively enriched, the requirement for the sample size is reduced, and meanwhile the sequencing cost can be better controlled. The product and the method provided by the invention can be effectively applied to screening of related genes, and the related genes can be researched more deeply.

Description

[0001] Related Applications

[0002] This application is based on the prior application with application number "202410518835X" filed on April 28, 2024, and invention name "A capture probe set, kit, library construction method and application of Marfan syndrome-related genes" as the priority basis. Specifically, claims 1 to 8 of this application claim its priority. The entire contents of the above application are incorporated herein by reference. Technical Field

[0003] The present invention relates to a capture probe set, a kit, a library construction method and application of Marfan syndrome related genes, and belongs to the technical field of gene detection. Background Art

[0004] Marfan syndrome (MFS) is an autosomal dominant connective tissue genetic disease. It is mainly characterized by defects in the three major systems of bones, eyes and cardiovascular. It was first proposed by French pediatrician Marfan in 1896 as a congenital defect of interstitial tissue. Because the bones are involved, the fingers are slender and spider-like, also known as spider finger (toe) syndrome. Later, other doctors added eye and heart changes and family history to form a complete syndrome. Etiology and epidemiology: Most MFS patients have a family history, but at the same time, 15% to 30% of patients are caused by self-mutation, and the rate of this spontaneous mutation is about 1 / 20,000. MFS is autosomal dominant, and most (>90%) are caused by mutations in the gene encoding the connective tissue protein fibrillin-1 (FBN1), and a few are caused by mutations in the gene encoding the transforming growth factor-beta receptor (TGFBR). More than 600 mutation sites have been found in patients with Marfan syndrome, widely distributed in the entire region of the FBN1 gene, most of which are missense mutations and splice site mutations, and most gene mutations lead to loss of protein function. Fibrillin-1 is the basis for the formation of elastic fibers in connective tissue, which are distributed throughout various tissue systems in the body. Loss of the structural support provided by this fibrillin can lead to aortic dilatation, arterial dissection and even rupture, as well as widespread dysplasia of mesoderm tissue throughout the body, resulting in multi-system damage.

[0005] It is reported that the incidence of MFS is 1 / 5000 to 1 / 3000. There is no gender predisposition in the onset of Marfan syndrome, and its mutation rate has no regional predisposition. However, gender can lead to certain differences in the clinical manifestations of MFS. For example, retrospective observations have found that the incidence of ascending aortic dilatation and the risk of vascular events in male MFS are 40% higher than those in females.

[0006] In addition, congenital contractural arachnodactyly (CCA) is also known as contracture spider finger (toe) syndrome. This disease is often confused with Marfan syndrome due to Marfan-like appearance, spider finger deformity, joint contracture and some facial features. CCA is caused by mutations in the gene encoding the connective tissue protein fibrillin-2 (FBN2), which has 78% homology with the FBN1 gene, so there are many similarities in clinical symptoms.

[0007] High-throughput sequencing is also known as next-generation sequencing. In recent years, with the advancement of high-throughput sequencing technology, sequencing costs have continued to decline, sequencing service objects and application segments have continued to expand, and the market size of high-throughput sequencing has continued to grow. With favorable policy conditions, the clinical application of high-throughput sequencing technology in reproductive health and personalized tumor medicine has entered the fast lane, and its application prospects are broad.

[0008] The sensitivity of NGS (next-generation gene sequencing) detection technology is much higher than that of current traditional detection technology. It can detect 0.03% point mutations and less than 0.1% gene fusions, and can perform multi-level DNA and RNA detection to ensure detection accuracy.

[0009] To sequence the genome sequence, in order to reduce costs, it is often necessary to design a gene panel with a certain diagnostic value. The common methods for enriching the target genes in the panel are multiplex PCR and probe hybridization capture. Multiplex PCR refers to the technology of using multiple DNA fragments as templates and multiple pairs of primers mixed in the same reaction system to amplify multiple targeted regions at the same time. This technology requires the design of primers, which need to have high specificity. At the same time, attention should be paid to avoid the generation of dimers between primers, and the amplification reaction temperature also needs to be strictly controlled. The length of the DNA fragment that can be amplified is mostly between 50bp and 2.5kb.

[0010] Hybridization capture requires designing specific probes for the genomic region of interest, and using the principle of complementary hybridization of nucleic acid bases to hybridize with genomic DNA to enrich DNA fragments in the target genomic region. The genomic DNA is then interrupted, and after adding sequencing adapters, it is hybridized with the probe to capture the target genomic DNA region, recover the target DNA fragments, and directly construct a high-throughput sequencing library. The main parameters for measuring capture and sequencing effects are sequencing depth, coverage of the target region, 0.2X uniformity, and GC bias (GC preference).

[0011] Sequencing technology can help us gain a more comprehensive understanding of Marfan syndrome-related genes and make further differential diagnosis for similar diseases. However, existing sequencing technologies have not yet been able to sequence the target regions of Marfan syndrome-related genes. Therefore, if Marfan syndrome-related genes are to be detected, whole genome sequencing or exon sequencing of the sample to be tested is required. However, such sequencing costs are high and are not conducive to high-throughput sequencing analysis of Marfan syndrome-related genes. Summary of the invention

[0012] The purpose of the present invention is to provide a capture probe group, a capture kit and a library construction method for Marfan syndrome related genes FBN1 and FBN2. The capture probe group in the present invention includes two groups of probes with sequences as shown in SEQ ID No.1-149 and SEQ ID No.150-238, which can specifically capture the target genes FBN1 and FBN2, and perform high-throughput sequencing, so that the sequencing target genes are accurate and the sequencing cost is reduced. The kit containing the capture probe group can effectively capture the target gene, and can reduce its detection cost and improve the detection sensitivity.

[0013] In order to achieve the above object, the present invention provides the following technical solutions:

[0014] The present invention provides a capture probe set for a Marfan syndrome-related gene, wherein the capture probe set specifically captures a gene called FBN1, and the sequence of the capture probe set is shown in SEQ ID No. 1 to SEQ ID No. 149. Specifically, the gene FBN1 and its chromosome coordinate information are shown in the following table:

[0015] Gene name Capture Length chromosome Gene start site Gene termination site FBN1 11609 chr15 48700510 48937906

[0016] Furthermore, the probe may be labeled with a group that facilitates identification, which may be a radioactive isotope such as 3H, 35S, 125I or 32P, or a non-radioactive substance such as fluorescein, biotin, digoxigenin, and the like.

[0017] Furthermore, the probes contained in the capture probe group are labeled with biotin.

[0018] In some embodiments of the present invention, biotin is labeled at the 5' end of the probe.

[0019] The present invention also provides a kit for library construction, wherein the kit at least comprises the above-mentioned capture probe group.

[0020] Furthermore, the kit further comprises at least one of the following reagents:

[0021] The linker whose sequence is shown as SEQ ID No.239 to SEQ ID No.240;

[0022] Preamplification primers having sequences as shown in SEQ ID No.241 to SEQ ID No.242;

[0023] The sequences are sequencing tags shown as SEQ ID No.243 to SEQ ID No.244.

[0024] The present invention also provides a method for constructing a Marfan syndrome-related gene sequencing library, the construction method comprising using the capture probe set or the kit to capture the gene FBN1.

[0025] Furthermore, the construction method adds a connector to the DNA fragment, then uses a capture probe group to capture and enrich the target gene FBN1, and finally adds a sequencing tag; the sequence of the capture probe group is shown in SEQ ID No.1 to SEQ ID No.149; the sequence of the connector is shown in SEQ ID No.239 to SEQ ID No.240; the sequence of the sequencing tag is shown in SEQ ID No.243 to SEQ ID No.244.

[0026] Furthermore, the construction method specifically comprises the following steps:

[0027] Step 1: genomic DNA fragmentation and end repair;

[0028] Step 2: Adapter ligation and purification;

[0029] Step 3: Prelibrary PCR amplification and purification and library quantification;

[0030] Step 4: Add capture probe set to hybridize with pre-library, capture and enrich target gene (FBN1) fragments, and perform PCR amplification, library purification and library quantification after capture.

[0031] The present invention also provides a sequencing method for the Marfan syndrome-related gene sequencing library constructed by the above construction method, the sequencing method comprising: performing double-end sequencing on the constructed library on a sequencing platform to obtain sequencing data.

[0032] Furthermore, the sequencing method also includes performing bioinformatics analysis on the sequencing data.

[0033] The present invention also provides an application of the capture probe set, kit, library construction method or sequencing method, wherein the application is selected from any one of the following applications:

[0034] 1) Application in the preparation of products for detecting FBN1 gene mutations;

[0035] 2) Use in the preparation of products for diagnosis or auxiliary diagnosis of Marfan syndrome;

[0036] 3) Application in the preparation of products for screening of Marfan syndrome-related gene FBN1;

[0037] 4) Application in studying the role of FBN1 gene in Marfan syndrome.

[0038] The present invention also provides another capture probe set for Marfan syndrome-related genes, wherein the capture probe set specifically captures FBN2 or a combination of FBN1 and FBN2, and the sequence of the capture probe set is shown in SEQ ID No. 150 to SEQ ID No. 238 or in SEQ ID No. 1 to SEQ ID No. 238. Specifically, the gene FBN2 and its chromosome coordinate information are shown in the following table:

[0039] Gene name Capture Length chromosome Gene start site Gene termination site FBN2 10927 chr5 127593601 127873938

[0040] Furthermore, the probe may be labeled with a group that facilitates identification, which may be a radioactive isotope such as 3H, 35S, 125I or 32P, or a non-radioactive substance such as fluorescein, biotin, digoxigenin, and the like.

[0041] Furthermore, the probes contained in the capture probe group are labeled with biotin.

[0042] In some embodiments of the present invention, biotin is labeled at the 5' end of the probe.

[0043] The present invention also provides a kit for library construction, wherein the kit at least comprises the capture probe set shown in SEQ ID No. 150 to SEQ ID No. 238 or in SEQ ID No. 1 to SEQ ID No. 238.

[0044] Furthermore, the kit further comprises at least one of the following reagents:

[0045] The linker whose sequence is shown as SEQ ID No.239 to SEQ ID No.240;

[0046] Preamplification primers having sequences as shown in SEQ ID No.241 to SEQ ID No.242;

[0047] The sequences are sequencing tags shown as SEQ ID No.243 to SEQ ID No.244.

[0048] The present invention also provides a method for constructing a Marfan syndrome-related gene sequencing library, the construction method comprising using the capture probe set or the kit to capture the gene FBN2 or a combination of FBN1 and FBN2.

[0049] Furthermore, the construction method adds a connector to the DNA fragment, then uses a capture probe group to capture and enrich the target gene FBN2 or the combination of FBN1 and FBN2, and finally adds a sequencing tag; the capture probe group is used to capture the gene FBN2 or the combination of FBN1 and FBN2, and the sequence of the capture probe group is shown in SEQ ID No.150 to SEQ ID No.238 or as shown in SEQ ID No.1 to SEQ ID No.238; the sequence of the connector is shown in SEQ ID No.239 to SEQ IDNo.240; the sequence of the sequencing tag is shown in SEQ ID No.243 to SEQ ID No.244.

[0050] Furthermore, the construction method specifically comprises the following steps:

[0051] Step 1: genomic DNA fragmentation and end repair;

[0052] Step 2: Adapter ligation and purification;

[0053] Step 3: Prelibrary PCR amplification and purification and library quantification;

[0054] Step 4: Add capture probe set to hybridize with pre-library, capture and enrich target gene (FBN2 or FBN1+FBN2) fragments, and perform PCR amplification, library purification and library quantification after capture.

[0055] The present invention also provides a sequencing method for the Marfan syndrome-related gene sequencing library constructed by the above construction method, the sequencing method comprising: performing double-end sequencing on the constructed library on a sequencing platform to obtain sequencing data.

[0056] Furthermore, the sequencing method also includes performing bioinformatics analysis on the sequencing data.

[0057] The present invention also provides an application of the capture probe set, kit, library construction method or sequencing method, wherein the application is selected from any one of the following applications:

[0058] 1) Application in the preparation of products for detecting FNB2 gene mutation or simultaneous mutation of FNB1 gene and FNB2 gene;

[0059] 2) Use in the preparation of products for diagnosis or auxiliary diagnosis of Marfan syndrome;

[0060] 3) Application in the preparation of products for screening Marfan syndrome-related gene FBN2 or simultaneous screening of FNB1 and FNB2;

[0061] 4) Application in studying the role of FBN2 gene in Marfan syndrome.

[0062] Compared with the prior art, the present invention has the following beneficial effects:

[0063] (1) The capture probe set of Marfan syndrome-related genes (FBN1 and FBN2) provided by the present invention can capture specific coding regions and perform high-throughput sequencing, so that the sequencing target genes are accurate and the sequencing cost is reduced.

[0064] (2) The capture kit for Marfan syndrome-related genes (FBN1 and FBN2) provided by the present invention comprises the above-mentioned capture probe group, which can effectively capture the related genes, reduce the detection cost of the related genes and improve the detection sensitivity.

[0065] (3) The method for constructing a sequencing library of Marfan syndrome-related genes (FBN1 and FBN2) provided by the present invention uses a capture probe set of the above genes and uses liquid phase hybridization sequence capture technology to enrich the target genes, which can effectively enrich the target genes, reduce the sample size requirements, and better control the sequencing costs.

[0066] (4) The use of the Marfan syndrome-related gene (FBN1 and FBN2) capture probe set, capture kit and sequencing library construction method provided by the present invention in the screening of related genes can conduct a more in-depth study on the characteristics of related genes, including not only whether certain characteristics are contained in the screening samples, but also further analysis of the SNPs (single nucleotide polymorphisms) and Indels (base insertions and deletions) of these genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 The sanger validation result for variant 1: FBN1 chr15:48717680c.7339C>A;

[0068] Figure 2 The sanger validation result for variant 2: FBN1 chr15:48757777c.4930G>A;

[0069] Figure 3 The sanger validation result for variant 3: FBN1 chr15:48722933c.6806A>G;

[0070] Figure 4The sanger validation result for variant 4: FBN1 chr15:48805788c.1546G>A;

[0071] Figure 5 The sanger validation result for variant 5: FBN1 chr15:48712992c.7711A>G;

[0072] Figure 6 The sanger validation result for variant 6: FBN1 chr15:48812913c.1090C>T;

[0073] Figure 7 This is the Sanger verification result of variant 7: FBN1 chr15:48758017c.4786C>T. DETAILED DESCRIPTION

[0074] In order to make the present invention more clearly understood, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0075] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0076] Example 1 Design of Marfan syndrome related gene (FBN1 and FBN2) capture probe set

[0077] The captured genes and their chromosome coordinate information in this example are shown in Table 1, and the sequence information of the designed capture probe set is shown in Table 2.

[0078] Table 1 Details of the genes captured in the present invention and their chromosome coordinate information

[0079] Gene name Capture Length chromosome Gene start site Gene termination site FBN1 11609 chr15 48700510 48937906 FBN2 10927 chr5 127593601 127873938

[0080] Table 2 Details of the capture probe set sequences in the present invention

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104] Among them, SEQ ID No. 1 to SEQ ID No. 149 represent FBN1 gene probe sequences, and SEQ ID No. 150 to SEQ ID No. 238 represent FBN2 gene probe sequences. The 5' ends of these probe sequences are modified with biotin.

[0105] The capture probe set is designed according to the following rules:

[0106] The probe length is 120 bp;

[0107] The probe adopts a flat-lay design;

[0108] The probe reference is the sense strand of the gene;

[0109] During probe design, probe specificity is ensured by comparing whole genome information;

[0110] Probes were designed in an in-depth manner in regions with low GC content.

[0111] Example 2 Preparation of a kit for library construction

[0112] This embodiment provides a kit for constructing a library of Marfan syndrome-related genes (FBN1 and FBN2), the kit comprising the following reagents:

[0113] Disconnect the final repair master mix;

[0114] Ligase;

[0115] Ligation buffer;

[0116] Amplification master mix;

[0117] Pre-amplification primers;

[0118] Sealant;

[0119] Hybridization solution A;

[0120] Hybridization solution B;

[0121] Magnetic bead washing solution;

[0122] Washing liquid 1;

[0123] Washing liquid 2;

[0124] Washing liquid 3;

[0125] Washing liquid 4;

[0126] Capture probe-F1 (i.e., the capture probe set described in Example 1);

[0127] Tag primer;

[0128] Capture magnetic beads.

[0129] In this embodiment, except for the capture probe, the other reagents can be purchased through commercial channels; the capture magnetic beads are streptavidin magnetic beads, which can be combined with the biotin-labeled probe.

[0130] Example 3 Design of synthetic linker sequence and tag sequence

[0131] The linker sequence designed and synthesized in this example is:

[0132] Adapter sequence Adapter-1:

[0133] 5'-phos-CTACACGACGCTCTTCCGATCTT-3' (SEQ ID No. 239);

[0134] Adapter sequence Adapter-2:

[0135] 5'-AGATCGGAAGAGCACACGTCTG-3' (SEQ ID No. 240);

[0136] The pre-amplification primer sequences designed in this embodiment are:

[0137] F: 5'-CTACACGACCTCTTCCG-3' (SEQ ID No. 241);

[0138] R: 5'-CAGACGTGTGCTCTTCCG-3' (SEQ ID No. 242);

[0139] The tag primer sequence contains the tag part:

[0140] 5'-GCATGGCGACCTTATCAG[Barcode-1]TTGTTCTTCCTAAGACCGCTTGG

[0141] -3' (SEQ ID No. 243);

[0142] The index primer sequence does not contain the index part:

[0143] 5'-CAAGCAGAAGACGGCATACGAGATCCGATGTGTGACTGGAGTTCAG ACGTGTGCTCTTCCG-3' (SEQ ID No. 244);

[0144] Example 4 Library Construction and Sequencing

[0145] This example provides a library construction method, the library is used for 150PE sequencing based on the BGI platform, and the library construction and sequencing process is as follows:

[0146] Step 1: Genomic DNA fragmentation and end repair

[0147] 1. Centrifuge the genomic DNA of the sample to be used for library construction, place it on an ice box, take 50 μL of genomic DNA, add 10 μL of fragmentation premix, vortex to mix, and centrifuge instantly. Note: To avoid uneven fragmentation caused by time differences, this sample addition step must be performed on ice.

[0148] 2. Start the reaction program on the PCR instrument: 4℃1min, 30℃15min, 72℃20min, 4℃Hold, reaction volume set to 60μL, heated cover at 75℃.

[0149] Step 2: Adapter ligation and purification

[0150] 1. Centrifuge the product from the previous step, place it on an ice box, add 30 μL of ligation buffer and 5 μL of ligase (if there is too much sample, mix the ligation buffer and ligase in advance and then dispense 35 μL).

[0151] 2. Add 5 μL of connector to the wall of the PCR tube, vortex to mix, and centrifuge instantly to place all the reaction liquid at the bottom of the PCR tube. Note: The connector should avoid premature contact with the connection buffer and ligase, otherwise more connector dimers will be formed.

[0152] 3. Start the reaction program on the PCR instrument: 20℃15min, 4℃Hold, reaction volume set to 100μL, no hot cover required.

[0153] 4. Invert and mix the purified magnetic beads, equilibrate at room temperature for 30 minutes, add 75 μL of purified magnetic beads to the ligation reaction product in step 3, mix well, and incubate at room temperature for 5 minutes.

[0154] 5. Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Use a pipette to remove the supernatant, being careful not to suck up the magnetic beads.

[0155] Note: It must be made clear that different brands of magnetic racks require adjustment of the placement time.

[0156] 6. Slowly add 150 μL of 80% ethanol solution along the side wall of the PCR tube, being careful not to disturb the magnetic beads. Let it stand for 30 seconds, and use a pipette to remove and discard the supernatant, being careful not to suck up the magnetic beads.

[0157] 7. Repeat the above steps once.

[0158] 8. Centrifuge the PCR tube briefly and place it on a magnetic rack. Use a 10μL pipette tip to remove a small amount of residual 80% ethanol solution, being careful not to suck up the magnetic beads.

[0159] 9. Open the PCR tube cap and let it stand at room temperature for about 2-3 minutes until the ethanol evaporates completely (the surface of the magnetic beads is rough and not smooth.

[0160] Note: Do not over-dry, otherwise it will affect the DNA recovery efficiency.

[0161] 10. Remove the PCR tube from the magnetic stand, add 25 μL Nuclease Free Water to the PCR tube, mix thoroughly, centrifuge briefly to remove droplets from the tube cap, and let stand at room temperature for 5 to 10 minutes.

[0162] 11. Place the reaction tube on the magnetic rack, adsorb for 3 minutes, and then aspirate 23 μL of supernatant and place it in a new PCR tube.

[0163] Step 3: Prelibrary amplification and purification

[0164] 1. Place the purified and recovered product in the previous step on an ice box, add 25 μL amplification premix and 2 μL preamplification primer, mix well, and centrifuge instantly to place all the reaction solution at the bottom of the PCR tube.

[0165] 2. Place the PCR tube in the PCR instrument and start the following program: 98℃45s; (98℃15s, 58℃30s, 72℃30s) 11 cycles; 72℃1min, 4℃Hold, volume set to 50μL, hot cover at 105℃.

[0166] 3. Use the purified magnetic beads to purify the product from the previous step. Before purification, invert the magnetic beads to mix well and equilibrate at room temperature for 30 minutes. Add 75 μL of purified magnetic beads to the PCR tube of the amplified product, mix well, and incubate at room temperature for 5 minutes.

[0167] 4. Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Use a pipette to remove the supernatant, but be careful not to absorb the magnetic beads.

[0168] Note: It must be made clear that different brands of magnetic racks require adjustment of the placement time.

[0169] 5. Slowly add 150 μL of 80% ethanol solution along the side wall of the PCR tube, being careful not to disturb the magnetic beads. Let it stand for 30 seconds, and use a pipette to remove and discard the supernatant, being careful not to suck up the magnetic beads.

[0170] 6. Repeat the above steps once.

[0171] 7. Centrifuge the PCR tube briefly and place it on a magnetic rack. Use a 10μL pipette tip to remove a small amount of residual 80% ethanol solution, being careful not to suck up the magnetic beads.

[0172] 8. Open the PCR tube cap and let it stand at room temperature for about 5 minutes until the ethanol evaporates completely (the surface of the magnetic beads is rough and not smooth.

[0173] Note: Do not over-dry, otherwise it will affect the DNA recovery efficiency.

[0174] 9. Remove the PCR tube from the magnetic stand, add 35 μL Nuclease Free Water to the PCR tube, mix thoroughly, centrifuge briefly to remove droplets from the tube cap, and let stand at room temperature for 5 to 10 minutes.

[0175] 10. Place the reaction tube on the magnetic rack, adsorb for 3 minutes, and aspirate 33 μL of supernatant into a new PCR tube to prepare the pre-library.

[0176] Step 4: Quantification of the library

[0177] Use a fluorescence quantification instrument (such as QubitTM 3.0 Fluorometer) or quantitative PCR to quantify the library. The library fragment distribution quality inspection was performed using fragment analysis instruments such as Agilent and Qsep100 (Bioptic).

[0178] Step 5: Hybridization of the library

[0179] 1. Take 1 to 8 purified pre-libraries of equal amount (500 ng per library) and mix them. After the pre-libraries are mixed, fill them up to 60 μL with nuclease-free deionized water, and then add 5 μL of blocking agent.

[0180] 2. Invert and mix the magnetic beads that have been equilibrated at room temperature for 30 minutes. Take 100 μL of purified magnetic beads and add them to the reaction tube in the previous step. After thorough mixing, centrifuge briefly to remove droplets from the tube cap and let stand at room temperature for 5 to 10 minutes.

[0181] 3. After standing, place the product on a magnetic rack and adsorb for 5 minutes. Then use a pipette to remove the supernatant, being careful not to absorb the magnetic beads.

[0182] 4. Slowly add 150 μL of 80% ethanol solution along the wall of the centrifuge tube, being careful not to disturb the magnetic beads. Let it stand for 30 seconds and use a pipette to remove and discard the supernatant.

[0183] 5. Repeat the above steps once.

[0184] 6. After instant centrifugation, place the centrifuge tube on a magnetic rack and use a 10μL pipette to remove a small amount of residual 80% ethanol solution. Be careful not to suck up the magnetic beads.

[0185] 7. Leave the magnetic beads to dry at room temperature for 5 minutes until the ethanol evaporates completely (the surface of the magnetic beads is rough, not smooth).

[0186] Note: Do not over-dry, otherwise it will affect the DNA recovery efficiency.

[0187] 8. Remove the centrifuge tube from the magnetic stand, and then add 9.5 μL of hybridization solution A, 3 μL of hybridization solution B, and 6.5 μL of capture probe-F1.

[0188] 9. Vortex to mix the magnetic beads and hybridization reaction solution thoroughly, incubate at 65℃ for 4 minutes, vortex to mix, centrifuge briefly, and let stand at room temperature for 4 minutes.

[0189] 10. Centrifuge the centrifuge tube briefly and place it on a magnetic rack until the liquid is completely clear. Use a pipette to transfer 17 μL of supernatant to a new PCR tube.

[0190] 11. Start the following hybridization program on the PCR instrument: 95℃ for 2 min; 65℃ for 12 h, hold at 65℃, heat cover at 105℃, reaction system 17μL.

[0191] Note: The hybridization time should be no less than 12 hours and no more than 24 hours.

[0192] Step 6: Cleaning fluid working fluid configuration table 3

[0193] Table 3 Cleaning fluid working fluid configuration

[0194] Components Stock solution volume (μL) Water volume added (μL) Working solution volume (μL) Magnetic beads washing solution (2x) 150 150 300 Washing solution 1 (10x) 30 270 300 Washing solution 2 (10x) 25 225 250 Washing solution 3 (10x) 15 135 150 Washing solution 4 (10x) 15 135 150

[0195] Note: The working solutions of Wash Solution 1 (10x) and Wash Solution 2 (10x) must be incubated at 65°C for at least 15 min.

[0196] Step 7: Preparation of magnetic bead suspension

[0197] Hybridization solution A 8.5 μL;

[0198] Hybridization solution B 2.7 μL;

[0199] Nuclease-Free Water 5.8μL.

[0200] Step 8: Washing the capture beads

[0201] 1. Vortex the capture beads for 15 seconds to ensure complete mixing, and equilibrate at room temperature for 30 minutes. Pipette 50 μL of magnetic beads into a PCR tube, place on a magnetic rack for 1 minute until the solution is clear, and remove the supernatant.

[0202] 2. Add 100 μL of the prepared magnetic bead cleaning solution, mix thoroughly, place on the magnetic stand for 1 min until the solution is clear, and remove the supernatant.

[0203] 3. Repeat the previous step two additional times.

[0204] 4. After removing the supernatant for the last time, centrifuge briefly to remove droplets from the tube cap, place the PCR tube on a magnetic rack, and use a 10μL pipette to remove as much residual liquid as possible.

[0205] 5. Add 17 μL of the prepared magnetic bead suspension (the capture magnetic bead resuspension should be fully mixed before adding), vortex mix, centrifuge briefly, fasten the tube cap, and place at 65°C for 5 min.

[0206] Step 9: Magnetic Bead Capture

[0207] 1. After the hybridization reaction, adjust the PCR instrument to the elution program: 65℃∞, hot cover 70℃, reaction system: 34μL.

[0208] 2. Add the resuspended capture beads to the hybridization system and mix by gently pipetting or vortexing.

[0209] 3. Incubate at 65°C for 45 minutes. Gently vortex every 15 minutes to ensure that the magnetic beads are completely resuspended. The reaction temperature should be kept around 65°C throughout the operation.

[0210] Step 10: High temperature washing

[0211] 1. After the incubation is completed, remove the PCR tube from the PCR instrument and add 100 μL of preheated 65℃ Wash Solution 1 working solution to it, and mix the hybridization system containing magnetic beads by pipetting. (The hot elution process should be performed quickly; try to avoid bubbles during the mixing process.)

[0212] 2. Add 100 μL of preheated 65℃ Wash Buffer 2 working solution, gently pipette 10 times to mix evenly, and centrifuge briefly to remove droplets from the tube cap. Place the PCR tube on a magnetic rack, and after the liquid is completely clarified, use a pipette to remove the supernatant.

[0213] 3. Remove the PCR tube from the magnetic rack, add 150 μL of preheated 65°C Wash Buffer 1 working solution, gently pipette 10 times to mix evenly, put it into the PCR instrument and incubate at 65°C for 5 minutes, then place it on the magnetic rack for 1 minute until the solution is clear, and remove the supernatant.

[0214] 4. Repeat the previous step two additional times.

[0215] Step 11: Wash at room temperature

[0216] 1. Remove the sample from the magnetic rack, add 150 μL of room temperature washing solution 2, vortex mix for 30 seconds, let stand at room temperature for 30 seconds, and vortex mix for 30 seconds. Centrifuge the PCR tube and place it on the magnetic rack for 1 minute. After the liquid is completely clarified, remove the supernatant.

[0217] 2. Remove the sample from the magnetic rack, add 150 μL of room temperature washing solution 3, vortex mix for 30 seconds, let stand at room temperature for 30 seconds, and vortex mix for 30 seconds. Centrifuge the PCR tube and place it on the magnetic rack for 1 minute. After the liquid is completely clarified, remove the supernatant.

[0218] 3. Remove the sample from the magnetic rack, add 150 μL of room temperature washing solution 4, vortex mix for 30 seconds, let stand at room temperature for 30 seconds, and vortex mix for 30 seconds. Centrifuge the PCR tube and place it on the magnetic rack for 1 minute. After the liquid is completely clarified, remove the supernatant.

[0219] 4. Use a 10μL pipette tip to remove a small amount of residual Wash 4 working solution.

[0220] 5. Remove the PCR tube from the magnetic stand, add 20 μL Nuclease-Free Water, and use a pipette to gently pipette 10 times to ensure even mixing. (Note: Do not remove the magnetic beads from the magnetic stand, and proceed to the next step with the magnetic beads.)

[0221] Step 12: Post-capture PCR amplification

[0222] 1. Centrifuge 20 μL of the magnetic beads with captured DNA in the previous step, place on ice, add 25 μL of amplification premix and 5 μL of label primer, mix well, and centrifuge.

[0223] 2. Set the PCR instrument to the following program: 98℃45s; (98℃15s, 58℃30s, 72℃30s) 11 cycles, 72℃1min, 4℃∞, volume set to 50μL, hot cover 105℃. Place the reaction tube and start PCR amplification. (The amplified product can be stored at 4℃ overnight.)

[0224] Step 13: Library purification

[0225] 1. Use the purified magnetic beads to purify the product from the previous step. Before purification, invert the magnetic beads to mix well and equilibrate at room temperature for 30 minutes. Add 75 μL of purified magnetic beads to the PCR tube of the amplified product, mix well, and leave at room temperature for 8 minutes.

[0226] 2. After standing, place the product on a magnetic rack and adsorb for 5 minutes. Then use a pipette to remove the supernatant, being careful not to absorb the magnetic beads.

[0227] 3. Slowly add 150 μL of 80% ethanol solution along the side wall of the PCR tube, being careful not to disturb the magnetic beads. Let it stand for 30 seconds, and use a pipette to remove and discard the supernatant, being careful not to suck up the magnetic beads.

[0228] 4. Repeat the above steps once.

[0229] 5. Centrifuge the PCR tube briefly and place it on a magnetic rack. Use a 10μL pipette tip to remove a small amount of residual 80% ethanol solution, being careful not to suck up the magnetic beads.

[0230] 6. Open the PCR tube cap and let it stand at room temperature for about 5 minutes until the ethanol evaporates completely (the surface of the magnetic beads is rough and not smooth.

[0231] Note: Do not over-dry, otherwise it will affect the DNA recovery efficiency.

[0232] 7. Remove the PCR tube from the magnetic rack, add 35 μL of Tris solution (10 mM Tris, pH = 8.5) to the PCR tube, mix thoroughly, centrifuge briefly to remove droplets from the tube cap, and let stand at room temperature for 5 to 10 minutes.

[0233] 10. Place the reaction tube on the magnetic rack, adsorb for 1 min, and aspirate 33 μL of supernatant into a new EP tube.

[0234] Step 14: Quantification of the library

[0235] Use a fluorescence quantification instrument (such as QubitTM 3.0 Fluorometer) or quantitative PCR to quantify the library. The library fragment distribution quality inspection was performed using fragment analysis instruments such as Agilent and Qsep100 (Bioptic).

[0236] Step 15: Sequencing

[0237] Using the final product of step thirteen, the captured region was sequenced with the MGISEQ-2000 second-generation sequencer produced by Wuhan MGI Intelligent Manufacturing Technology Co., Ltd., with a read length of 150 bp.

[0238] Step 16: Bioinformatics Analysis

[0239] The bioinformatics analysis process is as follows:

[0240] 1. The original FASTQ data was quality controlled, the adapters were removed, and low-quality data were filtered using fastp (version 0.23.2).

[0241] 2. The filtered FASTQ was aligned to the human reference genome (buildhg19) using bwa-mem (version 2.2.1) to generate an alignment file.

[0242] 3. The alignment files were processed and quality controlled using samblaster (version 0.1.26), samtools (version 1.16.1), and mosdepth (version 0.3.3).

[0243] 4. The processed alignment files were used for variation detection using gatk (version 4.3.0.0).

[0244] 5. The mutation detection results were filtered and quality controlled using bcftools (version 1.16).

[0245] 6. The mutation detection results were annotated using snpeff (version 5.0) and annovar (version 2020-06-08).

[0246] Step 17: Report Interpretation

[0247] Step 18: Sanger sequencing verification.

[0248] Application Example 1

[0249] In this example, FBN1 and FBN2 genes were detected in 42 patients clinically diagnosed with Marfan syndrome according to the method described in Example 4. Among them, the gene detection results of 20 probands were found to carry FBN1 gene mutations, and the detection positive rate was 47.6%; among them, 17 (40.5%) probands had P (pathogenic) or LP (possibly pathogenic), and 3 (7.1%) probands carried gene mutations of uncertain significance (VUS). The statistical results are shown in Table 4.

[0250] Table 4: Statistical results of genetic testing of probands

[0251]

[0252] The genetic test results of all probands are shown in Table 5 .

[0253] Table 5: FBN1 gene test results of all probands

[0254]

[0255]

[0256] Among them, 7 FBN1 gene pathogenic variants (P) were verified by Sanger, and the results were as follows Figures 1 to 7 shown.

[0257] The above description is only a preferred embodiment of the present invention and is not any formal or substantial limitation of the present invention. It should be pointed out that a person skilled in the art can make several improvements and supplements without departing from the present invention, and these improvements and supplements should also be regarded as the protection scope of the present invention.

Claims

1. A capture probe set for Marfan syndrome-related genes, characterized in that: The gene specifically captured by the capture probe group is FBN1, and the sequences of the capture probe group are shown in SEQ ID No.1 to SEQ ID No.

149.

2. A kit for library construction, characterized in that: The kit at least comprises the capture probe set according to claim 1.

3. The kit according to claim 2, characterized in that The kit also includes at least one of the following reagents: The linker whose sequence is shown as SEQ ID No.239 to SEQ ID No.240; Preamplification primers having sequences as shown in SEQ ID No.241 to SEQ ID No.242; The sequences are sequencing tags shown as SEQ ID No.243 to SEQ ID No.

244.

4. A method for constructing a Marfan syndrome-related gene sequencing library, characterized in that: The construction method comprises using the capture probe set according to claim 1 or the kit according to any one of claims 2 to 3 to capture the gene FBN1.

5. The construction method according to claim 4, characterized in that: The construction method adds a connector to the DNA fragment, then uses a capture probe group to capture and enrich the target gene FBN1, and finally adds a sequencing tag; the sequence of the capture probe group is shown in SEQ ID No.1 to SEQ ID No.238; the sequence of the connector is shown in SEQ ID No.239 to SEQ IDNo.240; the sequence of the sequencing tag is shown in SEQ ID No.243 to SEQ ID No.

244.

6. The construction method according to claim 4, characterized in that: The construction method specifically comprises the following steps: Step 1: genomic DNA fragmentation and end repair; Step 2: Adapter ligation and purification; Step 3: Prelibrary PCR amplification and purification and library quantification; Step 4: Add capture probe set to hybridize with pre-library, capture and enrich target gene fragments, and then perform PCR amplification, library purification and library quantification after capture.

7. A method for sequencing a Marfan syndrome-related gene sequencing library constructed using the construction method according to any one of claims 4 to 6, characterized in that: The sequencing method comprises: performing double-end sequencing on the constructed library on a sequencing platform to obtain sequencing data.

8. A use of the capture probe set according to claim 1, the kit according to any one of claims 2 to 3, the library construction method according to any one of claims 4 to 6, or the sequencing method according to claim 7, characterized in that: The application is selected from any of the following applications: 1) Application in the preparation of products for detecting FBN1 gene mutations; 2) Use in the preparation of products for diagnosis or auxiliary diagnosis of Marfan syndrome; 3) Application in the preparation of products for screening of Marfan syndrome-related gene FBN1; 4) Application in studying the role of FBN1 gene in Marfan syndrome.

9. A capture probe set for Marfan syndrome-related genes, characterized in that: The gene specifically captured by the capture probe group is FBN2 or a combination of FBN1 and FBN2. The sequence of the capture probe group is shown as SEQ ID No.150 to SEQ ID No.238 or as shown as SEQ ID No.1 to SEQ ID No.

238.

10. A kit for library construction, characterized in that: The kit at least comprises the capture probe set according to claim 9.

11. The kit according to claim 10, characterized in that The kit also includes at least one of the following reagents: The linker whose sequence is shown as SEQ ID No.239 to SEQ ID No.240; Preamplification primers having sequences as shown in SEQ ID No.241 to SEQ ID No.242; The sequences are sequencing tags shown as SEQ ID No.243 to SEQ ID No.

244.

12. A use of the capture probe set according to claim 9 or the kit according to any one of claims 10 to 11, characterized in that: The application is selected from any of the following applications: 1) Application in the preparation of products for detecting FNB2 gene mutation or simultaneous mutation of FNB1 gene and FNB2 gene; 2) Use in the preparation of products for diagnosis or auxiliary diagnosis of Marfan syndrome; 3) Application in the preparation of products for screening Marfan syndrome-related gene FBN2 or simultaneous screening of FNB1 and FNB2; 4) Application in studying the role of FBN2 gene in Marfan syndrome.

Images