Novel natural carbon dioxide fixation pathway and application thereof

Abstract

The invention provides a novel natural carbon dioxide immobilization pathway and application thereof. The invention also provides methods for producing nucleotides or nucleotide derivatives and methods for immobilizing carbon dioxide using the pathway. The carbon dioxide emission reduction can be realized, and the production raw material cost and the manufacturing cost can be reduced.

Description

Technical Field

[0001] The present invention relates to the field of microbial metabolic engineering, and more specifically, to a novel natural carbon dioxide fixation pathway and its application. Background Art

[0002] To date, six natural CO2 fixation pathways have been well-documented. These pathways include the Calvin-Benson-Bassham cycle, the reductive acetyl-CoA (Wood-Ljungdahl) pathway, the dicarboxylic acid / 4-hydroxybutyrate (DC / HB) cycle, the 3-hydroxypropionic acid / 4-hydroxybutyrate (HP / HB) cycle, the 3-hydroxypropionic acid (3-HP) dual cycle, the reductive TCA cycle, and the reductive glycine pathway has also been identified as a potential natural CO2 fixation pathway. These autotrophic pathways utilize various enzymes to fix CO2 or bicarbonate, allowing microorganisms to adapt to different habitats and produce central carbon metabolites for their growth. However, most industrial microorganisms are typically characterized by neutral or acidic fermentation, and the low solubility of CO2 in the culture limits the practical application of these autotrophic pathways (Liu, Z., Wang, K., Chen, Y., Tan, T., and Nielsen, J. (2020). Third-generation biorefineries as the means to produce fuels and chemicals from CO2. Nature Catalysis 3, 274-288).

[0003] Genome analyses of many autotrophic organisms have shown that some species, such as Acidoferrhoeae and Arsenicothermolyticus, do not have any genes for any known CO2 fixation pathways, suggesting that there may be other CO2 fixation pathways that have not yet been identified (Wang Kai, Liu Zihe, Chen Biqiang, Wang Meng, Zhang Yang, Bi Haoran, Zhou Yali, Huo Yiying, Tan Tianwei (2020). Microbial synthesis of fuels and chemicals from carbon dioxide - the third generation of biorefining. Synthetic Biology 1: 60-70). Summary of the invention

[0004] The inventors discovered a new natural carbon fixation pathway, the nucleotide synthesis pathway, through isotope experiments. The inventors unexpectedly found that CO2 or CO2 derivatives (such as bicarbonate) can enter the pathway directly (i.e., without other reactions) through the de novo nucleotide synthesis pathway in Halomonas through the reactions catalyzed by carbamoyl phosphate synthetase (encoding gene carB, EC: 6.3.5.5), 5-amino-1-(5-phospho-D-ribosyl)imidazole carboxylase (encoding gene purK, EC: 6.3.4.18) or their combination in the pathway, and the C atoms of CO2 or CO2 derivatives are directly converted into UMP, CMP, AMP, GMP, hypoxanthine and NAD + On the other hand, since the alkaline culture conditions of Halomonas increase the solubility of CO2, the identification of the above-mentioned new endogenous CO2 fixation mechanism can further promote the high-value application of CO2, which has important social and scientific significance for carbon neutrality.

[0005] The present invention also utilizes this pathway to produce nucleotides and nucleotide derivatives. Since CO2 or CO2 derivatives (such as bicarbonate) are fixed through the nucleotide de novo synthesis pathway, the synthesis of nucleotides and nucleotide derivatives in Halomonas can be promoted by adding CO2 or CO2 derivatives (such as bicarbonate) to the culture medium.

[0006] Therefore, on the one hand, the present invention provides a method for producing nucleotides or nucleotide derivatives in Halomonas or promoting the production of nucleotides or nucleotide derivatives or promoting the growth of Halomonas, the method comprising: culturing Halomonas to produce nucleotides or nucleotide derivatives or promote the production of nucleotides or nucleotide derivatives or promote the growth of Halomonas using a substrate comprising CO2, a CO2 derivative or a combination thereof.

[0007] In a specific embodiment, the Halomonas includes one or more of Halomonas bluephagenesis or its derivatives, Halomonas campaniensis or its derivatives, Halomonas aydingkolgenesis or its derivatives. In a preferred embodiment, the Halomonas is Halomonas bluephagenesis TD1.0, Halomonas bluephagenesis TD01 (strain collection number CGMCC No.4353), Halomonasaydingkolgenesis M1 (strain collection number CGMCC No.19880), Halomonas campaniensis LS21 (strain collection number CGMCC No.6593), Halomonas bluephagenesis TD1.0ΔzwfΔgcdΔpgi, Halomonas bluephagenesis WZY278.

[0008] In one embodiment, the CO2 is a gas; the CO2 derivative is: i) an organic acid and / or an organic acid salt having a carbon number of any integer from 1 to 10; and / or, ii) a CO3 2- Roots and / or HCO3 - The inorganic substance of the root is more preferably selected from one or more of carbonate, bicarbonate, formic acid, formate, acetic acid or acetate; even more preferably, the CO2 derivative is selected from one or more of sodium bicarbonate, potassium bicarbonate, calcium bicarbonate, ammonium bicarbonate, sodium carbonate, potassium carbonate, calcium carbonate, formate or acetate.

[0009] In a specific embodiment, the substrate comprises a combination of NaHCO3 and CO2, or a combination of NaHCO3 and sodium formate. Optionally, the substrate also comprises NaCl, i.e., the substrate comprises a combination of NaHCO3, CO2 and NaCl, or a combination of NaHCO3, sodium formate and NaCl.

[0010] In a specific embodiment, the nucleotides include one or more of adenylic acid, guanylic acid, cytidylic acid, uridine acid or thymidylic acid.

[0011] In one embodiment, the nucleotide derivatives include adenine, guanine, cytosine, uracil, thymine, ATP, NAD + and one or more of a flavor enhancer, wherein the flavor enhancer refers to a flavor nucleotide, including creatinine and guanylate.

[0012] In a specific embodiment, the salt mononas can grow with the CO2 or CO2 derivative as a carbon source through a nucleotide de novo synthesis pathway, wherein the C atom of the CO2 or CO2 derivative is directly converted into UMP, CMP, AMP, GMP, hypoxanthine and NAD through carbamoyl phosphate synthetase (encoding gene carB, EC: 6.3.5.5), 5-amino-1-(5-phospho-D-ribosyl) imidazole carboxylase (encoding gene purK, EC: 6.3.4.18) or a combination thereof in the nucleotide de novo synthesis pathway. + One or more C atoms in .

[0013] In one embodiment, the nucleotide or nucleotide derivative is secreted outside the cell. Specifically, the nucleotide or nucleotide derivative can be naturally secreted outside the cell by Halomonas in a CO2-enriched environment, and the CO2-enriched environment can be provided by high-concentration CO2 gas or CO2 derivatives.

[0014] In one embodiment, during the culture of Halomonas, the CO2 as a carbon source for halophiles can also adjust the pH value. Specifically, during the culture of Halomonas, due to carbonate as a carbon source and the rising pH value of the culture medium, CO2 as a carbon source for halophiles can be used to adjust the pH value.

[0015] In a specific embodiment, the method further comprises promoting the production of the nucleotide or nucleotide derivative by adjusting (e.g., increasing) a nitrogen source, which includes urea, aspartic acid, glutamine, peptone, and the like.

[0016] In a specific embodiment, the substrate further comprises one or more of glucose, gluconate, glycerol, sucrose, xylose or cellulose hydrolyzate.

[0017] In one embodiment, the CO2 is CO2 naturally present in the air or produced in industry. Under alkaline culture conditions of halophilic bacteria, any CO2 gas, including that in the air and produced in industry, can be used as a substrate to produce nucleotides and nucleotide derivatives.

[0018] Another aspect of the present invention also provides the use of a de novo nucleotide synthesis pathway in carbon dioxide fixation. The de novo nucleotide synthesis pathway can be a de novo nucleotide synthesis pathway in a cell or a de novo nucleotide synthesis pathway (reaction system) in an extracellular / cell-free system.

[0019] In one embodiment, CO2 or a CO2 derivative directly achieves the carbon dioxide fixation through a reaction catalyzed by carbamoyl phosphate synthetase, 5-amino-1-(5-phospho-D-ribosyl)imidazole carboxylase or a combination thereof.

[0020] In a specific embodiment, the nucleotide de novo synthesis pathway is a process for synthesizing nucleotides using raw materials including ribose phosphate, amino acids, one-carbon units and CO2, wherein preferably the ribose phosphate can be produced through the pentose phosphate pathway through one or more of glucose, gluconate, sucrose, xylose or cellulose hydrolysate; the amino acids include aspartic acid, glutamine and / or wool hydrolysate; the one-carbon unit can be produced through metabolism through one or more of serine, tryptophan, histidine, glycine, methionine or wool hydrolysate; the CO2 is provided by CO2 gas or a CO2 derivative, preferably wherein the C atom of the CO2 or CO2 derivative is directly converted into UMP, CMP, AMP, GMP, hypoxanthine and NAD through carbamoyl phosphate synthetase, 5-amino-1-(5-phospho-D-ribosyl)imidazole carboxylase or a combination thereof in the nucleotide de novo synthesis pathway. + More preferably, the process is as follows Figure 1 shown.

[0021] In a specific embodiment, the one-carbon unit includes one or more of methyl (-CH3), methylene (-CH=), formyl (-CHO), and imidomethyl (-CO=NH).

[0022] In a specific embodiment, the carbamoyl phosphate synthetase belongs to EC:6.3.5.5, and preferably the gene encoding it is carB.

[0023] In a specific embodiment, the 5-amino-1-(5-phospho-D-ribosyl)imidazole carboxylase belongs to EC:6.3.4.18, and preferably its encoding gene is purK.

[0024] In a specific embodiment, the nucleotides include one or more of adenylic acid, guanylic acid, cytidylic acid, uridine acid or thymidylic acid.

[0025] In a specific embodiment, the de novo nucleotide synthesis pathway is a natural de novo nucleotide synthesis pathway.

[0026] In a specific embodiment, the nucleotide de novo synthesis pathway is a nucleotide de novo synthesis pathway in Halomonas, and preferably the Halomonas includes one or more of Halomonas bluephagenesis or its derivatives, Halomonas campaniensis or its derivatives, Halomonas aydingkolgenesis or its derivatives. In a preferred embodiment, the Halomonas is Halomonas bluephagenesis TD1.0, Halomonas bluephagenesis TD01 (strain collection number CGMCC No.4353), Halomonasaydingkolgenesis M1 (strain collection number CGMCC No.19880), Halomonas campaniensis LS21 (strain collection number CGMCC No.6593), Halomonas bluephagenesis TD1.0ΔzwfΔgcdΔpgi, Halomonas bluephagenesis WZY278.

[0027] In a specific embodiment, the substrate for carbon dioxide fixation includes CO2 or a CO2 derivative, preferably the CO2 derivative is: i) an organic acid and / or an organic acid salt having a carbon number of 1-10; and / or, ii) an organic acid containing CO3 2- Roots and / or HCO3 - The inorganic substance of the root is more preferably selected from one or more of carbonate, bicarbonate, formic acid, formate, acetic acid or acetate; even more preferably, the CO2 derivative is selected from one or more of sodium bicarbonate, potassium bicarbonate, calcium bicarbonate, ammonium bicarbonate, sodium carbonate, potassium carbonate, calcium carbonate, formate or acetate.

[0028] Another aspect of the present invention also provides a method for fixing carbon dioxide, which comprises culturing Halomonas with CO2 or a CO2 derivative or a combination thereof as the sole carbon source, wherein the carbon dioxide is fixed by utilizing the de novo nucleotide synthesis pathway in the Halomonas.

[0029] In a specific embodiment, the Halomonas includes one or more of Halomonas bluephagenesis or its derivatives, Halomonas campaniensis or its derivatives, Halomonas aydingkolgenesis or its derivatives. In a preferred embodiment, the Halomonas is Halomonas bluephagenesis TD1.0, Halomonas bluephagenesis TD01 (strain collection number CGMCC No.4353), Halomonasaydingkolgenesis M1 (strain collection number CGMCC No.19880), Halomonas campaniensis LS21 (strain collection number CGMCC No.6593), Halomonas bluephagenesis TD1.0ΔzwfΔgcdΔpgi, Halomonas bluephagenesis WZY278.

[0030] In one embodiment, the CO2 derivative is: i) an organic acid and / or an organic acid salt having a carbon number of any integer from 1 to 10; and / or, ii) an organic acid containing CO3 2- Roots and / or HCO3 - The inorganic substance of the root is more preferably selected from one or more of carbonate, bicarbonate, formic acid, formate, acetic acid or acetate; even more preferably, the CO2 derivative is selected from one or more of sodium bicarbonate, potassium bicarbonate, calcium bicarbonate, ammonium bicarbonate, sodium carbonate, potassium carbonate, calcium carbonate, formate or acetate.

[0031] In a specific embodiment, the carbon dioxide fixation is directly achieved by a reaction catalyzed by carbamoyl phosphate synthetase, 5-amino-1-(5-phospho-D-ribosyl)imidazole carboxylase, or a combination thereof.

[0032] The present application uses CO2, CO2 derivatives and / or other carbon sources as substrates for Halomonas to synthesize nucleotides or nucleotide derivatives, which are essential substances for life. High concentrations of CO2 or CO2 derivatives can promote the de novo synthesis of nucleotides, and metabolic modification or regulation of nitrogen sources can promote the generation of nucleotides or nucleotide derivatives. In addition, in addition to being potential carbon sources, CO2 and CO2 derivatives can also be used as pH buffers, thereby reducing dependence on NaOH during the fermentation process and simplifying the treatment of late fermentation wastewater. Moreover, inorganic CO2 derivatives can replace part of the inorganic salts in the culture medium to maintain the osmotic pressure of the culture process. The specific scheme is as follows:

[0033] The present invention defines a novel natural carbon dioxide fixation pathway that enables Halomonas to grow using CO2 or CO2 derivatives as a carbon source and to synthesize nucleotides and nucleotide derivatives.

[0034] The CO2 and / or CO2 derivatives can be absorbed and utilized by microorganisms, which can also be called carbon dioxide fixation.

[0035] The Halomonas include but are not limited to one or more of Halomonas bluephagenesis or its derivatives, Halomonas campaniensis or its derivatives, Halomonas aydingkolgenesis or its derivatives.

[0036] Those skilled in the art can adjust the addition of CO2 or CO2 derivatives as needed, or maintain the CO2 concentration in the culture process within a suitable range by adding CO2 and CO2 derivatives at the same time.

[0037] CO2 derivatives are: i) organic acids and / or organic acid salts having a carbon number of any integer from 1 to 10; and / or, ii) containing CO3 2- Roots and / or HCO3 - Inorganic root matter.

[0038] Preferably, the organic acid and / or organic acid salt has an integer of 1-10 carbon atoms, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 carbon atoms. Further preferably, the organic acid and / or organic acid salt has reducing power, such as organic acid and / or organic acid salt that can be decomposed into CO2, such as potassium salt, calcium salt, sodium salt, magnesium salt, aluminum salt, zinc salt or iron salt.

[0039] Contains CO3 2- Roots and / or HCO3 - The inorganic matter of the roots includes carbonates and / or bicarbonates.

[0040] In a specific embodiment of the present invention, the CO2 derivative is selected from one or more of carbonates, bicarbonates, formic acid or formate; preferably, the CO2 derivative is selected from one or more of sodium bicarbonate, potassium bicarbonate, calcium bicarbonate, ammonium bicarbonate, sodium carbonate, potassium carbonate, calcium carbonate or formate.

[0041] The culture includes but is not limited to seed culture, well plate culture, shake flask culture or fermenter culture.

[0042] The culture can be continuous fermentation or fed-batch fermentation.

[0043] Preferably, the substrate is contained in the culture medium.

[0044] The culture medium may be solid, liquid or semi-solid.

[0045] The culture medium can be an activation medium, a seed medium, a fermentation medium, a fed-batch medium, a feed medium, etc.

[0046] The second aspect of the present invention provides a novel natural carbon dioxide fixation pathway and its application, wherein the application includes but is not limited to the production of nucleotides and / or nucleotide derivatives.

[0047] Those skilled in the art can adjust the concentrations of added substrates, nitrogen sources and inorganic salts as needed, wherein the substrate includes a carbon source, CO2 and / or CO2 derivatives, the nitrogen source includes urea, aspartic acid, glutamine, peptone, etc., and the inorganic salt maintains the osmotic pressure required by the microorganisms.

[0048] The carbon source includes, but is not limited to, one or more of glucose, gluconate, sucrose, xylose or cellulose hydrolyzate, preferably glucose.

[0049] In a specific embodiment of the present invention, the substrate comprises glucose and / or bicarbonate.

[0050] The culture includes but is not limited to seed culture, shake flask culture or fermenter culture.

[0051] The culture can be continuous fermentation or fed-batch fermentation.

[0052] Preferably, the substrate is contained in the culture medium.

[0053] The culture medium may be solid, liquid or semi-solid.

[0054] The culture medium can be an activation medium, a seed medium, a fermentation medium, a fed-batch medium, a feed medium, etc.

[0055] Preferably, the concentration of the substrate in the culture medium is any value in the range of 1-300 g / L, preferably any value in the range of 30-100 g / L.

[0056] Preferably, the concentration of the carbon source in the culture medium is any value in the range of 1-300 g / L, preferably any value in the range of 30-100 g / L.

[0057] The concentration of the nitrogen source is any value in the range of 0.001-100 g / L.

[0058] Preferably, the concentration of CO2 and / or CO2 derivatives in the culture medium is any value in the range of 1-100 g / L, preferably any value in the range of 5-40 g / L.

[0059] Preferably, in the culture medium, the molar amount of CO2 and / or CO2 derivatives is any value in the range of 0.01-1M, preferably any value in the range of 0.05-1M, for example, 0.01, 0.02, 0.03, 0.04, 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1M, preferably any value in the range of 0.02-0.5M.

[0060] The carbon source can be added to the culture medium at the beginning of fermentation, or can be added during the fermentation process, or can be added in batches as feed.

[0061] The CO2 and / or CO2 derivatives can be added to the culture medium at the beginning of fermentation, can be added during the fermentation process, or can be added in batches as feed.

[0062] Preferably, the culture medium further includes inorganic salts, such as potassium salts and / or sodium salts. The potassium salts include, but are not limited to, one or more of potassium chloride, potassium sulfate, potassium phosphate, potassium citrate, potassium nitrate, or potassium dihydrogen phosphate. The sodium salts include, but are not limited to, one or more of sodium chloride, sodium sulfate, sodium phosphate, sodium citrate, sodium nitrate, or sodium dihydrogen phosphate. Preferably, the sodium salt is sodium chloride.

[0063] Preferably, in the culture medium, the concentration of inorganic salts is any value in the range of 0.0001-1M.

[0064] Among them, when the CO2 derivative is an inorganic substance, it can partially replace the inorganic salts (such as NaCl) in the culture medium.

[0065] The nucleotides include one or more of adenylic acid, guanylic acid, cytidylic acid, uridine acid or thymidylic acid, and the nucleotide derivatives include but are not limited to upstream precursors and / or downstream metabolites of nucleotides. Preferably, the nucleotide derivatives include adenine, guanine, cytosine, uracil, thymine, ATP, NAD + , and one or more of flavor enhancers, wherein the flavor enhancers refer to flavor nucleotides, including creatinine and guanylate.

[0066] The derivatives can be produced by wild strains or can be produced after modification. Preferably, the derivatives can be secreted by wild strains to the extracellular space or produced intracellularly, and more preferably, the derivatives are secreted by wild strains or engineered strains to the extracellular space.

[0067] The third aspect of the present invention provides a method for producing nucleotides or derivatives thereof using CO2, wherein the method for producing nucleotides or derivatives thereof comprises culturing the microorganisms described in the second aspect, preferably using the above-mentioned culture medium.

[0068] The fourth aspect of the present invention provides an application of the above method or the nucleotide derivative prepared by the above method in the preparation of food flavor enhancers or medicines, such as flavor nucleotides, antiviral drugs, anticancer drugs, etc.

[0069] Beneficial effects:

[0070] A) Alkaline culture medium increases the solubility of CO2 and promotes the storage and utilization efficiency of CO2.

[0071] B) Adding CO2 / CO2 derivatives to the culture medium can promote the accumulation of nucleotides and nucleotide derivatives, broaden the types of high-value CO2 products, and promote the high-value utilization of greenhouse gases.

[0072] C) Adding CO2 / CO2 derivatives to the culture medium allows microorganisms to utilize exogenous CO2 / CO2 derivatives as additional carbon sources, reducing the use of carbon sources such as glucose, which can reduce the cost of industrial production of nucleotides and / or nucleotide derivatives and make the entire production process more green and sustainable.

[0073] The "carbon dioxide fixation" of the present invention refers to the process of converting carbon dioxide or inorganic salts derived from carbon dioxide into organic matter. Of course, it can also include the process of decomposing organic matter that can be converted into carbon dioxide into carbon dioxide and then converting it into organic matter.

[0074] The words “include” or “comprising” described in the present invention are open-ended descriptions, including all the specified components or steps described, as well as other specified components or steps that will not be substantially affected; when used to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the activity described in the present invention.

[0075] The "and / or" described in the present invention includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately herein. For example, "A and / or B" includes "A", "A and B" and "B". For another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C" and "A and B and C".

[0076] The above merely summarizes some aspects of the present invention and is not and should not be considered to limit the present invention in any aspect.

[0077] All patents and publications mentioned in this application are incorporated herein by reference as a whole. Those skilled in the art will recognize that certain changes may be made to the present invention without departing from the concept or scope of the present invention. The following examples further illustrate the present invention in detail and should not be considered to limit the scope of the present invention or the specific method described in the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] The above features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying drawings, in which:

[0079] Figure 1 The novel natural carbon dioxide fixation pathway (nucleotide de novo synthesis pathway) according to the present invention is shown, wherein the red C represents the isotope labeling 13 C atom.

[0080] Figure 2 Display the mass spectrum of detected AMP;

[0081] Figure 3 Mass spectra showing detected GMP;

[0082] Figure 4 a mass spectrum showing detected UMPs; and

[0083] Figure 5 The mass spectrum of the detected CMP is shown. DETAILED DESCRIPTION

[0084] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only some embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0085] The embodiments of the present application are described using CO2, CO2 derivatives and / or glucose as examples to synthesize nucleotides and / or nucleotide derivatives.

[0086] Unless otherwise specified, the experimental methods used in the examples are conventional methods.

[0087] Unless otherwise specified, the reagents and materials used in the examples can be obtained from commercial sources.

[0088] Halomonas bluephagenesis TD1.0ΔzwfΔgcdΔpgi used in the example is a Gram-negative halophilic bacterium constructed by gene editing in this laboratory. The coding genes zwf, gcd, and pgi of the key enzymes of glycolysis were knocked out on the basis of Halomonas bluephagenesis TD1.0, which is disclosed in the article "Qin, Q., et al., CRISPR / Cas9 editing genome of extremophile Halomonas spp. Metabolic Engineering, 2018.47: p.219-229." The public can obtain the bacteria from Tsinghua University. Among them, Halomonas bluephagenesis TD1.0 refers to the document Novel T7-like expression systems used for Halomonas (Zhao et al, Metabolic Engineering, 2017).

[0089] Halomonas bluephagenesis WZY278 used in the example is a Gram-negative halophilic bacterium that has successfully achieved industrial production of PHA, disclosed in the article "Ji, M., et al., PHB production from foodwaste hydrolysates by Halomonas bluephagenesis Harboring PHB operon linkedwith an essential gene. Metabolic Engineering, 2023.77: p.12-20." The public can obtain the bacteria from Tsinghua University.

[0090] Halomonas aydingkolgenesis M1 used in the examples is described in patent application publication CN111593006A; the public can obtain the bacterium from Tsinghua University.

[0091] The gene editing methods used in the examples are CRISPR-AID and small regulatory RNA methods, see respectively Engineered Halomonas spp. for production of l-Lysine and cadaverine (Zhao et al, Bioresource Technology, 2022), Engineering Halomonas bluephagenesis via small regulatory RNAs (Wang et al, Metabolic Engineering, 2022).

[0092] The culture medium in the embodiment comprises:

[0093] Glucose 50g / L, 0-0.86M NaCl, 0-0.86M NaHCO3 or 0-0.86M CaCO3, 0.5-3g / L urea, 0.2g / L MgSO4, 10g / L Na2HPO4·12H2O, 1.5g / L KH2PO4, other trace elements not exceeding 0.1g / L (Fe(III)-NH4-Citrate, CaCl2·2H2O, ZnSO4·7H2O, MnCl2·4H2O, H3BO 3， CoCl2·6H2O, CuSO4·5H2O, NiCl2·6H2O, NaMoO4·2H2O.

[0094] Methods for qualitative and quantitative nucleotides: The culture was centrifuged at 14,000g for 5 minutes, and after gently washing 3 times with PBS buffer, the pellet was immediately placed on dry ice and 2 ml of 80% (vol / vol) methanol (pre-cooled in a -80°C refrigerator) was added. Then, the cells were disrupted by ultrasound and the lysate was incubated at -80°C for 2 hours. Next, the lysate was centrifuged at 4°C and 14,000g for 20 minutes, and the supernatant containing the metabolites was transferred to a new 1.5 ml test tube on dry ice. Subsequently, the pellet was dried at room temperature using a Speedvac / lyophilizer, and the sample was then sent to the metabolomics platform for targeted omics determination of cellular metabolites, which can determine the relative abundance of nucleotides. The abundance of the same substance can be compared between groups, and the differences between different substances within or between groups cannot be compared. At the same time, standard samples of specific substances are sent for simultaneous detection, and the absolute concentration of nucleotides can be inferred from the standard curve of concentration. The specific detection process is as follows: Metabolite detection was performed using a Dionex Ultimate 3000 UPLC system coupled to a TSQ Quantiva Ultra triple quadrupole mass spectrometer (Thermo Fisher, CA) equipped with a heated electrospray ionization (HESI) probe, and the extracts were separated by a Synergi Hydro-RP column (2.0 × 100 mm, 2.5 μm, phenomenex). A binary solvent system was used, in which mobile phase A consisted of 10 mM tributylamine adjusted with 15 mM acetic acid in water and mobile phase B was methanol. The analysis used a 25-min gradient from 5% to 90% mobile phase B. Metabolite data were collected with selected reaction monitoring (SRM) in positive and negative ion switching mode. The resolution of Q1 and Q3 was 0.7 FWHM. The source voltage was 3500 V in positive ion mode and 2500 V in negative ion mode. The source parameters were: capillary temperature: 350 °C; heater temperature: 300 °C; sheath gas flow rate: 35; auxiliary gas flow rate: 10.

[0095] Result analysis: Tracefinder 3.2 (Thermo, USA) was used for metabolite identification and peak integration.

[0096] The cell dry weight (CDW, g / L) mentioned in the examples is the ratio of the mass of the dried bacterial cells to the volume of the recovered bacterial solution.

[0097] Method for quantifying glucose concentration:

[0098] The remaining glucose concentration in the bacteria can be quantified by liquid chromatography, using an LC-20 instrument (Shimadzu) with an Aminex HPX-87H column (Bio-Rad) and a RID-10A refractive index detector (Shimadzu). The mobile phase is 5mM degassed H2SO4, and the flow rate is 0.5mL / min. The column temperature is maintained at 55°C. The culture solution is centrifuged at 12,000×g and 4°C for 2min, and the supernatant is taken and filtered through a 0.22μm polyethersulfone membrane filter (Jinglong) as the sample, with a sample volume of 30μL. Glucose standards are prepared at five different concentrations, and a standard curve is drawn to calculate the concentration of the sample.

[0099] Example 1: Isotope labeling experiments reveal a new natural carbon fixation pathway

[0100] In this experiment, Halomonas bluephagenesis TD1.0ΔzwfΔgcdΔpgi was used as the starting strain for fermentation culture. When only 0.86M NaHCO3 or NaCl was added to the culture medium during fermentation, H.bluephagenesisTD1.0ΔzwfΔgcdΔpgi could use NaHCO3 as a carbon source for autotrophic growth (Table 1). The additional addition of 1g / L yeast extract to the culture medium further promoted the growth of H.bluephagenesis TD1.0ΔzwfΔgcdΔpgi (Table 2). To reveal the carbon fixation mechanism of Halomonas, 0.86M NaH was added to the culture medium during fermentation. 13 CO3+1g / L yeast extract, using microtiter plate experiment, three parallel samples were set up, metabolite results were displayed as percentages, and the average was taken. The culture temperature was 37℃, and the rotation speed was 1000rpm. The experimental results are shown in Table 3. NaH was added to the culture medium. 13 After CO3, the nucleotides and nucleotide derivatives of H. bluephagenesis TD1.0ΔzwfΔgcdΔpgi were labeled in large quantities. The mass spectrum of the detection results is shown in Figures 2 to 5 .

[0101] Table 1: OD values ​​of H. bluephagenesis TD1.0ΔzwfΔgcdΔpgi grown in NaHCO3 or NaCl 600

[0102] Ingredients and concentration <![CDATA[OD 600 ]]> 0.86M NaCl 0.17±0.01 <![CDATA[0.86M NaHCO3]]> 0.65±0.05

[0103] Table 2: Addition of yeast extract promotes the growth of H. bluephagenesis TD1.0ΔzwfΔgcdΔpgi in NaHCO3

[0104]

[0105] Table 3: NaH 13 Effects of CO3 on the accumulation of metabolites in Halomonas bluephagenesis TD1.0ΔzwfΔgcdΔpgi

[0106]

[0107]

[0108] In addition, further analysis showed that the above-mentioned labeled metabolites can be enriched in the nucleotide de novo synthesis pathway ( Figure 1 ), where the CO2 fixation reaction is catalyzed by ① carbamoyl phosphate synthetase (encoding gene carB, EC:6.3.5.5) and ② 5-amino-1-(5-phospho-D-ribosyl)imidazole carboxylase (encoding gene purK, EC:6.3.4.18), respectively. After knocking out the purK gene using CRISPR-AID (obtaining H.bluephagenesis TD1.0ΔzwfΔgcdΔpgiΔpurK), the growth of the strain H.bluephagenesis TD1.0ΔzwfΔgcdΔpgi in NaHCO3 medium was blocked (Table 4). After knocking down the carB gene using small regulatory RNA (obtaining H.bluephagenesis TD1.0ΔzwfΔgcdΔpgi-qdcarB), the growth of the strain H.bluephagenesis TD1.0ΔzwfΔgcdΔpgi in NaHCO3 medium was also blocked (Table 4). Therefore, purK and carB are key genes for fixing CO2 in the nucleotide synthesis pathway. Aspartic acid is a precursor for nucleotide synthesis. Knocking out the purK gene or knocking down the carB gene has an important effect on the growth of H.bluephagenesis. The blockage of TD1.0ΔzwfΔgcdΔpgi growth further indicated that nucleotide synthesis was the reason why Halomonas could grow in NaHCO3 medium. The gRNA sequence for knocking out the purK gene by CRISPR-AID and the small regulatory RNA sequence used to knock down the carB gene are shown in Table 5.

[0109] Table 4: Effect of knockout gene purK on the growth of H. bluephagenesis TD1.0ΔzwfΔgcdΔpgi

[0110]

[0111] Table 5: gRNA sequences for knocking out the gene purK and small regulatory RNA sequences for knocking down the gene carB

[0112] gRNA sequence for knocking out gene purK (5'→3') accagcatttggcggaatttct(SEQ ID No.1) Small regulatory RNA sequence (5'→3') to knock down the gene carB ttgtcgctcatcgtcacttatttt(SEQ ID No.2)

[0113] Example 2: Shake flask experiment results show that the addition of NaHCO3 and CO2 to the culture medium can promote the synthesis of nucleotides

[0114] In this experiment, Halomonas bluephagenesis WZY278 was used as the starting strain for cultivation. When Halomonas bluephagenesis WZY278 was fermented, 0.86M NaHCO3 or 0.86M NaCl was added to the culture medium. A shake flask experiment was used. Three parallel samples were set for each group of experiments, and the results were averaged. The amount of glucose added during the fermentation process was 50g / L, the fermentation temperature was 37°C, and the shake flask speed was 200rpm. During fermentation, the 0.86M NaCl culture medium will become acidic, and 5MNaOH can be used to adjust the pH. NaHCO3 is absorbed to increase the pH of the culture medium, affecting the growth of the strain. To stabilize the pH of the strain, CO2 gas can be passed through the NaHCO3 culture medium. The pH change results are shown in Table 6. Analysis of nucleotide results showed that the abundance of adenine and cytosine secreted into the extracellular space by Halomonas bluephagenesis WZY278 increased by approximately 8 times and 127 times, respectively, compared with that of the control group (Table 7). The results were presented as the ratio of the average abundance of the control group (NaCl group)".

[0115] Table 6: pH of H. bluephagenesis WZY278 stabilized in NaHCO3 medium by CO2 gas flow

[0116]

[0117]

[0118] Table 7: Effects of adding NaHCO3 and CO2 on nucleotide accumulation in strain Halomonas bluephagenesis WZY278 (results are shown as "ratio to the average abundance of the control group")

[0119]

[0120] Example 3: Shake flask results show that the addition of CO2 derivative sodium formate can promote the growth of strains

[0121] In this experiment, H.bluephagenesis TD1.0ΔzwfΔgcdΔpgi was used as the starting strain for fermentation culture. During fermentation, 0.43M NaCl+0.43M NaHCO3 or 0.43M NaCl+0.215M NaHCO3+0.215M sodium formate was added to the culture medium, and 0.5g / L urea was added at the same time. A shake flask experiment was used, and three parallel samples were set for each group of experiments, and the results were averaged. The amount of glucose added during the fermentation process was 50g / L, the fermentation temperature was 37°C, and the shake flask speed was 200rpm. The experimental results are shown in Table 8. After sodium formate was added to the culture medium on the basis of adding NaHCO3, the dry weight of the cells of the strain H.bluephagenesisTD1.0ΔzwfΔgcdΔpgi increased.

[0122] Table 8: Addition of sodium formate promotes the growth of H. bluephagenesis TD1.0ΔzwfΔgcdΔpgi in NaHCO3

[0123]

[0124] Example 4: Shake flask results show that regulating nitrogen metabolism can promote the growth and nucleotide accumulation of strains in NaHCO3

[0125] In this experiment, Halomonas aydingkolgenesis M1 was used as the starting strain for fermentation culture. During fermentation, 0.86M NaCl or 0.43M NaCl+0.43MNaHCO3 was added to the culture medium, and 0.5, 1.5, 3g / L urea or 5g / L peptone was added at the same time. A shake flask experiment was used, and three parallel samples were set for each group of experiments, and the results were averaged. The amount of glucose added during the fermentation process was 50g / L, the fermentation temperature was 37°C, and the shake flask speed was 200rpm. The experimental results are shown in Table 9. On the basis of adding NaHCO3 to the culture medium, the urea concentration was increased or replaced with peptone, and the cell dry weight of the strain Halomonassaydingkolgenesis M1 increased. Further metabolite analysis of targeted metabolomics showed that regulating nitrogen metabolism caused the strain Halomonas aydingkolgenesis M1 to accumulate more nucleotide precursors and nucleotides (Table 10), and the results were shown as "ratio to the average abundance of the control group".

[0126] Table 9: Effects of regulating nitrogen metabolism on the growth of strain Halomonas aydingkolgenesis M1

[0127]

[0128]

[0129] Table 10: Effects of regulating nitrogen metabolism on metabolite accumulation in strain Halomonas aydingkolgenesis M1

[0130]

[0131] The above results show that taking glucose plus CO2 derivatives as co-substrates to produce nucleotides as an example, the accumulation of nucleotides is promoted by adding CO2 derivatives, and CO2 is integrated into high-value chemicals such as nucleotides and nucleotide derivatives, which is beneficial to the green development of biomanufacturing.

[0132] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0133] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations. In addition, the various different embodiments of the present invention can also be combined arbitrarily, as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A method for producing nucleotides or nucleotide derivatives or promoting the production of nucleotides or nucleotide derivatives or promoting the growth of Halomonas, the method comprising: Cultivating Halomonas in the presence of a substrate comprising CO2, a CO2 derivative, or a combination thereof to produce nucleotides or nucleotide derivatives or to promote the production of nucleotides or nucleotide derivatives or to promote the growth of Halomonas.

2. The method according to claim 1, wherein: The Halomonas includes one or more of Halomonas bluephagenesis or its derivatives, Halomonas campaniensis or its derivatives, Halomonas aydingkolgenesis or its derivatives; and / or The CO2 derivative is: i) an organic acid and / or an organic acid salt having a carbon number of any integer from 1 to 10; and / or, ii) an organic acid containing CO3 2- Roots and / or HCO3 - The inorganic substance of the root is more preferably selected from one or more of carbonate, bicarbonate, formic acid, formate, acetic acid or acetate; more preferably, the CO2 derivative is selected from one or more of sodium bicarbonate, potassium bicarbonate, calcium bicarbonate, ammonium bicarbonate, sodium carbonate, potassium carbonate, calcium carbonate, formate or acetate, Preferably, the substrate comprises a combination of NaHCO3 and CO2, or a combination of NaHCO3 and sodium formate.

3. The method according to claim 1 or 2, wherein: A) the nucleotides include one or more of adenylic acid, guanylic acid, cytidylic acid, uridine acid or thymidylic acid; B) The nucleotide derivatives include adenine, guanine, cytosine, uracil, thymine, ATP, NAD + and one or more of a flavor enhancer, wherein the flavor enhancer refers to a flavor nucleotide, including creatinine and guanylate; C) The Halomonas can grow with the CO2 or CO2 derivative as a carbon source through a nucleotide de novo synthesis pathway, wherein the C atom of the CO2 or CO2 derivative is directly converted into UMP, CMP, AMP, GMP, hypoxanthine and NAD via carbamoyl phosphate synthetase, 5-amino-1-(5-phospho-D-ribosyl)imidazole carboxylase or a combination thereof in the nucleotide de novo synthesis pathway. + One or more C atoms in ; D) the nucleotide or nucleotide derivative is secreted extracellularly; E) during the culture of Halomonas, the CO2 as a carbon source for halophiles can also adjust the pH value; and / or G) The method further comprises promoting the production of the nucleotide or nucleotide derivative by adjusting the nitrogen source.

4. The method according to any one of claims 1 to 3, wherein the substrate further comprises one or more of glucose, gluconate, glycerol, sucrose, xylose or cellulose hydrolyzate.

5. The method according to any one of claims 1 to 4, wherein the CO2 is CO2 naturally present in the air or CO2 produced in industry.

6. Application of de novo nucleotide synthesis pathway in carbon dioxide fixation.

7. The use according to claim 6, wherein CO2 or a CO2 derivative directly achieves the carbon dioxide fixation through a reaction catalyzed by carbamoyl phosphate synthetase, 5-amino-1-(5-phospho-D-ribosyl)imidazole carboxylase or a combination thereof.

8. The use according to claim 6 or 7, wherein: A) The de novo nucleotide synthesis pathway is a process for synthesizing nucleotides using raw materials including ribose phosphate, amino acids, one-carbon units and CO2, wherein preferably the ribose phosphate can be produced through the pentose phosphate pathway through one or more of glucose, gluconate, sucrose, xylose or cellulose hydrolysate; the amino acids include aspartic acid, glutamine and / or wool hydrolysate; the one-carbon unit can be produced through metabolism through one or more of serine, tryptophan, histidine, glycine, methionine or wool hydrolysate; the CO2 is provided by CO2 gas or a CO2 derivative, preferably wherein the C atom of the CO2 or CO2 derivative is directly converted into UMP, CMP, AMP, GMP, hypoxanthine and NAD through carbamoyl phosphate synthetase, 5-amino-1-(5-phospho-D-ribosyl)imidazole carboxylase or a combination thereof in the de novo nucleotide synthesis pathway. + The C atoms in one or more of the above, more preferably the process is as shown in Figure 1; B) the carbamoyl phosphate synthetase belongs to EC:6.3.5.5, and preferably the gene encoding it is carB; C) the 5-amino-1-(5-phospho-D-ribosyl)imidazole carboxylase belongs to EC:6.3.4.18, and preferably the encoding gene thereof is purK; D) the nucleotides include one or more of adenylic acid, guanylic acid, cytidylic acid, uridine acid or thymidylic acid; E) the de novo nucleotide synthesis pathway is a natural nucleotide de novo synthesis pathway; F) the de novo nucleotide synthesis pathway is a de novo nucleotide synthesis pathway in Halomonas, preferably the Halomonas includes one or more of Halomonas bluephagenesis or its derivatives, Halomonas campaniensis or its derivatives, Halomonas aydingkolgenesis or its derivatives; and / or G) The substrate for fixing carbon dioxide includes CO2 or a CO2 derivative, preferably the CO2 derivative is: i) an organic acid and / or an organic acid salt having a carbon number of any integer from 1 to 10; and / or, ii) an organic acid containing CO3 2- Roots and / or HCO3 - The inorganic substance of the root is more preferably selected from one or more of carbonate, bicarbonate, formic acid, formate, acetic acid or acetate; even more preferably, the CO2 derivative is selected from one or more of sodium bicarbonate, potassium bicarbonate, calcium bicarbonate, ammonium bicarbonate, sodium carbonate, potassium carbonate, calcium carbonate, formate or acetate.

9. A method for fixing carbon dioxide, the method comprising culturing Halomonas with CO2, a CO2 derivative, or a combination thereof as the sole carbon source, wherein the de novo nucleotide synthesis pathway in the Halomonas is used to fix carbon dioxide, wherein: Preferably, the Halomonas includes one or more of Halomonas bluephagenesis or its derivatives, Halomonascampaniensis or its derivatives, Halomonas aydingkolgenesis or its derivatives; and / or Preferably, the CO2 derivative is: i) an organic acid and / or an organic acid salt having a carbon number of any integer from 1 to 10; and / or, ii) an organic acid containing CO3 2- Roots and / or HCO3 - The inorganic substance of the root is more preferably selected from one or more of carbonate, bicarbonate, formic acid, formate, acetic acid or acetate; even more preferably, the CO2 derivative is selected from one or more of sodium bicarbonate, potassium bicarbonate, calcium bicarbonate, ammonium bicarbonate, sodium carbonate, potassium carbonate, calcium carbonate, formate or acetate.

10. The method of claim 9, wherein the carbon dioxide fixation is directly achieved by a reaction catalyzed by carbamoyl phosphate synthetase, 5-amino-1-(5-phospho-D-ribosyl)imidazole carboxylase, or a combination thereof.

Images