New application of medicine for intervening APT2 target spot

Abstract

The invention belongs to the technical field of medicines, and particularly relates to novel application of a medicine for intervening an APT2 target spot. The invention provides application of a medicine for intervening in an APT2 target spot in preparation of a medicine for preventing and / or treating Tau protein palmitoylation modification reduction related diseases. The learning and memory ability of an Alzheimer's disease model mouse in which the APT2 gene is knocked out or an APT2 inhibitor is injected is improved, the tangling aggregation and neuroinflammation of Tau protein are relieved, and the expression of protein related to synaptic function is increased. Experiments show that APT2 serving as a potential target spot for treating Alzheimer's disease has a remarkable effect of improving symptoms of neurodegenerative diseases, a new direction is brought to treatment of Alzheimer's disease, development of treatment of other Tau protein palmitoylation modification reduced related diseases is promoted, and the application has a wide prospect.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and specifically relates to a new use of a drug for intervening in APT2 targets. Background Art

[0002] Alzheimer's disease (AD) is a common central nervous system disease in the elderly (over 65 years old). Its typical pathological feature is the cognitive dysfunction of the brain caused by neuronal degeneration. With the increasing trend of population aging, the study of the pathogenic mechanism of Alzheimer's disease is imminent.

[0003] Clinical pathological examinations indicate that neurotoxicity caused by amyloid beta (Aβ) plaques and Tau protein tangles may be the main cause of neuronal death. Tau protein is highly expressed in neuronal axons and binds to microtubules, regulating microtubule stability and axonal transport. Changes in the ability of Tau protein to bind to microtubules may be a prerequisite for Tau protein tangles. Although the current mainstream view is that excessive phosphorylation of Tau protein will cause it to dissociate from microtubules and may cause Tau protein tangles, whether other forms of post-translational protein modifications are also involved in this process remains to be explored and confirmed in depth.

[0004] Palmitoylation is a post-translational modification that involves attaching palmitic acid to cysteine ​​residues of proteins. Palmitoylation has an important impact on protein function and stability. The relationship between protein palmitoylation levels and AD has been one of the hot topics of research in recent years. Abnormal palmitoylation of Tau protein may lead to reduced stability and aggregation of Tau protein, exacerbating the process of neurodegeneration. Therefore, regulating the palmitoylation state of Tau protein may provide a new strategy for the treatment of Alzheimer's disease and provide potential targets for the development of new therapeutic strategies.

[0005] The depalmitoylation process of proteins is affected by a variety of enzymes, including APT family enzymes (acyl-protein thioesterases), PPT family enzymes (palmitoyl protein thioesterases), and ABHD family enzymes (α / βhydrolase domain-containing proteins). APT2 belongs to the APT family enzyme and has been reported to be used for the depalmitoylation of Gasdermin-D protein and Signal Transducer and Activator of Transcription3 protein, and has potential application value in antiviral therapy and inflammatory bowel disease treatment.

[0006] However, there is no literature report on the connection between APT2 and tau protein palmitoylation modification, nor on the connection between APT2 and neurodegenerative diseases. Therefore, the prior art has not attempted to treat AD by targeting APT2 to regulate the palmitoylation level of tau protein. Summary of the invention

[0007] In view of the defects of the prior art, the present invention provides a use of a drug for intervening in the APT2 target for treating AD, with the aim of establishing a method for treating AD targeting the APT2 target.

[0008] The present invention provides use of a drug for intervening in an APT2 target in the preparation of a drug for preventing and / or treating diseases related to reduced palmitoylation modification of tau protein, characterized in that the drug for intervening in an APT2 target is selected from an APT2 inhibitor, a drug for inhibiting APT2 gene expression, a drug for knocking out or knocking down the APT2 gene, and a drug for degrading APT2.

[0009] Preferably, the APT2 inhibitor is selected from small molecule compounds, polypeptides, and antibodies.

[0010] Preferably, the structural formula of the APT2 inhibitor is:

[0011]

[0012] Wherein, R1, R6, and R7 are independently selected from O, N, and S;

[0013] R2 is selected from C1-C 10 Alkyl, C1-C 10 Ether, halogen, C1-C 10 Halogenated alkyl, C1-C 10 Alkoxy;

[0014] R3, R4, and R5 are independently selected from halogen, C1-C 10 Alkyl, C1-C 10 Halogenated alkyl, C1-C 10 Alkoxy;

[0015] m is selected from 0, 1, 2, 3, 4, 5;

[0016] n is selected from 0, 1, 2, 3, 4;

[0017] k is selected from 0, 1, 2;

[0018] h is selected from 0, 1, 2, 3, 4.

[0019] Preferably, the compound represented by formula I includes the following compounds:

[0020]

[0021] Preferably, the APT2 inhibitor is selected from ML349, Palmostatin B, and JCP174.

[0022] Preferably, the drug for inhibiting APT2 gene expression is selected from circular RNA, antisense nucleic acid, small interfering nucleic acid, nucleic acid aptamer, small activating nucleic acid, micronucleic acid, mRNA drug, ribozyme; and / or, the drug for knocking out or knocking down APT2 gene is CRISPR / Cas9 gene editing system.

[0023] Preferably, the drug for degrading APT2 comprises a protein degrader.

[0024] Preferably, the drug for degrading APT2 is selected from PROTAC and molecular glue.

[0025] Preferably, the disease associated with reduction of palmitoylation modification of tau protein is a neurodegenerative disease.

[0026] Preferably, the neurodegenerative disease is at least one of the following diseases: Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, prefrontal dementia, Lewy body dementia, multiple sclerosis, spinal muscular atrophy, Creutzfeldt-Jakob disease, Wilson's disease.

[0027] The present invention provides a use of a drug for intervening in the APT2 target in the preparation of a drug for preventing and / or treating diseases related to reduced palmitoylation modification of tau protein. The learning and memory abilities of Alzheimer's disease model mice in which the APT2 gene is knocked out or the APT2 inhibitor is injected are improved, the tangle aggregation and neuroinflammation of tau protein are alleviated, and the expression of proteins related to synaptic function is increased. Experiments have shown that APT2, as a potential target for the treatment of Alzheimer's disease, has a significant effect on improving the symptoms of neurodegenerative diseases, which brings a new direction for the treatment of Alzheimer's disease and promotes the development of treatments for other diseases related to reduced palmitoylation modification of tau protein, with broad prospects.

[0028] Definitions of terms used in the present invention: Unless otherwise stated, the initial definitions provided for groups or terms in this document apply to the groups or terms throughout the specification; for terms that are not specifically defined in this document, the meaning that a person skilled in the art can give them should be given based on the disclosure and context.

[0029] "Substitution" refers to the replacement of a hydrogen atom in a molecule by another different atom or molecule.

[0030] The minimum and maximum carbon atom content in a hydrocarbon group is indicated by a prefix, for example, the prefix C a～bAlkyl refers to any alkyl group containing from "a" to "b" carbon atoms. Thus, for example, "C 1～4 The term "alkyl" refers to an alkyl group containing 1 to 4 carbon atoms.

[0031] "Alkyl" refers to a saturated hydrocarbon chain having a specified number of member atoms. For example, C1-C6 alkyl refers to an alkyl group having 1 to 6 member atoms, such as 1 to 4 member atoms. The alkyl group can be straight or branched. Representative branched alkyl groups have one, two or three branches. The alkyl group may be optionally substituted with one or more substituents as defined herein. Alkyl includes methyl, ethyl, propyl (n-propyl and isopropyl), butyl (n-butyl, isobutyl and tert-butyl), pentyl (n-pentyl, isopentyl and neopentyl) and hexyl. The alkyl group may also be part of other groups, such as C1-C6 alkoxy.

[0032] "Alkoxy" refers to an alkyl group attached to the site of attachment through an oxygen atom, for example, methoxy refers to -OCH3.

[0033] "Ether" refers to a saturated alkane chain having the specified number of carbon atoms containing at least one oxygen atom.

[0034] "Halogen" refers to a halogen atom including fluorine, chlorine, bromine, and iodine.

[0035] "Haloalkyl" means that the hydrogen atoms in the alkyl group may be replaced by one or more halogen atoms. 1～4 The halogenalkyl group refers to an alkyl group containing 1 to 4 carbon atoms in which hydrogen atoms are substituted by one or more halogen atoms.

[0036] "APT2 inhibitor" refers to any substance that has the effect of inhibiting APT2 activity. These substances can be small molecule compounds, peptides or antibodies, including molecules that can inhibit APT2 activity reported in the prior art, such as ML349, Palmostatin B, JCP174, etc.

[0037] "Drugs that inhibit APT2 gene expression" refers to any substance that has the effect of inhibiting APT2 gene expression, including antisense nucleic acids (ASOs), small interfering nucleic acids (siRNAs), nucleic acid aptamers, small activating nucleic acids, micronucleic acids, mRNA drugs, ribozymes, etc.

[0038] "Drugs for knocking out or knocking down the APT2 gene" are any substances that have the effect of knocking out or knocking down the APT2 gene, which can be the CRISPR / Cas9 gene editing system.

[0039] "Drugs that degrade APT2" refers to any substance that has the function of degrading APT2 protein, such as protein degraders. Protein degraders include Protac, molecular glue, etc.

[0040] The present invention adopts the method of preparing the product under the following process conditions. The method provided by the present invention has simple process, low production cost and is suitable for large-scale promotion. Experiments have shown that the product has significantly improved immune-enhancing activity and has application prospects for preparing immune-enhancing functional foods or drugs for treating immunosuppression.

[0041] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0042] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The electrophoretic diagrams of the palmitoylation level of tau protein in brain tissues of wild-type mice, 5XFAD mice, normal humans and AD patients;

[0044] Figure 2 The figure is a quantitative result of the determination of tau protein palmitoylation level in brain tissues of wild-type mice and 5XFAD mice;

[0045] Figure 3 This is a quantitative result diagram of the palmitoylation level of tau protein in brain tissues of normal people and AD patients;

[0046] Figure 4 The electrophoresis diagram shows the palmitoylation level of tau protein in brain tissues of wild-type mice and APT2 knockout mice;

[0047] Figure 5 This is the electrophoresis diagram of the palmitoylation level of tau protein in cells overexpressing the APT2 gene;

[0048] Figure 6 The figure is a quantitative result of the determination of tau protein palmitoylation level in brain tissues of wild-type mice and APT2 gene knockout mice (5XFAD-KO);

[0049] Figure 7 This is a quantitative result diagram of the palmitoylation level of tau protein in cells overexpressing the APT2 gene;

[0050] Figure 8 This is a visualization of the results of the Y-maze experiment for mice;

[0051] Fig. 9This is the result of the Y-maze experiment on mice;

[0052] Fig.10 This is a visualization of the results of the water maze experiment for mice;

[0053] Fig.11 This is the result of the water maze experiment on mice;

[0054] Fig.12 This is the electrophoresis diagram of the expression of related proteins in the brain tissue of mice after APT2 gene knockout;

[0055] Fig.13 This is a quantitative result diagram of the expression of related proteins in the brain tissue of mice after knocking out the APT2 gene;

[0056] Fig.14 This is the RT-PCR result of inflammatory factors in the brain tissue of mice after APT2 gene knockout;

[0057] Fig.15 This is a visualization of the results of the Y-maze test on mice after intraperitoneal injection of drugs;

[0058] Fig.16 This is a visualization of the results of the Y-maze test in mice after intracerebroventricular injection of drugs;

[0059] Fig.17 The electrophoresis diagram of related protein expression in mouse brain tissue after injection of ML349;

[0060] Fig.18 This is a quantitative result diagram of tau protein expression in mouse brain tissue after injection of ML349;

[0061] Fig.19 The figure is the quantitative result of the expression of other related proteins in the brain tissue of mice after injection of ML349;

[0062] Fig. 20 This is the RT-PCR result of inflammatory factors in the brain tissue of mice after injection of ML349. DETAILED DESCRIPTION

[0063] In the following examples and experimental examples, reagents and materials not particularly described are all commercially available.

[0064] The AD model animal used in the present invention is 5XFAD mouse. The following is the specific information of 5XFAD mouse:

[0065] The strain information of 5xFAD heterozygous mice is (JAX stock number 34848-JAX, B6) Cg-Tg (PSEN1*M146L*L286V) 6799Vas / Mmjax. Experimental mice and control mice were generated by crossing male 5xFAD heterozygous mice with female C57BL / 6J (Jackson Laboratory, ME). The hybrid offspring were genotyped according to the JAX protocol, and PCR reactions were performed using two pairs of primers: the mutant allele was AAG CTA GCT GCA GTA ACG CCA TTT (SEQ ID NO.1); the wild-type gene was ACC TGC ATG TGA ACC CAG TAT TCT ATC (SEQ ID NO.2); the hybrid offspring were divided into 5XFAD mice and wild-type mice according to the genotyping results. The mice were group-housed and had free access to food and water in a 12-h light / dark cycle.

[0066] Example 1 APT2 inhibitors for interventional treatment of AD

[0067] This embodiment provides a use of an APT2 inhibitor ML349 in the intervention treatment of AD.

[0068] 1. Reagents

[0069] APT2 inhibitor: ML349, stock number HY-100737, the structural formula is as follows:

[0070]

[0071] APT2 inhibitor solution: Under sterile conditions, accurately weigh and dissolve ML349 compound in DMSO to ensure a final concentration of 20 mM.

[0072] 2. APT2 inhibitors for intervention and treatment of AD

[0073] The mice were accurately weighed, and the APT2 inhibitor solution was injected intraperitoneally or intracerebroventricularly into 5XFAD mice at a dose of 5 mg / kg.

[0074] For intraperitoneal injection, the injection needle was inserted subcutaneously into the lower abdomen of the mouse and injected through the abdominal muscle at a 45-degree angle. The injection was performed once a day with one day off per week for a total of 30 days.

[0075] When injecting into the lateral ventricle, inject once every other day for 30 consecutive days.

[0076] Experimental Example 1 Relationship between APT2 and Tau protein in AD model animals

[0077] 1. Experimental Methods

[0078] 1. Determination of Tau protein palmitoylation level

[0079] Method for obtaining mouse brain tissue: euthanize the mouse, quickly remove the brain, and place it on ice. Fix the brain tissue in 4% paraformaldehyde, then dehydrate the fixed brain tissue in 30% sucrose solution until the tissue sinks to the bottom, embed the dehydrated brain tissue with OCT (optimum cutting temperature) embedding agent, and quickly freeze it in a freezing microtome until the OCT is completely solidified. Use a freezing microtome to cut the brain tissue into slices of the desired thickness.

[0080] Source of human brain tissue: All human brain tissues were obtained from the China Brain Bank Center of South-Central University for Nationalities. The negative control (NC) sample information is as follows: NC1: 81 years old, male; NC2: 76 years old, male; NC3: 80 years old, female. The AD sample information is as follows: AD1: 86 years old, male; AD2: 91 years old, female; AD3: 95 years old, female. All human brain samples comply with the scientific research ethics and technology safety review requirements of South-Central University for Nationalities (2024-scecc-046).

[0081] Cells or brain tissues were harvested and protein lysates were obtained using RIPA buffer (P0013B; Beyotime) and protease inhibitor cocktail (P1006; Beyotime) to detect the palmitoylation level of proteins.

[0082] In order to detect the palmitoylation level of Tau protein, ABE (acyl-biotinyl exchange) technology and Western Blot experiment were used. The specific operation is as follows:

[0083] The protein lysate was alkylated with 50 mM n-ethylmaleimide (NEM) at room temperature for 90 min to block free thiols. Excess NEM was removed from the sample by chloroform-methanol extraction and washed twice with methanol. Next, the sample was incubated with 2 M hydroxylamine (H3NO) for 120 min at room temperature to cleave the cys-palmitoyl thioester bond and incubated with 4 mM biotin-HPDP (CAS: 129179-83-5) to biotinylate the protein. After chloroform-methanol precipitation and two methanol washes, the biotinylated protein was affinity purified using streptavidin agarose and incubated with rotation at 4°C overnight. The bound protein was eluted with wash buffer and precipitated using methanol / chloroform precipitation. The precipitated proteins were dissolved in 50 μl Laemmli loading buffer (2.1% SDS, 66 mM Tris, 26% glycerol w / v, 50 mM DTT, pH 7.5) for SDS-PAGE analysis or dissolved in 50 μl 8 μM urea for subsequent mass spectrometry analysis.

[0084] Among them, "HA+" refers to the protein sample treated with hydroxylamine, "HA-" refers to the protein sample not treated with hydroxylamine, which serves as a negative control; "input" refers to the sample that has not been treated before the experiment, which is used as the total protein control of the experiment.

[0085] S1 and S2 are two parallel wild-type mice, and the wild-type mice are C57BL / 6J mice.

[0086] 2. Determination of the effect of APT2 on the palmitoylation level of Tau protein

[0087] (1) Construction of APT2 knockout mice (APT2-KO)

[0088] CRISPR / Cas9 technology was used to construct APT2-KO mice. Cas9 mRNA and gRNA were produced using an in vitro transcription (IVT) kit. The nucleic acid sequence of Cas9 mRNA was: CGGTGGCTGCGTCGGTGAGCAGG (SEQ ID NO.3), and the nucleic acid sequence of gRNA was: ACCGACGCAGCCACCGT GTC TGG (SEQ ID NO.4). These components were mixed and microinjected into the fertilized egg cytoplasm. The injected oocytes were cultured to the two-cell stage and then transferred into ICR cultured mice. After 20 days, F0 mice were born, genomic DNA was isolated, and genotyping was performed to verify whether the construction was successful. The nucleic acid sequence of the front primer used for genotyping was: TACCCAATGAAGGAACGGCC (SEQ ID NO.5), and the nucleic acid sequence of the rear primer was: GGGCCAACTTTCTACCC (SEQ ID NO.6).

[0089] (2) Construction of cells overexpressing APT2 (APT2-HA)

[0090] APT2-HA and Tau-Flag plasmids were co-transfected into HET-293T cells using Lip3000. The control group cells were HET-293T cells transfected with Tau-Flag plasmids.

[0091] (3) Detection of palmitoylation level of Tau protein

[0092] Follow the steps of Method 1 of this experimental example.

[0093] 2. Experimental Results

[0094] 1. Tau protein palmitoylation level in AD model animals

[0095] The experimental results are as follows Figure 1-3As shown: Compared with wild-type mice, the palmitoylation level of Tau protein in 5XFAD mice is reduced. The same result was also found in the brain tissue of AD patients, proving that Tau protein in AD model animals or AD patients is abnormally palmitoylated, and has a lower palmitoylation level of Tau protein than normal animals or humans.

[0096] 2. Effect of APT2 on Tau protein palmitoylation level

[0097] The experimental results are as follows Figure 4-7 As shown: After knocking out the APT2 gene, the palmitoylation level of Tau protein in mice increased significantly; after overexpressing the APT2 gene, the palmitoylation level of Tau protein in cells decreased significantly. This shows that APT2 can be used as a depalmitoylation modification enzyme for Tau protein, reducing the depalmitoylation level of Tau protein.

[0098] The above results show that compared with normal animals or humans, the palmitoylation level of Tau protein in AD animals or patients is lower; APT2 can be used as a depalmitoylation modification enzyme of Tau protein to reduce the depalmitoylation level of Tau protein. Therefore, APT2 can be used as a target to regulate the palmitoylation level of Tau protein.

[0099] Experimental Example 2 Effects of APT2 gene knockout on 5XFAD mice

[0100] 1. Experimental Methods

[0101] 1. Y-maze experiment

[0102] The Y-maze was used to assess short-term memory in mice. The subjects were 3-month-old wild-type mice, 5XFAD mice, and 5XFAD mice with APT2 knockout (5XFAD+APT2-KO). Spontaneous alternation is a measure of spatial working memory. The test was performed using a Y-maze with a 120° orientation and 35 cm arm length. During the test, a mouse was allowed to freely explore the arms within 8 minutes. When all four limbs of the mouse were in one arm, it was counted as an entry; alternation was defined as the behavior of the mouse entering all three arms of the Y-maze consecutively. The number of arm entries and alternations were recorded, and the percentage of alternation behavior was calculated. Behavioral data were recorded and analyzed using ethvision XT15 (Noldus Information Technology).

[0103] 2. Water maze experiment

[0104] The subjects were 12-week-old wild-type mice, 5XFAD mice, and 5XFAD+APT2-KO mice. The mice were trained for 5 days before testing. They were allowed to swim in a circular pool (120 cm in diameter and 50 cm in height) filled with water containing white pigment titanium dioxide and divided into four equal quadrants (S1, S2, S3, and S4). In the navigation test, mice were randomly placed in one of the four quadrants and allowed to find a hidden circular platform (1 cm below the water surface) within 1 min. After training, all mice stayed on the platform for 15 seconds. In the detection test, the platform was removed and all mice performed a 60-s detection test. The latency to platform, speed, and crossing platform times were recorded using a video tracking system (Noldus Information Technology Company ethvision XT15).

[0105] 3. Western Blot Experiment

[0106] Western Blot experiments were used to determine the expression of Tau protein oligomers, Tau protein monomers, NeuN, Synapsin, Iba1, and GFAP proteins in brain tissues of wild mice, 5XFAD mice, APT2-KO mice, and 5XFAD+APT2-KO mice over 8 months old. The method for obtaining mouse brain tissue was in accordance with the steps described in Experimental Example 1, Experimental Method 1. The antibodies used in the experiment are as follows:

[0107] Table 1 Antibodies used in Western Blot experiments

[0108] Antibody Article No. Company Anti-T22-antibody ABN454 Millipore Anti-NeuN-antibody ab177487 Abcam Anti-Synapsin-1-antibody A-6442 Invitrogen Anti-Iba1-antibody ab5076 Abcam Anti-GFAP-antibody ab7260 Abcam Anti-Flag-antibody AE024 Abclonal

[0109] 4. RT-PCR experiment

[0110] The RT-PCR experiment was used to detect the expression of RNA of IL-1β (interleukin 1β), IL-6 (interleukin 6) and TNF-α (tumor necrosis factor α) in the brain tissue of wild mice over 8 months old, 5XFAD mice, 5XFAD mice with ZDHHC23 gene knockout (5XFAD+ZDHHC23-KO), and 5XFAD+APT2-KO mice. The method for obtaining mouse brain tissue follows the steps described in Experimental Example 1, Experimental Method 1. The protein encoded by ZDHHC23 can activate protein-cysteine ​​S-palmitoyltransferase activity and participate in the protein palmitoylation process. The RT-PCR experimental method is as follows:

[0111] Total mRNA from mouse brain tissue was isolated using the RNeasy Plus Mini Kit (QIAGEN, Cat#74134). Then, Prime SCRIPT RT Master Mix (TAKARA, Cat#

[0112] RR036A) was used to synthesize the first strand of cDNA, and real-time PCR was performed on Roche Cobas z480 using TB Green qPCR Premix (TAKARA, Cat#RR820A). The total reaction volume of real-time PCR was 20 μL, including 2 μL (100 ng) of cDNA, 10 μL of PCR master mix, 0.8 μL (10 μM) of each primer, and 6.4 μL of RNAse-free water. The PCR program included keeping at 50°C for 2 min, then keeping at 95°C for 10 min, then denaturing at 95°C for 15 s, and annealing at 60°C for 60 s, for a total of 40 cycles.

[0113] 2. Experimental Results

[0114] 1. Effect of APT2 knockout on the learning and memory abilities of 5XFAD mice

[0115] The results of the Y-maze experiment are as follows Figure 8 , 9 As shown: Compared with wild-type mice, the number of arm entries and alternations of 5XFAD mice decreased significantly; compared with 5XFAD mice, the number of arm entries and alternations of 5XFAD+APT2-KO mice increased significantly, indicating that the short-term memory ability of AD mice with APT2 gene knockout was improved.

[0116] The results of the water maze test were as follows Fig.10 , 11 As shown: Compared with wild-type mice, the average speed and number of platform crossings of 5XFAD mice were significantly reduced, and the latency to the platform area was increased; compared with 5XFAD mice, the average speed and number of platform crossings of 5XFAD+APT2-KO mice were significantly increased, and the latency to the platform area was reduced. This shows that the learning and memory abilities of AD mice with APT2 gene knockout have been restored.

[0117] 2. Effects of APT2 knockout on related proteins in 5XFAD mice

[0118] Western Blot results Fig.12 , 13As shown: Compared with 5XFAD mice, 5XFAD+APT2-KO mice have reduced expression of Tau protein oligomers, increased expression of Synapsin, reduced expression of Iba1, and reduced expression of GFAP. Synapsin plays a key role in synaptic transmission and synaptic plasticity, Iba1 is a marker of microglia, and GFAP is specifically expressed in the cytoplasm of astrocytes in the central nervous system and is an astrocyte-specific marker. These changes in protein expression indicate that AD mice with knockout of the APT2 gene have reduced Tau protein aggregation and tangle formation, restored synaptic function, and alleviated neuroinflammation.

[0119] 3. Effects of APT2 knockout on related inflammatory factors in 5XFAD mice

[0120] The results of RT-PCR experiments are as follows Fig.14 As shown: Compared with 5XFAD mice, IL-1β, IL-6 and TNF-α levels were not reduced in 5XFAD+ZDHHC23-KO mice; IL-1β, IL-6 and TNF-α levels were significantly reduced in 5XFAD+APT2-KO mice. IL-1β, IL-6 and TNF-α are the main proinflammatory cytokines associated with neuroinflammation. The results show that palmitoylation of proteins does not reduce neuroinflammation, while neuroinflammation is alleviated in AD mice with knockout of the APT2 gene.

[0121] The above results show that compared with AD mice, the learning and memory abilities of AD mice with APT2 gene knockout have been restored, the aggregation and tangle formation of Tau protein have been reduced, the synaptic function has been restored, and neuroinflammation has been alleviated. Therefore, the APT2 gene can be used as a target for the treatment of AD.

[0122] Experimental Example 3 Effects of APT2 inhibitor on 5XFAD mice

[0123] 1. Experimental Methods

[0124] 1. Y-maze experiment

[0125] The steps of Experimental Method 1 of Experimental Example 2 were followed, except that the subjects were 3-month-old wild mice, 5XFAD mice injected intraperitoneally (IP) with DMSO (5XFAD+DMSO), 5XFAD mice injected IP with ML349 (5XFAD+ML349); 5XFAD+DMSO mice injected intracerebroventricularly (ICV), and 5XFAD+ML349 mice injected ICV.

[0126] 2. Western Blot Experiment

[0127] The steps of Experimental Method 3 of Experimental Example 2 were followed, except that the research subjects were wild mice, 5XFAD mice, IP-injected 5XFAD+DMSO mice, IP-injected 5XFAD+ML349 mice, ICV-injected 5XFAD+DMSO mice, and ICV-injected 5XFAD+ML349 mice.

[0128] 3. RT-PCR experiment

[0129] The steps of Experimental Method 4 of Experimental Example 2 were followed, except that the research subjects were wild mice, 5XFAD mice, IP-injected 5XFAD+DMSO mice, IP-injected 5XFAD+ML349 mice, ICV-injected 5XFAD+DMSO mice, and ICV-injected 5XFAD+ML349 mice.

[0130] 2. Experimental Results

[0131] 1. Effects of APT2 inhibitors on learning and memory abilities of 5XFAD mice

[0132] The results of the Y-maze test on mice injected with drugs intraperitoneally are as follows Fig.15 As shown: Compared with 5XFAD+DMSO mice, the number of arm entries and alternations in 5XFAD+ML349 mice increased and reached the level of normal mice, indicating that ML349 can improve the short-term memory ability of AD mice after intraperitoneal injection.

[0133] The results of the Y-maze test on mice injected with drugs in the lateral ventricle are as follows Fig.16 As shown, the results are similar to those of intraperitoneal injection of drugs, and the number of arm entries and alternations of 5XFAD+ML349 mice increased, indicating that ML349 can improve the short-term memory ability of AD mice regardless of whether it is injected intraperitoneally or intracerebroventricularly.

[0134] 2. Effects of APT2 inhibitors on related proteins in 5XFAD mice

[0135] Western Blot results Figure 17-19 As shown: Compared with 5XFAD mice, whether injected intraperitoneally or intracerebroventricularly, the expression of Tau oligomers in 5XFAD+ML349 mice was reduced, the expression of Synapsin was increased, and the expression of Iba1 and GFAP was reduced. These changes in protein expression levels indicate that ML349 can reduce the aggregation and entanglement of Tau proteins in AD mice, restore the synaptic function of AD mice, and alleviate neuroinflammation.

[0136] 3. Effects of APT2 inhibitors on related inflammatory factors in 5XFAD mice

[0137] The results of RT-PCR experiments are as follows Fig. 20 As shown: Compared with 5XFAD mice, 5XFAD+ML349 mice had reduced levels of IL-1β, IL-6, and TNF-α, whether injected intraperitoneally or intracerebroventricularly. Their reduction suggests that ML349 can alleviate neuroinflammation in AD mice.

[0138] The above results show that compared with AD mice, AD mice injected with ML349 have restored their memory ability, reduced Tau protein aggregation and tangles, restored synaptic function, and alleviated neuroinflammation. Therefore, ML349 is used as an inhibitor of APT2 target for the treatment of AD.

[0139] The results of the above experimental examples show that APT2 can be used as a target to regulate the palmitoylation level of Tau protein in AD animals. Compared with AD mice, AD mice with knockout APT2 gene showed improved and alleviated learning and memory ability, Tau protein aggregation and tangles, synaptic function and neuroinflammation. Therefore, the APT2 gene can be used as a target for the treatment of AD. Compared with AD mice, AD mice injected with ML349 showed improved and alleviated memory ability, Tau protein aggregation and tangles, synaptic function and neuroinflammation. Therefore, ML349, as an inhibitor of APT2 target, can be used to treat AD.

[0140] Through the above embodiments and experimental examples, it can be seen that the present invention provides a drug for intervening in the APT2 target for use in the preparation of a drug for preventing and / or treating diseases related to reduced palmitoylation modification of Tau protein. The learning and memory abilities of Alzheimer's disease model mice in which the APT2 gene was knocked out or the APT2 inhibitor was injected were improved, the tangle aggregation and neuroinflammation of Tau protein were alleviated, and the expression of proteins related to synaptic function was increased. Experiments have shown that APT2, as a potential target for the treatment of Alzheimer's disease, has a significant effect on improving the symptoms of neurodegenerative diseases, which has brought a new direction for the treatment of Alzheimer's disease and promoted the development of the treatment of other diseases related to reduced palmitoylation modification of Tau protein, with broad prospects.

Claims

1. Use of a drug for intervening in the APT2 target in the preparation of a drug for preventing and / or treating diseases related to reduced palmitoylation modification of Tau protein, characterized in that: The drug that intervenes in the APT2 target is selected from APT2 inhibitors, drugs that inhibit APT2 gene expression, drugs that knock out or knock down the APT2 gene, and drugs that degrade APT2.

2. The use according to claim 1, characterized in that: The APT2 inhibitor is selected from small molecule compounds, polypeptides, and antibodies.

3. The use according to claim 2, characterized in that: The structural formula of the APT2 inhibitor is: Wherein, R1, R6, and R7 are independently selected from O, N, and S; R2 is selected from C1-C 10 Alkyl, C1-C 10 Ether, halogen, C1-C 10 Halogenated alkyl, C1-C 10 Alkoxy; R3, R4, and R5 are independently selected from halogen, C1-C 10 Alkyl, C1-C 10 Halogenated alkyl, C1-C 10 Alkoxy; m is selected from 0, 1, 2, 3, 4, 5; n is selected from 0, 1, 2, 3, 4; k is selected from 0, 1, 2; h is selected from 0, 1, 2, 3, 4.

4. The use according to claim 3, characterized in that The compounds shown in formula I include the following compounds:

5. The use according to claim 2, characterized in that: The APT2 inhibitor is selected from ML349, Palmostatin B, and JCP174.

6. The use according to claim 1, characterized in that: The drug for inhibiting APT2 gene expression is selected from circular RNA, antisense nucleic acid, small interfering nucleic acid, nucleic acid aptamer, small activating nucleic acid, micronucleic acid, mRNA drug, ribozyme; and / or, the drug for knocking out or knocking down APT2 gene is CRISPR / Cas9 gene editing system.

7. The use according to claim 1, characterized in that: The drug for degrading APT2 includes a protein degrader.

8. The use according to claim 7, characterized in that: The drug for degrading APT2 is selected from PROTAC and molecular glue.

9. The use according to any one of claims 1 to 8, characterized in that: The diseases associated with the reduction of palmitoylation modification of Tau protein are neurodegenerative diseases.

10. The use according to claim 9, characterized in that The neurodegenerative disease is at least one of the following diseases: Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, prefrontal dementia, Lewy body dementia, multiple sclerosis, spinal muscular atrophy, Creutzfeldt-Jakob disease, and Wilson's disease.

Images