Application of chromatin structural domain Y-like protein CDYL in preparation of medicine for preventing or treating heart aging

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of chromatin structural domain Y-like protein CDYL in preparation of a medicine for preventing or treating heart aging. The invention provides application of chromatin structural domain Y-like protein CDYL in preparation of a medicine for preventing or treating heart aging aiming at the problem that intervention targets or intervention modes of epigenetic modification need to be researched at present and can specifically play a role in heart aging. The invention further provides application of the chromatin structural domain Y-like protein CDYL in preparation of the medicine for preventing or treating heart aging. It is found through tests for the first time that after over-expression of chromatin structural domain Y-like protein CDYL, compared with a control senescence group, heart weight, myocardial cross-sectional area and myocardial fibrosis of mice are all remarkably reduced, and heart functions are remarkably improved. Therefore, the CDYL is taken as a target, the application of the CDYL in preparation of the medicine for preventing or treating heart aging and the novel medicine are provided, and the CDYL has important practical significance.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to use of a chromatin domain Y-like protein CDYL in preparing a drug for preventing or treating cardiac aging. Background Art

[0002] Aging is an increasingly serious global problem. At present, the aging of my country's population is accelerating, and various cardiovascular diseases caused by aging have become health problems that cannot be ignored. Cardiac aging refers to a series of structural and functional degeneration of the heart due to the increase in individual age, including myocardial cell aging, hypertrophy, excessive proliferation of myocardial fibroblasts, metabolic abnormalities of extracellular matrix such as elastin, inflammation, cardiac dysfunction, etc. Cardiac aging increases the risk of hypertension, atherosclerosis and heart failure. Current studies have shown that cardiac aging can be delayed to a certain extent through lifestyle interventions, such as aerobic exercise, a balanced diet and a regular schedule. In addition, further exploring the key molecules and molecular mechanisms of cardiac aging from a new perspective will help develop strategies that effectively delay cardiac aging and improve cardiovascular diseases in the elderly, which has important clinical significance.

[0003] Recent studies have shown that epigenetic modifications play a key role in cardiac aging and can serve as potential intervention targets. Existing studies have revealed that the Sirtuin family (such as SIRT1 and SIRT2) plays an important role in cardiac aging. For example, SIRT2 mainly activates AMPK in an LKB1-dependent manner, thereby inhibiting vascular and myocardial remodeling. It is worth noting that epigenetic modifications are reversible, which means that the level of related modifications can be regulated by drug intervention to improve cardiac function. For example, previous studies reported that the histone acetyltransferase activator SPV106 significantly restored the proliferation and differentiation levels of cardiac mesenchymal cells in diabetic patients, reduced the level of histone methylation, and significantly inhibited aging. Therefore, epigenetic modifications have broad application prospects in cardiac aging. Chromodomain Y-like (CDYL) is a protein with chromatin remodeling and transcriptional regulation functions, which plays an important role in cellular epigenetic regulation. As a crotonyl-CoA hydratase, CDYL can convert crotonyl-CoA into β-hydroxybutyryl-CoA and negatively regulate histone crotonylation modification. It has been reported that CDYL is closely related to physiological and pathological processes such as acute kidney injury, tumors and reproductive development, but whether it plays a role in cardiac aging has not been reported yet. Summary of the invention

[0004] The technical problem to be solved by the present invention is: Currently, epigenetic modification plays a key role in cardiac aging and can be used as a potential intervention target. However, which intervention targets or intervention methods can specifically act on cardiac aging remains to be studied.

[0005] The technical solution of the present invention to solve the above technical problem is: to provide a use of a chromatin domain Y-like protein CDYL in preparing a drug for preventing or treating cardiac aging.

[0006] Among them, in the above-mentioned use, the encoding nucleotide sequence of the chromatin domain Y-like protein CDYL is shown in SEQ ID NO: 1.

[0007]

[0008] Among them, in the above-mentioned use, the heart aging refers to at least one of heart dysfunction caused by aging, myocardial cell hypertrophy, increased collagen deposition in myocardial tissue, myocardial fibrosis or chronic heart failure.

[0009] Among them, in the above use, the chromatin domain Y-like protein CDYL works by overexpression.

[0010] Among them, in the above-mentioned use, the medicine also includes pharmaceutically acceptable excipients.

[0011] The present invention also provides a drug for preventing or treating heart aging, comprising a chromatin domain Y-like protein CDYL.

[0012] The beneficial effects of the present invention are:

[0013] The present invention constructs a recombinant adeno-associated virus vector that overexpresses CDYL. Studies have found that the recombinant vector can overexpress CDYL. It is also found that overexpressing CDYL can delay heart aging, improve weakened heart function caused by advanced age, relieve myocardial hypertrophy, reduce myocardial fibrosis, and reduce myocardial cell hypertrophy and myocardial fibrosis. Therefore, the present invention provides the use of the chromatin domain Y-like protein CDYL in the preparation of a drug for preventing or treating heart aging, providing a new drug and method for the intervention of heart aging. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a map of the adeno-associated virus vector used in the present invention.

[0015] Figure 2 The figure shows the timeline of animal experiments overexpressing CDYL in mice and the infection efficiency of adeno-associated virus in myocardial tissue. A shows the timeline of animal experiments; B shows the infection efficiency of adeno-associated virus in myocardial tissue detected by immunofluorescence. EGFP is an adeno-associated virus carrying element, which is labeled with green fluorescence, α-actinin is a cardiomyocyte-specific marker, which is labeled with red fluorescence, and DAPI is a cell nucleus, which is labeled with blue fluorescence.

[0016] Figure 3Overexpression of CDYL in mice significantly improved heart aging. A shows that overexpression of CDYL significantly reduced the increase in ejection fraction (EF) and fraction shortening (FS) caused by aging; B shows the statistical results of the heart weight / body weight (HW / BW) and heart weight / tibia length (HW / TL) ratios of each group. Overexpression of CDYL significantly reduced the increase in heart weight caused by aging; C shows the results of hematoxylin-eosin (H&E) staining and wheat germ agglutinin (WheatGerm Agglutinin (WGA) staining, overexpression of CDYL significantly reduced the increase in myocardial cross-sectional area caused by aging; D is that overexpression of CDYL significantly reduced the gene expression of myocardial hypertrophy markers (Nppa, Nppb and Myh7); E is that overexpression of CDYL significantly reduced myocardial fibrosis in the elderly group; F is that overexpression of CDYL significantly reduced the gene expression of myocardial fibrosis markers (Col1a1, Fn1 and Ctgf). ***, p<0.001, n=8-10. DETAILED DESCRIPTION

[0017] The present invention provides a recombinant adeno-associated virus vector expressing a chromatin domain Y-like protein CDYL, wherein the vector comprises a gene encoding the chromatin domain Y-like protein CDYL, and CDYL can be overexpressed in vivo. After constructing a recombinant adeno-associated virus vector overexpressing the chromatin domain Y-like protein CDYL, the present invention found that overexpression of CDYL can significantly improve cardiac aging in mice, and can be used as a drug intervention target for delaying cardiac aging, and a drug for delaying cardiac aging is prepared.

[0018] The present invention constructs an adeno-associated virus (AAV) carrying a cardiac troponin T (cTnT) promoter (targeting myocardial cells) to overexpress CDYL, and the overexpression control AAV and overexpression CDYLAAV are AAV9-cTnT-Ctrl and AAV-cTnT-CDYL, respectively. C57 mice in the young group (3 months old) and the old group (21 months old) were included and injected with the above virus. After 3 months, the effect of CDYL on cardiac aging was evaluated by echocardiography, pathological staining, marker detection, etc. The present invention found that compared with the control old group, the cardiac function of the old mice overexpressing CDYL was significantly improved, the myocardial cross-sectional area was significantly reduced, the myocardial fibrosis was significantly reduced, and the cardiac aging was significantly delayed. The above study confirms that CDYL can be used as a target for the preparation of cardiac aging drugs.

[0019] The specific implementation modes of the present invention will be further explained below through examples, but it is not intended to limit the protection scope of the present invention to the scope described in the examples.

[0020] The reagents and equipment used in the examples are all common commercially available products.

[0021] Example 1 In vivo experiments in mice verify the effect of CDYL on cardiac aging

[0022] An adeno-associated virus carrying the cTnT promoter targeting myocardial cells to overexpress CDYL was constructed and commissioned to be synthesized by Hanheng Biotechnology (Shanghai) Co., Ltd. The pHBAAV-TNT-3flag-P2A-EGFP vector map is as follows: Figure 1 The overexpression target sequence is shown in SEQ: NO: 1.

[0023] Twenty young (3-month-old) C57 mice were randomly divided into two groups and injected with AAV9-cTnT-Ctrl and AAV-cTnT-CDYL, respectively. Twenty old (21-month-old) C57 mice were randomly divided into two groups and injected with AAV9-cTnT-Ctrl and AAV-cTnT-CDYL, respectively. The virus titer was 5×10 11 vg. After 3 months, echocardiography, pathological staining, and marker detection were used to evaluate the effect of CDYL on cardiac aging. Figure 2 As shown in A.

[0024] (1) Echocardiography to evaluate cardiac function in mice: Before the ultrasound examination, the mice were anesthetized by inhalation of isoflurane, and the anesthetized mice were fixed in a supine position on the monitoring table. The hair on the chest of the mice was removed. The heart rate of the mice was maintained at 400-500 beats / min during the ultrasound examination. The 3100 small animal high-frequency ultrasound imaging system was used, and the MX400 probe (30MHz) was selected. After continuous observation of several cardiac cycles in the long-axis section and short-axis section, echocardiographic images were collected. Vevo LAB5.5.1 software was used to analyze the images and calculate EF and FS to evaluate the cardiac function of mice. The results are shown in Figure 3 As shown in A, the results show that compared with the young group of mice, the EF and FS of the old mice were significantly decreased, while overexpression of CDYL significantly upregulated the EF and FS values ​​of the old mice. This result shows that CDYL can significantly improve the decline in cardiac function caused by aging.

[0025] (2) The mice were euthanized, weighed, dissected, and the heart was removed. The residual blood was gently squeezed out, and the heart was washed twice with ice PBS and weighed and recorded. The tibia of the mice was removed and the length was measured with a vernier caliper and recorded. The ratio of heart weight to body weight and the ratio of heart weight to tibia length were calculated as follows: Figure 3 As shown in B. The results show that compared with the young group of mice, the heart weight to body weight ratio and heart weight to tibia length ratio of the old group increased significantly, while knocking down CDYL significantly reduced the ratio. This result shows that knocking down CDYL significantly reduced the increase in heart weight caused by aging.

[0026] (3) Immunofluorescence detection of the infection efficiency of adeno-associated virus in the mouse myocardium: The fixed tissue was fixed in 4% paraformaldehyde at 4°C for 24 hours, and then transferred to 30% sucrose solution for further fixation for 24 hours. The tissue was embedded in OCT embedding medium and then quickly frozen in liquid nitrogen. The embedded tissue was placed in a freezing microtome and cut into slices of about 6 μm. The slices were dried at room temperature for 15 minutes, then fixed with cold acetone for 5-10 minutes, rinsed with PBS, and blocked with blocking buffer for 1 hour. Blocked with PBS supplemented with 0.2% Triton X-100 and 5% serum at room temperature, and then incubated with the primary antibody (α-actinin) overnight at 4°C. The next day, the slices were incubated with the fluorescently labeled secondary antibody at room temperature for 1 hour. Use DAPI to stain the cell nucleus and incubate at room temperature for 10-15 minutes. Finally, the slices were sealed with anti-fluorescence quenching medium and observed and photographed using a confocal microscope. The results are as follows Figure 2 As shown in B, the results show that the fluorescence overlap ratio of EGFP and α-actinin is high, which indicates that AAV9 has a high efficiency in infecting cardiomyocytes.

[0027] (4) Pathological staining: ① After fixing the heart tissue with 4% paraformaldehyde at 4°C for 24 hours, perform routine dehydration, transparency, paraffin embedding, sectioning, and H&E staining. After staining, seal the sections and scan the sections. ② Dewax the tissue sections at room temperature, rinse with distilled water, perform antigen repair with antigen repair solution, add FITC-Wheat Germ Agglutinin (FITC-WGA), incubate in a humidified box at room temperature for 1 hour, stain the nucleus with DAPI, and seal the sections. Observe and scan under a microscope. Then use Image pro plus software to analyze the cross-sectional area of ​​the myocardium. ③ The tissue sections were routinely dewaxed to water, stained with the prepared Weigert iron hematoxylin stain, differentiated with acidic ethanol differentiation solution, blued with Masson bluing solution, and stained with Ponceau fuchsin staining solution. Washing with water was required between each staining. After Ponceau fuchsin staining, the sections were washed with weak acid working solution (the ratio of weak acid working solution was distilled water: weak acid solution = 2:1), and then washed with phosphomolybdic acid solution. After that, the sections were directly placed in aniline blue staining solution for staining. After washing with the prepared weak acid working solution, the sections were quickly dehydrated with 95% ethanol, and then dehydrated with anhydrous ethanol for 3 times. Finally, the sections were transparentized with xylene for 3 times and sealed with neutral gum. After staining, the sections were scanned. After obtaining the scanned images, the myocardial collagen deposition was analyzed using Image J software. The results are shown in Figure 3 C and Figure 3 As shown in E, the results show that overexpression of CDYL in animals significantly reduced the myocardial cross-sectional area and the area of ​​myocardial fibrosis. This result shows that CDYL can significantly improve myocardial hypertrophy and myocardial fibrosis caused by aging.

[0028] (5) Detection of marker genes: RNA was extracted according to the instructions of the kit (Accurate Biotechnology, AG21024), and then reverse transcription and RT-qPCR were performed to detect the expression of related genes. The reverse transcription reaction system is as follows: 5×Reverse Transcripition buffer (4μL), Primer Mix (1μL), RT Enzyme Mix (1μL), RNA and RNAase free Water (14μL). The PCR amplification reaction system consists of the following components: SYBRGreen Real time PCR Master Mix (10μL), upstream primer (10μM, 1μL); downstream primer (10μM, 1μL), cDNA and RNAase free Water (8μL); PCR reaction procedure is: pre-denaturation (95℃, 2min); amplification reaction (95℃, 10s; 59℃, 10s; 72℃, 15s), 40 cycles; melting curve analysis (65-95℃). The primers of mouse marker genes used are as follows: Nppa upstream primer sequence: TCTTCCTCGTCTTGGCCTTT (SEQ ID NO: 2), Nppa downstream primer sequence: CCAGGTGGTCTAGCAGGTTC (SEQ ID NO: 3); Nppb upstream primer sequence: TGGGAGGTCACTCCTATCCT (SEQ ID NO: 4), Nppb downstream primer sequence: GGCCATTTCCTCCGACTTT (SEQ ID NO: 5); Myh7 upstream primer sequence: CGGACCTTGGAAGACCAGAT (SEQ ID NO: 6); Myh7 downstream primer sequence: GACAGCTCCCCATTCTCTGT (SEQ ID NO: 7); Fn upstream primer sequence: TAGGATTGGAGACACGTGGA (SEQ ID NO: 8), Fn downstream primer sequence: TGCGGTTGGTAAATAGCTGT (SEQ ID NO: 9); Ctgf upstream primer sequence: GGACACCTAAAATCGCCAAGC (SEQ ID NO: 10); NO: 10), Ctgf downstream primer sequence: ACTTAGCCCTGTATGTCTTCACA (SEQ ID NO: 11); Gapdh upstream primer sequence: AGGTCGGTGTGAACGGATTTG (SEQ ID NO: 12) Gapdh downstream primer sequence: TGTAGACCATGTAGTTGAGGTCA (SEQ ID NO: 13). The results are as follows Figure 3As shown in Figures D and 3F, the results showed that compared with the young group, the gene expressions of myocardial hypertrophy markers Nppa, Nppb and Myh7, as well as myocardial fibrosis markers Col1a1, Fn1 and Ctgf in the aged mice were significantly upregulated, while overexpression of CDYL significantly reduced the increased gene expression of these markers caused by aging. This result shows that overexpression of CDYL can significantly reduce the upregulation of gene expression associated with heart failure caused by aging.

[0029] From the above results, it can be seen that overexpression of CDYL can significantly improve cardiac aging in mice, and can be used as a drug intervention target for delaying cardiac aging and for preparing drugs for delaying cardiac aging.

Claims

1. Use of chromatin domain Y-like protein CDYL in the preparation of drugs for preventing or treating cardiac aging.

2. The use according to claim 1, characterized in that: The encoding nucleotide sequence of the chromatin domain Y-like protein CDYL is shown in SEQ ID NO:

1.

3. The use according to claim 1, characterized in that: The heart aging refers to at least one of heart dysfunction, myocardial cell hypertrophy, increased myocardial collagen deposition, myocardial fibrosis or chronic heart failure caused by aging.

4. The use according to claim 1, characterized in that: The chromatin domain Y-like protein CDYL acts by overexpression.

5. The use according to claim 1, characterized in that: The medicine also includes pharmaceutically acceptable excipients.

6. A drug for preventing or treating heart aging, characterized in that: Includes the chromatin domain Y-like protein CDYL.

Images