Method for delaying cell senescence by controlling non-coding region of gene

Abstract

The invention discloses a method for delaying cell senescence by controlling a non-coding region of a gene. Through whole genome CRISPRpas screening analysis, it is found that cell senescence phenotypes can be effectively improved by reprogramming selective polyadenylated APA of some genes, and a new means is provided for delaying cell senescence treatment from the perspective of intervening a gene non-coding region. According to the invention, the CRISPRpas are utilized to intervene the selective polyadenylation APA of the gene KIAA1549, so that the 3 'UTR subtype proportion equivalent to that of young cells is maintained, and the senescence phenotype of the cells can be effectively delayed.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a method for delaying cell aging by manipulating gene non-coding regions. Background Art

[0002] Aging refers to the process in which the adaptability and function of an organism decline with age, which is usually accompanied by the continuous accumulation of senescent cells in tissues. Cellular senescence is one of the main driving factors of individual aging, and is also closely related to the risk of a variety of age-related diseases (such as cardiovascular disease, neurodegenerative diseases and cancer). The removal or reprogramming of senescent cells has become an important means to cope with individual aging, extend healthy life span and reduce the incidence of aging-related diseases. The homeostasis of gene expression is an important basis for maintaining the healthy vitality of cells. Understanding the changes and characteristics of gene expression during cell aging, as well as utilizing and modifying it, is crucial for developing new technologies for delaying cell aging. Existing studies have shown that there is a dysregulation of post-transcriptional regulation during replicative cell aging, such as the dynamic changes in the selection of polyadenylation (PA) sites in the 3′-untranslated region (3′UTR) of genes. Genes choose to be cut and tailed at different PA sites to produce transcripts with different 3′ ends. This process is called alternative polyadenylation (APA). APA mediates changes in the expression of key genes, thereby affecting the process of cell aging. Therefore, exploring the endogenous reprogramming gene APA and alleviating its disorder in cell aging has very important theoretical and clinical significance as a new means to delay cell aging.

[0003] In 2022, a study reported that a dCas9-based method can be used for APA of endogenous intervention genes, known as CRISPRpas. The basic principle of this method is to design the gRNA between the proximal and distal PA sites. Under the guidance of the gRNA, the dCas9 protein binds to the selective 3′UTR region of the target gene to form a steric hindrance, hindering the extension of RNA polymerase II (Pol II), thereby promoting the selection and use of the proximal PA site and producing transcripts with shorter 3′UTRs. However, there have been no reports on whether CRISPRpas can be used to regulate cell aging. Summary of the invention

[0004] The purpose of the present invention is to provide a method for delaying cell aging by manipulating the non-coding region of a gene; the present invention uses whole-genome CRISPRpas screening and analysis to find that reprogramming the selective polyadenylation (APA) of certain genes can effectively improve the cellular aging phenotype, and provides a new means for the treatment of delaying cell aging from the perspective of intervening in the non-coding region of a gene. The present invention uses CRISPRpas to intervene in the selective polyadenylation (APA) of the gene KIAA1549, so that it maintains a 3′UTR subtype ratio equivalent to that of youth, which can effectively delay the cellular aging phenotype.

[0005] The technical solution of the present invention is specifically described as follows.

[0006] The invention provides an application of a reprogramming gene in delaying cell senescence, which delays cell senescence by changing the selective polyadenylation APA in the 3'UTR region of the gene, wherein the gene includes the KIAA1549 gene.

[0007] In the present invention, the cells are fibroblasts.

[0008] In the present invention, the application method is as follows:

[0009] CRISPRpas technology is used to design and construct a gRNA library targeting the selective 3′ untranslated region of the gene, i.e., 3′UTR; the gRNA library is introduced into cells, and gRNAs that can delay cell aging are screened; the screened gRNAs are used to intervene in the 3′UTR of the target gene, changing its selective polyadenylation APA pattern, shortening the length of the 3′UTR, thereby delaying cell aging.

[0010] In the present invention, the phenotype of delayed cell senescence includes: enhanced cell proliferation ability; reduced proportion of SA-β-gal staining positive cells; increased proportion of MKI67 staining positive cells; down-regulated expression level of cell cycle-dependent kinase inhibitor CDKN1A; up-regulated expression level of nuclear lamin LMNB1; and down-regulated expression level of inflammation-related factor interleukin IL1A.

[0011] The present invention also provides a pharmaceutical composition for delaying replicative cell senescence, comprising: a gRNA targeting the 3′UTR region of the KIAA1549 gene; and a Cas9 protein or a variant thereof.

[0012] Furthermore, the present invention provides a method for delaying cell aging by manipulating gene non-coding regions for non-disease diagnosis and treatment purposes, comprising the following steps: intervening in the 3′UTR region of the KIAA1549 gene to change its selective polyadenylation APA pattern, thereby delaying cell aging.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The present invention reprograms the gene KIAA1549 to selectively polyadenylate APA based on CRISPRpas technology, thereby changing the specific non-coding region (3' untranslated region) of the gene. By fine-tuning the gene expression level, the aging phenotype of cells can be improved, cell aging can be delayed, and the risk of cancer caused by excessive gene regulation can be prevented. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Flowchart of functional APA events for screening CRISPRpas to delay cellular senescence.

[0016] Figure 2 The quality control results of CRISPRpas in delaying cell senescence in the whole genome. A is a representative figure and quantitative statistical graph of SA-β-gal staining results of CRISPRpas screening group and control group. B is a crystal violet staining test for the clone formation ability and quantitative statistical graph of CRISPRpas screening group and control group. The p value is calculated by two-tailed t-test, * represents p<0.05, three technical repeats. C is the change in the proportion of MKI67-positive cells in the CRISPRpas screening group by immunofluorescence detection (left), and the right figure is a quantitative graph of immunofluorescence staining. The p value is calculated by two-tailed t-test, *** represents p<0.001, six technical repeats. D is the change in the proportion of CDKN1A-positive cells in the CRISPRpas screening group in HFF cells by immunofluorescence detection (left), and the right figure is a quantitative graph of immunofluorescence staining. The p value is calculated by two-tailed t-test, *** represents p<0.001, seven technical repeats. E is the cell proliferation ability of the CRISPRpas screening group detected by CCK-8. The p value was calculated by two-way ANOVA test, *** represents p < 0.001, and three technical replicates were performed. F is the relative expression of LMNB1, CDKN1A and IL1A in the CRISPRpas screening group and the control group detected by qRT-PCR. The p value was calculated by one-way ANOVA test, *** represents p < 0.001, and three technical replicates were performed.

[0017] NTG represents the negative control group, and CRISPRpas represents the screening group.

[0018] Figure 3 Figure 1 shows the enrichment of gRNAs in CRISPRpas screening, where the top 200 genes are highlighted in Figure A. Figure B shows the GO analysis of the enriched genes. The enrichment level and number of genes are represented by circles of different colors and sizes, respectively.

[0019] Figure 4To improve the cellular senescence phenotype by using CRISPRpas to intervene in the APA of KIAA1549. A shows the coverage of aUTR reads of KIAA1549 in young and old HFF cells, as well as the RNA-seq density map after CRISPRpas intervention in APA. Blue is the young group, purple is the old group, gray is the NTG group, light green is the KIAA1549_gRNA a group, and dark green is the KIAA1549_gRNA b group. The red arrow is the annotated proximal Poly (A) site position, the blue arrow is the distal Poly (A) site position, and the area between the two is the aUTR. B is a representative graph and quantitative statistical graph of SA-β-gal staining results before and after CRISPRpas intervention in KIAA1549 APA in HFF cells. The p value was calculated using the one-way ANOVA test, *** represents p < 0.001, and five technical replicates. C is the change in the proportion of MKI67-positive cells detected by immunofluorescence after CRISPRpas intervention in KIAA1549 APA. The right figure is a quantitative statistical graph of MKI67 immunofluorescence staining. The p value was calculated using the oneway ANOVA test, *** represents p<0.001, and there were five technical replicates. D is a CCK-8 experiment to detect the cell proliferation rate before and after CRISPRpas intervention in KIAA1549 APA. The p value was calculated using the two-way ANOVA test, *** represents p<0.001, and there were three technical replicates. E is a qRT-PCR test to detect the changes in cell senescence markers (MKI67, LMNB1, and CDK1) in KIAA1549 after CRISPRpas intervention in APA. F is an enrichment analysis of gene pathways that were downregulated after CRISPRpas intervention in KIAA1549 APA in HFF cells. DETAILED DESCRIPTION

[0020] In order to make the present invention more clearly understood, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0021] Example 1

[0022] This example provides a method for screening CRISPRpas at the genome-wide level to selectively polyadenylate reprogrammed genes and thereby change 3′UTR targets to delay cell senescence:

[0023] 1. Experimental methods

[0024] 1.1 gRNA library design. This paper uses CRISPRpas to screen functional APAs that can delay cell aging across the entire genome. The gRNA library design principles are as follows:

[0025] (1) First, we used the PolyA_DB database, which provides information on mammalian polyadenylation sites and their genomic locations, as well as the use of alternative polyadenylation sites in various tissues and organs. This study selected genes with proximal and distal PA sites that were used in at least 50% of the samples (this means that the PA site is widely used);

[0026] (2) Since CRISPRpas act on the selective 3′UTR region and are more efficient when they are more than 500 nt away from the proximal PA site, in the first step of this study, we screened genes to remove those with a selective 3′UTR length of less than 500 nt;

[0027] (3) For the remaining genes, we targeted the selective 3′UTR region, designed 6 specific gRNAs at equal distances for each gene, and required the GC content to be greater than 20%. In addition, 550 nontarget gRNAs were used as negative controls, and 6 positive control gRNAs were targeted to the TP53 promoter region to inhibit its expression. In the end, this study obtained 17,890 gRNA library information targeting 3,222 genes;

[0028] 1.2gRNA library synthesis

[0029] The transcription process of the U6 promoter needs to use G / A as the starting point for transcription, so make sure that each gRNA sequence starts with a G. In addition, it is necessary to add homology arm sequences corresponding to the vector (Addgene cat.112233) at both ends of the synthesized oligo sequence. The corresponding sequence pattern is as follows: "TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCgXXXXXXXXXXXXXXX XXXXgTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT". Among them, X represents the gRNA sequence, and the sequences on both sides are homology arm sequences that completely match the vector sequence. After designing the above sequence library, high-throughput oligo synthesis is carried out in the company.

[0030] 1.3 Library construction

[0031] (1) Amplify the synthesized oligo library using a high-fidelity enzyme. The reaction system is as follows (configuration 10 copies):

[0032] Reagents volume 2×PCR mix 12.5μL Pooled oligo library template(1ng / μL) 1μL Oligo-Fwd 1.25μL Oligo-Rev 1.25μL <![CDATA[H2O]]> 9μL

[0033] Oligo-Fwd sequence is: "gtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacacc"

[0034] The Oligo-Rev sequence is: "actttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaac"

[0035] Mix the above reagents and put them into the PCR instrument, set the hot cover temperature to 105℃: pre-denaturation at 98℃ for 30 seconds; 98℃ for 10 seconds, 63℃ for 10 seconds, and 72℃ for 5 seconds, 20 cycles; 72℃ for 2 minutes.

[0036] The product was subjected to agarose gel electrophoresis at 150V for 20 minutes. The correct position of the band was between 100-200bp. The band that met the expected position was cut out, recovered by gel recovery using a kit, and stored in a -20℃ refrigerator for later use.

[0037] (2) Next, the plasmid lentiCRISPR-dCas9-V2 purchased from Addgene (Cat. No. 112233) was digested with enzymes. The reaction system is as follows:

[0038] Reagents volume lentiCRISPR-dCas9-V2 5μL 10x r3.1 buffer 5μL BnB 1μL <![CDATA[H2O]]> 39μL

[0039] Mix the above reagents, place in a PCR instrument, react at 55℃ for 45 minutes, inactivate at 80℃ for 20 minutes, and place at 4℃ after completion. Perform agarose gel electrophoresis on the product, and use the original plasmid without enzyme digestion as a control for electrophoresis at 150V for 20 minutes. Cut the band that meets the expected position, recover the gel with the kit, and store in a -20℃ refrigerator for later use.

[0040] (3) The amplified oligo library product and the linearized vector were homologously recombined to construct a plasmid library. The reaction system is as follows (configured in 2 copies):

[0041] Reagents volume 2x Gibson assembly mix 10μL lentiCRISPR-dCas9-V2 330ng(8μL) Pooled oligo library 1.05μL (50ng) <![CDATA[H2O]]> 0.95μL

[0042] After mixing, place it on the PCR instrument and react at 50℃ for 1 hour. After the end, the initial plasmid library was purified with magnetic beads. The recombinant plasmid library was electrotransformed using the electrotransformation competent state produced by Weidi Biotechnology according to the instructions. Specifically: Place the electrotransformation cup on ice for precooling, add 5μL of recombinant product to the just thawed competent state, and flick the bottom of the tube with your hand to avoid bubbles. Cut off the tip of the 200μL gun tip with sterile scissors and gently transfer the competent state to the electrotransformation cup. After electroporation at 1.8kv voltage, quickly transfer to ice and let stand for 2 minutes, add 10mL SOC, place in a shaker, and recover at 30℃ for 2 hours. Then centrifuge at 5000rpm for 2 minutes, collect the bacteria, resuspend with 2mL SOC, apply to 30 LB plates, and culture at 30℃ for 20 hours. One of the plates was used for dilution 10,000 times for colony counting. The next day, the colonies on the plate were collected and extracted with an endotoxin-free plasmid extraction kit. The plasmid library is sent to the company for library homogeneity identification, and subsequent experiments are carried out after passing the quality inspection.

[0043] 1.4 Genome-wide functional APA screening

[0044] (1) The CRISPRpas library was packaged with lentivirus using HEK293T cells and cultured in HFF

[0045] The lentivirus titer was tested in the cells to make the MOI of infection around 0.3. To ensure that only one virus invades a cell, at least 16 million cells are required for infection, based on the 300-fold coverage and 0.3 MOI required for each gRNA, about 15 10cm dishes, with a cell density of around 50-60%. Two dishes were also required for the negative control group infected with the nontarget gRNA virus;

[0046] (2) After 24 hours of infection, the complete culture medium was replaced. After 48 hours, puromycin (2.5 μg / mL) was used for resistance screening. After 2 days of screening, cells stably expressing the CRISPRpas library were obtained. At this time, about 5.4 million cells (300-fold gRNA coverage) were collected as a base point, and after quick freezing in liquid nitrogen, they were stored in a -80°C refrigerator;

[0047] (3) Count the remaining cells, synchronize the control group and experimental group cells at the same ratio, and then passage them.

[0048] Until the P28 generation, the cells in the control group showed cellular senescence phenotypes such as slow growth and enlarged cells, and 5.4 million cells in the screening group were collected;

[0049] (4) Continue to subculture until P32, and collect cells from the last point. Finally, extract genomic DNA from the cells of these three points at the same time, and perform library construction and sequencing to analyze the enrichment of gRNA. The specific analysis process refers to the protocol published in Nature protocol in 2017 (Joung J et al. Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nat Protoc. 2017Apr; 12(4): 828-863.).

[0050] 1.5 Real-time fluorescence quantitative PCR experiment to detect gene APA changes

[0051] A pair of primers were designed for the constitutive and selective 3′UTR regions of the gene, respectively, and the reaction was performed using SYBR-Green. The results represent the expression levels of the total 3′UTR and the long 3′UTR, respectively. Primer design rules: 1) The primer length is 18-30bp, 2) The GC content is between 40%-60%, 3) The amplification region length is about 150-300bp, and 4) It is uniquely aligned on the genome by Primer-BLAST detection.

[0052] The relative usage ratio of the distal PA site can be calculated by dividing the expression level of the long 3′UTR by the expression level of the total 3′UTR.

[0053] 1.6 Cell immunofluorescence experiment

[0054] One day in advance, the cells were seeded on a cell slide with a density of 50-60%.

[0055] (1) Take out the cell culture plate, remove the culture medium, rinse once with 1×PBS, add 500μL 4% paraformaldehyde and fix at room temperature for 15 minutes, remove the fixative, rinse once with 1×PBS. Add 0.05% TRITON-X-100 to permeabilize the membrane, and treat at room temperature for 10 minutes;

[0056] (2) Add blocking solution prepared with 10% fetal bovine serum and block at room temperature for 1 hour. Remove the blocking solution, add the diluted antibody according to the antibody instructions, and incubate in a humidified box at 4°C overnight;

[0057] (3) The next day, rinse twice with 1×PBST, 5 minutes each time. Select the secondary antibody according to the species of the primary antibody, and use 10% fetal bovine serum to prepare the secondary antibody according to the dilution ratio, generally 1:100. Note that after the secondary antibody, it should be kept away from light throughout the process. After incubating at room temperature in the dark for 1 hour, rinse three times with 1×PBST, 5 minutes, 10 minutes and 10 minutes respectively; (4) Take out the slide, absorb the moisture with dust-free paper, add DAPI mounting medium on the slide, slowly cover the slide (avoid the formation of bubbles), incubate in a dark box for 10 minutes, apply nail polish on the edge of the slide, and fix the coverslip. After drying, it can be photographed under a confocal microscope immediately, or stored at -20℃, and fluorescence imaging data should be collected as soon as possible within 2 months.

[0058] 1.7 SA-β-Gal experiment

[0059] The cells were seeded in a 12-well plate one day in advance, and the ideal cell density was 60-70% the next day.

[0060] Before the experiment, X-GAL was preheated in a water bath at 37°C for 1 hour.

[0061] (1) Remove the culture medium and rinse the cells three times with 1× PBS. Next, add 400 μL of 1× fixative to each well and fix the cells at room temperature for 7 minutes. During this time, prepare the staining solution. The specific formula is as follows:

[0062] Reagents volume 10×Staining buffer 40μL Liquid A 5μL Liquid B 5μL X-gal 10μL <![CDATA[H2O]]> 340μL

[0063] (2) Wash three times with 1× PBS, then add 400 μL of staining solution filtered with a 0.22 μm filter to each well. Incubate in a 37°C water bath away from light;

[0064] (3) The incubation time of HFF cells used in this article is usually 4-5 hours;

[0065] (4) After staining, remove the staining solution, wash three times with 1× PBS, add 50% glycerol to block, and place under an ordinary optical microscope for photography and observation.

[0066] 1.8 CCK-8 experiment

[0067] (1) First, collect the cells to be tested and resuspend them in 1 mL of complete culture medium;

[0068] (2) Use a cell counting instrument to count. Taking a 96-well plate as an example, add 100 μL of a suspension containing 2,000 to 3,000 cells to each well. To ensure the accuracy and reliability of the results, this experiment set up 4 different time points, with 4 technical replicate wells at each time point;

[0069] (3) Add 100 μL of culture medium containing 10 μL CCK-8 at the same time every day for 4 consecutive days. Then, incubate the cells at 37°C for 2 hours;

[0070] (4) Detect the absorbance at wavelengths of 450 nm and 630 nm in an ELISA instrument. By comparing the absorbance at different time points, the proliferation trend and vitality status of the cells can be understood.

[0071] 2. Experimental results:

[0072] (1) First, in order to more comprehensively and scientifically identify genes that are regulated by APA and involved in the process of cell aging, this study used the whole-genome CRISPRpas screening technology ( Figure 1 ), using human primary foreskin fibroblasts (HFF) as a model, a gRNA plasmid library with uniform quality inspection was obtained, and HEK293T cells were used for lentiviral packaging. To ensure that each cell is infected with at most one gRNA virus, this study conducted screening experiments at a multiplicity of infection (MOI) of 0.3. At the same time, to ensure the uniformity of gRNA, a ratio of one gRNA covered by at least 300 cells is required. After the successfully infected cell population was obtained by puromycin resistance screening, the cells were collected to extract genomic DNA as the baseline control group. Subsequently, as the number of passages increased, the NTG group showed a classic cell senescence phenotype, and the screening group cell samples were collected to identify its delayed cell senescence phenotype. The SA-β-gal staining results showed that the proportion of senescent blue-stained positive cells in the CRISPRpas screening group was significantly reduced ( Figure 2 A), the clone formation ability increased significantly ( Figure 2 B), the proportion of MKI67 positive cells increased significantly ( Figure 2 C), the proportion of cells positive for CDKN2A staining decreased significantly ( Figure 2 D). CCK-8 results showed that compared with the control group, the CRISPRpas intervention group effectively promoted cell proliferation ( Figure 2 E). Real-time fluorescence quantitative PCR experiments detected changes in the expression levels of related molecular markers, and found that the expression levels of LMNB1, which encodes the cell nuclear lamin protein, and CDK1, a key kinase encoding cell cycle regulation, were upregulated in the CRISPRpas group, while the expression level of the inflammatory-related factor interleukin IL1A was downregulated ( Figure 2 F) These results indicate that regulating the APA of certain genes through CRISPRpas can improve the cellular senescence phenotype of HFFs.

[0073] (2) Next, when the cells in the NTG group showed growth arrest, we obtained cell genomic DNA from the CRISPRpas intervention group and performed second-generation sequencing to analyze the enrichment of gRNA. We found that the first gene was KIAA1549 ( Figure 3 A). At the same time, among the gRNAs ranked second only to KIAA1549, this paper detected a positive control (gRNA that knocks down TP53) that delays cell aging, indicating the reliability of this CRISPRpas screening. Next, this study performed a gene ontology GO analysis on the genes corresponding to the top 200 gRNAs and found that the genes that were positively enriched for delaying cell aging screened by CRISPRpas were significantly enriched in pathways such as RNA splicing and fibroblast proliferation ( Figure 3 B).

[0074] (3) Finally, this study validated the two gRNAs that targeted the KIAA1549 aUTR region. The RNA-seq density map showed that the usage ratio of the distal PA site of this gene increased in aging HFFs, and the coverage of the aUTR region increased significantly. After CRISPRpas intervention, the usage ratio of the distal PA site of the gene KIAA1549 decreased, and the 3′UTR became shorter ( Figure 4 A). As the number of passages increased, the NTG group showed a classic cell senescence phenotype, while the two experimental groups of APA with the endogenous intervention gene KIAA1549 showed an effective delay in the cell senescence phenotype, which was specifically reflected in the significant decrease in the proportion of SA-β-gal staining positive cells ( Figure 4 B), the proportion of MKI67 positive cells increased significantly ( Figure 4 C), the cell proliferation rate increased significantly ( Figure 4 D). Real-time fluorescence quantitative PCR experiments revealed that the expression levels of LMNB1 and CDK1 in the APA group with intervention gene KIAA1549 were upregulated ( Figure 4 E). Transcriptomic sequencing analysis found that after intervening in the APA of KIAA1549, the downregulated genes were significantly enriched in the inflammatory factor secretion-related pathway. These results indicate that regulating the APA of KIAA1549 through CRISPRpas can improve the cell senescence phenotype of HFF ( Figure 4 F).

[0075] The above embodiments are only preferred embodiments of the present invention and are not any formal or substantial limitations of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the present invention, and these improvements and supplements should also be regarded as the scope of protection of the present invention.

Claims

1. An application of a reprogramming gene in delaying cell aging, characterized in that: Delaying cellular senescence by altering the selective polyadenylation of the 3′ UTR region of genes including KIAA1549 Gene.

2. The use according to claim 1, characterized in that: The cells are fibroblasts.

3. The use according to claim 1, characterized in that: The application method is as follows: CRISPRpas technology is used to design and construct a gRNA library targeting the selective 3′ untranslated region of the gene, i.e., 3′ UTR; the gRNA library is introduced into cells, and gRNAs that can delay cell aging are screened; the screened gRNAs are used to intervene in the 3′ UTR of the target gene, changing its selective polyadenylation APA pattern, shortening the length of the 3′ UTR, thereby delaying cell aging.

4. The use according to claim 3, wherein the phenotype of delayed cell senescence comprises: The cell proliferation ability was enhanced; the proportion of SA-β-gal positive cells was reduced; The proportion of MKI67-positive cells increased; the expression level of cell cycle-dependent kinase inhibitor CDKN1A was downregulated; the expression level of nuclear lamin LMNB1 was upregulated; and the expression level of inflammation-related factor interleukin IL1A was downregulated.

5. A pharmaceutical composition for delaying replicative cell senescence, characterized in that: include: A targeted KIAA1549 a guide RNA targeting the 3′ UTR region of a gene; and a Cas9 protein or a variant thereof.

6. A method for delaying cell aging by manipulating non-coding regions of genes for purposes other than disease diagnosis and treatment, characterized in that: The following steps are involved: Through intervention KIAA1549 The 3′ UTR region of the gene changes its selective polyadenylation APA pattern, thereby delaying cell senescence.

Images