Molecular marker related to cucumber blister wrinkle leaf character and application thereof

Abstract

The invention belongs to the field of plant molecular genetic breeding, and relates to a molecular marker related to cucumber blister wrinkled leaf characters and application of the molecular marker. According to the SNP molecular marker, a C / T polymorphic site exists at the 841st site of a nucleotide sequence shown as SEQ ID NO: 1. Corresponding molecular marker primers are developed and comprise a forward primer with a nucleotide sequence shown as SEQ ID NO.2 and a reverse primer with a nucleotide sequence shown as SEQ ID NO.3, and genotype interpretation is performed by utilizing Sanger sequencing after PCR (polymerase chain reaction) amplification. It is verified that the molecular marker can be well used for distinguishing the wild type and the mutant type of the cucumber blister leaf crinkling gene Csbcl (cucumber genome ID: CsGy7G020590), and identification of the cucumber blister leaf crinkling character and auxiliary breeding of cucumber ideal plant type varieties are facilitated.

Description

Technical Field

[0001] The invention belongs to the field of plant molecular genetic breeding, relates to a molecular marker technology, and specifically relates to a molecular marker related to a cucumber bubble-shaped wrinkled leaf trait and an application thereof. Background Art

[0002] Cucumber (Cucumis sativus L.) is an important vegetable crop in the genus Muskmelon of the Cucurbitaceae family. It is also a model crop for genetic research of Cucurbitaceae crops due to its short growing period, monoecious sexes, no inbreeding degeneration, small genome size (~367Mb), and single copy of most genes.

[0003] With the completion of cucumber genome sequencing, the construction of high-density genetic maps, and the establishment of cucumber genetic transformation systems, multiple cucumber disease resistance (downy mildew, powdery mildew, and vine blight), stress resistance (low temperature resistance, salt resistance, and waterlogging resistance), and fruit quality traits related genes (fruit size, shape, reticulation, and cavity) have been located. In cucumber breeding, short internodes, moderate leaf size, small leaf-branch angle, and suitable dense planting are an important direction for breeding high-yield varieties, which have important theoretical and practical significance for efficient cucumber production. The analysis of the regulatory mechanism of important traits such as cucumber plant height, branching, leaf size, angle, and internode length is the key and prerequisite for breeding ideal cucumber varieties.

[0004] Among them, leaf morphology plays an important role in photosynthesis, planting density, crop yield and labor costs of cultivation. In addition to capturing light energy for photosynthesis to synthesize carbohydrates, leaves can also sense and transmit environmental signals, including light, temperature, water, insects and microorganisms. Typical cucumber leaves are palm-shaped with five main veins extending from the petiole at the base of the leaf to the leaf margin to form shallowly lobed leaves. The mutants with abnormal leaf morphology reported so far mainly include round leaf (rl), mango leaf (mango fruit), curly leaf (curly leaf), little leaf (little leaf) and wrinkle leaf (wrinkle leaf).

[0005] There are currently two reports of wrinkled leaf mutants in cucumber. Liu Mengying et al. reported a wrinkled leaf dwarf mutant C1056. After the 3-4 leaf stage, the true leaves of the mutant began to darken from the veins, the veins became thicker, the leaves became wrinkled, and the leaf tips curled inward. Gene fine mapping identified a key regulatory gene CsGME1 that controls this trait. This gene is a key gene for ascorbic acid synthesis and the formation of cell wall pectin component RG-II (Liu Mengying. Identification of leaf dwarf mutant C1056 and cloning of mutant gene WRC-1 [T]. Northwest Agriculture and Forestry University, Master's degree thesis, 2019). Zhu Gaoxiang et al. reported a wrinkled leaf mutant of Leting cucumber. Compared with the wild type, the mutant lc showed wrinkled leaves, changed leaf shape, close proximity of the leaf base along the depression, compact plant shape, and normal plant growth. Genetic analysis preliminarily determined that the mutant trait was controlled by a single recessive gene (Zhu Gaoxiang, Zhang Meidi, Song Xiaofei, Cui Haonan, Li Xiaoli, Zhu Xueyun, Yan Liying. Phenotypic identification and genetic analysis of cucumber wrinkled leaf mutants [J]. Chinese Vegetables, 2022, 35(3): 9-15.).

[0006] The inventors discovered a naturally occurring bubble-shaped leaf mutant of cucumber during their research. This mutant has obvious bulges between the veins of its leaves, which are bubble-shaped. Currently, the gene and function of the bubble-shaped leaf mutant have not been reported. Summary of the invention

[0007] The purpose of the present invention is to solve the above problems existing in the prior art, and a molecular marker related to the bubble-crinkle leaf trait of cucumber and its application are proposed. The present invention locates the gene controlling the trait, and develops corresponding molecular marker primers for the variation, and uses Sanger sequencing to interpret the genotype after PCR amplification. It has been verified that the molecular marker can be used to distinguish the wild type and mutant type of the cucumber Csbcl gene (cucumber genome ID: CsGy7G020590).

[0008] The technical solution of the present invention is:

[0009] The invention provides a SNP molecular marker related to the bubble-shaped wrinkled leaf trait of cucumber, wherein a C / T polymorphic site exists at the 841th position of the nucleotide sequence as shown in SEQ ID NO:1.

[0010] Specifically, the SNP molecular marker is a mutation from C to T at the 841 bp position on the 9th exon 0 transcript of the cucumber bubble wrinkled leaf gene (cucumber genome ID: CsGy7G020590).

[0011] The present invention also provides primers for amplifying SNP molecular markers associated with cucumber bubble-shaped wrinkled leaves, including:

[0012] Forward primer: 5'-TTCTTATCTCTTTCCCGGAGG-3' (SEQ ID NO. 2);

[0013] Reverse primer: 5'-TCGGTTCTTGAAGTTGTACCA-3' (SEQ ID NO. 3).

[0014] The present invention also provides the application of the SNP molecular marker in the identification of the bubble-shaped wrinkled leaf trait of cucumber and / or the auxiliary breeding of cucumber ideal plant type varieties.

[0015] Furthermore, when the base of the polymorphic site of the SNP molecular marker is C, it is a wild type; when the base of the polymorphic site of the SNP molecular marker is T, it is a bubble-shaped wrinkled leaf mutant.

[0016] The present invention further provides the use of the SNP molecular marker primer in the identification of the cucumber bubble wrinkled leaf genotype and / or the auxiliary breeding of new cucumber varieties with ideal plant types.

[0017] Furthermore, the application is that the SNP molecular marker primer can be used for the identification of the cucumber bubble wrinkled leaf genotype and the auxiliary breeding of new varieties with ideal plant types. The specific operation process is as follows:

[0018] (1) using the genomic DNA of the cucumber material to be tested as a template and the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 as primers to perform conventional PCR amplification;

[0019] (2) The PCR product obtained in step (1) is subjected to Sanger sequencing, and then sequence analysis is performed using peak analysis software: If the mutation site is base C, that is, the target fragment sequence is as follows (the 145th bold underlined base is a single nucleotide site mutation SNP):

[0020] TTCTTATCTCTTTCCCGGAGGAGACCGGAACTTGTTAACACATGGACCCCAGGCATGGACGATAGAGCGGTTAGGTCTTCATGCGGTTCCGACATGTCGATCGATGACCCCACTGAAGATCCTATTGGAAGGCACAACAAGCCA C AGTACCAAACAGAGAATAAGCACGATCCTCAATCTGGTACAACTTCAAGAACCGA (SEQ ID NO.4); the cucumber material to be tested is a wild genotype;

[0021] If the variant site is base T, that is, the target fragment sequence is as follows (the 145th bold underlined base is a single nucleotide site variant SNP):

[0022] TTCTTATCTCTTTCCCGGAGGAGACCGGAACTTGTTAACACATGGACCCCAGGCATGGACGATAGAGCGGTTAGGTCTTCATGCGGTTCCGACATGTCGATCGATGACCCCACTGAAGATCCTATTGGAAGGCACAACAAGCCATAGTACCAAACAGAGAATAAGCACGATCCTCAATCTGGTACAACTTCAAGAACCGA (SEQ ID NO.5); the cucumber material to be tested is a homozygous mutant genotype, the leaves are bulged, and the plants are dwarfed;

[0023] If the mutation site is C / T, the cucumber material to be tested is a heterozygous genotype, and the phenotype is consistent with the wild type.

[0024] Furthermore, the PCR amplification system (50 μL) is: 2×PCR buffer 25 μL (containing Mg 2+ , dNTPs), 2 μL each of forward and reverse primers (10 μmol / L), 1 μL of genomic DNA, 1 μL of high-fidelity DNA polymerase, 1 μL of ddH 2 O 20 μL;

[0025] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

[0026] Beneficial effects of the present invention:

[0027] The cucumber mutant screened by the present invention exhibits bubble-shaped and wrinkled leaves, shortened internodes, and dwarfed plants, but the fruit can grow normally. The bubble-shaped and wrinkled leaves can significantly increase the surface area of ​​the cucumber leaves and improve the light energy capture rate of the leaves. In addition, the shortened internodes are conducive to reducing the vine falling operation in production. These characteristics of the mutant provide the possibility for the construction of an ideal plant type in cucumber breeding, and have good application prospects and application value in cultivating new varieties of cucumber ideal plant types.

[0028] The SNP molecular markers and related primers developed by the present invention can quickly identify wild genotypes and wrinkled leaf mutation genotypes, and can be used to screen heterozygous gene materials containing the mutation. The molecular markers are helpful for the identification of the bubble-shaped wrinkled leaf trait of cucumber and the auxiliary breeding of new cucumber varieties with ideal plant types. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The phenotypic traits of cucumber wild type and mutant; A: Cucumber wild type, mutant and F 1 Generation seed phenotypes; B: cucumber wild type, mutant and F 1 A: leaf phenotype of the first generation; C: male flower phenotype of the wild type and mutant cucumber; D: plant phenotype of the wild type and mutant cucumber; E: fruit phenotype of the mutant cucumber; F: fruit phenotype of the wild type cucumber.

[0030] Figure 2 is the result of SNP-index association analysis; the vertical axis SNP-index (highbulk) is the linkage map of mutant offspring; SNP-index (lowbulk) is the linkage map of wild offspring; ΔSNP-index is the linkage map of the population; the horizontal axis Chromosome (Mb) represents the chromosome number.

[0031] Figure 3 The PCR results of molecular markers of wild-type and mutant cucumbers; M: DL2000 molecular weight marker; 1-2: mutant plants; 3-4: wild-type plants; 5-6: F 1 Generation of plants.

[0032] Figure 4 The peak diagram of sequencing of PCR products of molecular markers of wild-type and mutant cucumber; A: blister-shaped wrinkled leaf mutant plant; B wild-type plant; C: heterozygous F1 generation plant. DETAILED DESCRIPTION

[0033] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] In order to further understand the present invention, the present invention will be further described in conjunction with the accompanying drawings and embodiments.

[0035] Example 1

[0036] Phenotypic Analysis of Cucumber Bubble Leaf Mutant

[0037] During the research on cucumber breeding, the inventor screened out a naturally mutated cucumber bubble-shaped wrinkled leaf mutant, which was preserved in this laboratory. Field observations showed that the leaves of the mutant had obvious bulges between veins and were bubble-shaped. Compared with wild-type plants, the mutant plants had shorter internodes and significantly reduced plant height, but could flower and bear fruit normally (Table 1 and Figure 1 ).

[0038] Table 1 Growth indexes of cucumber bubble-shaped wrinkled leaf mutant and wild type

[0039] Plant type Plant height(cm) Stem diameter (mm) Internode(mm) <![CDATA[Leaf area (cm 2 )]]> Bullose leaf mutant 130.80±7.60 9.27±1.02 59.70±2.17 142.86±20.47 wild type 223.0±2.74** 10.23±0.47 99.04±6.19** 511.79±14.65**

[0040] Note: Data are expressed as mean ± SD; ** indicates significant difference between data (t test, P < 0.05)

[0041] Example 2

[0042] The cucumber bubble-shaped wrinkled leaf mutant was reciprocally crossed with the wild type to obtain the F 1 , F 1 All generations showed normal leaves, indicating that the mutant trait was regulated by a recessive nuclear gene. 1 F 2 In the first generation segregation population, the segregation ratio of wild-type plants and mutant plants was consistent with the segregation ratio of 3:1. It was preliminarily determined that the cucumber bubble-shaped wrinkled leaf mutation was a quality trait controlled by a single recessive nuclear gene and named Csbcl.

[0043] The BSA-seq strategy was used to construct the male parent (mixed leaves of 10 plants), the female parent (mixed leaves of 10 plants), and the F 2 Normal group (mixed samples of 50 leaves), F 2 Four mixed pools were set up for the wrinkled leaf group (mixed samples of 50 leaves), and genomic DNA was extracted from each mixed sample. DNA samples that passed the electrophoresis test were randomly interrupted into 350bp-500bp fragments by Covaris ultrasonic crusher, and the library was constructed using TruSeq DNALT Sample Prep kit. DNA fragments were repaired at the end, ployA tailed, sequencing adapter added, purified, PCR amplified, and other steps to complete the sequencing library construction. The constructed library was sequenced by Shanghai Ouyi Biomedical Technology Co., Ltd.

[0044] The raw reads of the original sequencing sequence need to be screened and filtered using fastp software. Unqualified sequences such as adapter sequences are removed to obtain clean reads, and clean reads are aligned to the reference genome (http: / / cucurbitgenomics.org / ftp / genome / cucumber / Gy14 / v2 / ) using BWA software. After the alignment results are converted to a format using SAMtools, redundancy is removed using Picard software, and the alignment results are analyzed using Qualimap software.

[0045] Based on the sequencing data of BSA-seq and the whole genome information of cucumber GY14, 12 Indel candidate sites and 2 SNP candidate sites were initially obtained, which were located on cucumber chromosomes 1, 2, 4, 6 and 7 ( Figure 2 ). Further analysis showed that most of the gene mutation sites were located in the transcribed spacer or intron region, and only the 9th exon of the CsGy7G020590 gene transcript on chromosome 7 had a SNP mutation site. The cDNA base at 841bp corresponding to the transcript mutated from C to T, resulting in changes in protein structure. Therefore, it was preliminarily determined that the CsGy7G020590 gene mutation caused the cucumber bubble-shaped wrinkled leaf phenotype. The CsGy7G020590 gene was annotated as a GPI-anchored adhesin-like protein in the cucumber genome database, and its function has not yet been reported.

[0046] Example 3

[0047] Design and verification of molecular markers for variation of cucumber bubble-shaped wrinkled leaf phenotype

[0048] According to the CsGy7G020590 gene sequence information in the cucumber genome database, the forward primer and reverse primer were designed within 250 bp around the 841st mutant base in the coding region of the CsGy7G020590 gene using Oligo7 primer design software. Primer design principles: Tm value around 55℃-60℃, product size 150-500bp, primer length 20-24bp. The designed primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd., and the specific sequences are as follows:

[0049] Forward primer: 5'-TTCTTATCTCTTTCCCGGAGG-3' (SEQ ID NO. 2)

[0050] Reverse primer: 5'-TCGGTTCTTGAAGTTGTACCA-3' (SEQ ID NO. 3)

[0051] The PCR amplification system (50 μL) is:

[0052] 2×PCR buffer 25μL (containing Mg 2+ , dNTPs), 2 μL each of forward and reverse primers (10 μmol / L), 1 μL of genomic DNA, 1 μL of high-fidelity DNA polymerase, 1 μL of ddH 2 20 μL of HO.

[0053] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

[0054] The PCR amplification products are nearly 200 bp in length and are SEQ ID NO.4:

[0055] TTCTTATCTCTTTCCCGGAGGAGACCGGAACTTGTTAACACATGGACCCCAGGCATGGACGATAGAGCGGTTAGGTCTTCATGCGGTTCCGACATGTCGATCGATGACCCCACTGAAGATCCTATTGGAAGGCACAACAAGCCACAGTACCAAACAGAGAATAAGCACGATCCTCAATCTGGTACAACTTCAAGAACCGA;

[0056] and / or SEQ ID NO.5:

[0057] TTCTTATCTCTTTCCCGGAGGAGACCGGAACTTGTTAACACATGGACCCCAGGCATGGACGATAGAGCGGTTAGGTCTTCATGCGGTTCCGACATGTCGATCGATGACCCCACTGAAGATCCTATTGGAAGGCACAACAAGCCATAGTACCAAACAGAGAATAAGCACGATCCTCAATCTGGTACAACTTCAAGAACCGA;

[0058] Then, 1% agarose gel electrophoresis was used to separate the PCR products that matched the target fragment size, and the PCR products were recovered and sent to the company for Sanger sequencing ( Figure 3 ). The sequencing peak analysis results showed that the mutation site of the wild-type single strain (target fragment 145) was C base, and the mutation site of the mutant single strain was T base, indicating that the marker can well distinguish wild-type and mutant genes ( Figure 4 ).

[0059] The above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art can still modify the technical solutions described in the above embodiments, or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, modification, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with the blister-shaped wrinkled leaf trait of cucumber, characterized in that: There is a C / T polymorphic site at the 841st position of the nucleotide sequence as shown in SEQ ID NO:

1.

2. A primer for amplifying the SNP molecular marker according to claim 1, characterized in that: It comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

3.

3. Use of the SNP molecular marker described in claim 1 in the identification of the bubble-shaped wrinkled leaf trait of cucumber and / or in the auxiliary breeding of ideal cucumber plant type varieties.

4. The use according to claim 3, characterized in that: When the base of the polymorphic site of the SNP molecular marker is C, it is a wild type; when the base of the polymorphic site of the SNP molecular marker is T, it is a bubble-shaped wrinkled leaf mutant.

5. Use of the SNP molecular marker primers described in claim 2 in the identification of cucumber bubble-shaped wrinkled leaf genotypes and / or in the auxiliary breeding of new cucumber varieties with ideal plant types.

6. The use according to claim 5, characterized in that: The application is to use the SNP molecular marker primer to identify the cucumber bubble wrinkled leaf genotype or assist in breeding new varieties of cucumber with ideal plant types, and the steps are as follows: (1) using the genomic DNA of the cucumber material to be tested as a template and the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 as primers for PCR amplification; (2) The PCR product obtained by amplification is subjected to Sanger sequencing to obtain the nucleotide sequence shown in SEQ ID NO.4 and / or SEQ ID NO.5, and then the sequence is analyzed using peak diagram interpretation software. If the 145th mutation site of the target sequence is base C, the cucumber material to be tested is a wild genotype; if the mutation site is base T, the cucumber material to be tested is a homozygous mutant genotype, the leaves are bubble-shaped and the plant is dwarfed; if the mutation site is C / T, the cucumber material to be tested is a heterozygous genotype, and the phenotype is consistent with the wild type.

7. The use according to claim 6, characterized in that: The PCR amplification system is 2×PCR buffer 25 μL (containing Mg 2+ , dNTPs), 2 μL each of forward and reverse primers (10 μmol / L), 1 μL of genomic DNA, 1 μL of high-fidelity DNA polymerase, 20 μL of ddH2O; 50 μL in total; The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

Images