RSV molecule-based mRNA amplification process

Abstract

The invention provides an in-vitro transcription method of RSV molecules. The in-vitro transcription method comprises the following steps: controlling the proportion of each component in an in-vitro transcription process, controlling an in-vitro transcription reaction process, and purifying an IVT reaction liquid through combination of hydrophobic chromatography and tangential flow ultrafiltration. An IVT transcription system is provided, linear amplification can be achieved, operation is simple, high-yield mRNA can be obtained, the highest yield is close to 12 mg / ml, and the highest purity is close to 95%. The mRNA purification process provided by the invention can adopt a one-step hydrophobic chromatography method and is matched with a tangential flow ultrafiltration system, the final recovery rate reaches 75-90%, the final yield is 8-11 mg / ml, and the purity is greater than or equal to 90%. The mRNA provided by the invention is amplified in process, simple in flow and high in yield; a hydrophobic filler is adopted for purification, a high-cost chromatographic filler is not needed, flammable and toxic solvents are not involved, and the method can be applied to preparation of mRNA vaccines and drugs and has good economic benefits.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a method for preparing, separating and purifying mRNA of RSV molecules. Background Art

[0002] mRNA technology is to introduce mRNA containing antigen protein into the human body, directly translate it, and form corresponding proteins, thereby achieving the corresponding immune prevention or treatment effect. In the process of new crown vaccine research and development, the advantages of mRNA technology such as short research and development cycle and low production cost are fully reflected. And with the deepening of understanding, the advantages of mRNA technology in fields such as protein replacement therapy and cell therapy are gradually revealed, and its future industrial application scenarios are very diverse.

[0003] As a relatively new technology, the mRNA industry is developing rapidly in China. The in vitro transcription of mRNA in the mRNA process includes enzyme capping and co-transcriptional capping. Among them, the enzyme capping process is relatively complicated, and the co-transcriptional capping method has the advantages of simple process and high yield. The purification processes in the mRNA process are commonly used in the industry, including tangential flow filtration (TFF), reverse phase, ion, affinity chromatography and molecular sieve. Among them, reverse phase chromatography has a low load capacity and requires the introduction of toxic solvents; ion exchange, affinity chromatography and molecular sieve are widely used, but the load capacity is relatively low and the universal adaptability is not high.

[0004] Therefore, providing an efficient, stable, and high-quality mRNA preparation process has become an urgent problem to be solved. Summary of the invention

[0005] In view of the deficiencies of the prior art, the first aspect of the present invention provides an in vitro mRNA transcription system based on RSV molecules, wherein the transcription system includes the content ratio of each component in the transcription reaction and the control of the reaction process.

[0006] The second aspect of the present invention provides an mRNA purification process, wherein the purification process comprises a hydrophobic chromatography method and a tangential flow filtration combination. The mRNA industrial purification scheme provided by the present invention adopts a more economical hydrophobic filler, can obtain high-quality mRNA, is simple to operate, has a high yield, and has higher economic benefits.

[0007] The third aspect of the present invention is the use of the mRNA in vitro transcription system described in the first aspect and the mRNA purification process described in the second aspect in the preparation of mRNA vaccines and drugs.

[0008] In order to achieve the above-mentioned invention object, the following technical scheme is adopted:

[0009] An mRNA in vitro transcription (IVT) system transcribes the nucleotide sequence as shown in SEQ ID NO.1, and has an amino acid sequence with 70%, 75%, 80%, 85%, 90%, 95%, 99% identity. The optimized nucleotide sequence is transcribed as shown in SEQ ID NO.2, and has an amino acid sequence with 70%, 75%, 80%, 85%, 90%, 95%, 99% identity.

[0010] SEQ ID NO.1

[0011] ATGGAACTGCTGATTCTGAAAGCGAACGCGATTACCACCATTCTGACC

[0012] GCGGTGACCTTTTGCTTTGCGAGCGGCCAGAACATTACCGAAGAATTT

[0013] TATCAGAGCACCTGCAGCGCGGTGAGCAAAGGCTATCTGAGCGCGCT

[0014] GCGCACCGGCTGGTATACCAGCGTGATTACCATTGAACTGAGCAACAT

[0015] TAAAGAAAACAATGCAACGGCACCGATGCGAAAGTGAAACTGATTA

[0016] AACAGGAACTGGATAAATATAAAAACGCGGTGACCGAACTGCAGCTG

[0017] CTGATGCAGAGCACCCCGCCGACCAACAACCGCGCGCGCCGCGAACT

[0018] GCCGCGCTTTATGAACTATACCCTGAACAACGCGAAAAAAACCAACGT

[0019] GACCCTGAGCAAAAAACGCAAACGCCGCTTTCTGGGCTTTCTGCTGGG

[0020] CGTGGGCAGCGCGATTGCGAGCGGCGTGGCGGTGAGCAAAGTGCTGC

[0021] ATCTGGAAGGCGAAGTGAACAAAATTAAAAGCGCGCTGCTGAGCACC

[0022] AACAAAGCGGTGGTGAGCCTGAGCAACGGCGTGAGCGTGCTGACCAG

[0023] CAAAGTGCTGGATCTGAAAAACTATATTGATAAACAGCTGCTGCCGAT

[0024] TGTGAACAAACAGAGCTGCAGCATTAGCAACATTGAAACCGTGATTG

[0025] AATTTCAGCAGAAAAACAACCGCCTGCTGGAAATTACCCGCGAATTTA

[0026] GCGTGAACGCGGGCGTGACCACCCCGGTGAGCACCTATATGCTGACCA

[0027] ACAGCGAACTGCTGAGCCTGATTAACGATATGCCGATTACCAACGATC

[0028] AGAAAAAACTGATGAGCAACAACGTGCAGATTGTGCGCCAGCAGAGC

[0029] TATAGCATTATGAGCATTATTAAAGAAGAAGTGCTGGCGTATGTGGTG

[0030] CAGCTGCCGCTGTATGGCGTGATTGATACCCCGTGCTGGAAACTGCAT

[0031] ACCAGCCCGCTGTGCACCACCAACACCAAAGAAGGCAGCAACATTTG

[0032] CCTGACCCGCACCGATCGCGGCTGGTATTGCGATAACGCGGGCAGCGT

[0033] GAGCTTTTTTCCGCAGGCGGAAACCTGCAAAGTGCAGAGCAACCGCGT

[0034] GTTTTGCGATACCATGAACAGCCTGACCCTGCCGAGCGAAATTAACCT

[0035] GTGCAACGTGGATATTTTTAACCCGAAATATGATTGCAAAATTATGAC

[0036] CAGCAAAACCGATGTGAGCAGCAGCGTGATTACCAGCCTGGGCGCGA

[0037] TTGTGAGCTGCTATGGCAAAACCAAATGCACCGCGAGCAACAAAAAC

[0038] CGCGGCATTATTAAAACCTTTAGCAACGGCTGCGATTATGTGAGCAAC

[0039] AAAGGCATGGATACCGTGAGCGTGGGCAACACCCTGTATTATGTGAAC

[0040] AAACAGGAAGGCAAAAGCCTGTATGTGAAAGGCGAACCGATTATTAA

[0041] CTTTTATGATCCGCTGGTGTTTCCGAGCGATGAATTTGATGCGAGCATT

[0042] AGCCAGGTGAACGAAAAAATTAACCAGAGCCTGGCGTTTATTCGCAA

[0043] AAGCGATGAACTGCTGCATAACGTGAACGCGGGCAAAAGCACCACCA

[0044] ACATTATGATTACCACCATTATTATTGTGATTATTGTGATTCTGCTGAG

[0045] CCTGATTGCGGTGGGCCTGCTGCTGTATTGCAAAGCGCGCAGCACCCC

[0046] GGTGACCCTGAGCAAAGATCAGCTGAGCGGCATTAACAACATTGCGTTTAGCAACTGA。

[0047] SEQ ID NO.2

[0048] ATGGAACTGCTGATTCTGAAAGCGAACGCGATTACCACCATTCTGACC

[0049] GCGGTGACCTTTTGCTTTGCGAGCGGCCAGAACATTACCGAAGAATTT

[0050] TATCAGAGCACCTGCAGCGCGGTGAGCAAAGGCTATCTGAGCGCGCT

[0051] GCGCACCGGCTGGTATACCAGCGTGATTACCATTGAACTGAGCAACAT

[0052] TAAAGAAAACAAATGCAACGGCACCGATGCGAAAGTGAAACTGATTA

[0053] AACAGGAACTGGATAAATATAAAAACGCGGTGACCGAACTGCAGCTG

[0054] CTGATGCAGAGCACCCCGCCGTGCAACAACCGCGCGCGCCGCGAACT

[0055] GCCGCGCTTTATGAACTATACCCTGAACAACGCGAAAAAAACCAACGT

[0056] GACCCTGAGCAAAAAACGCAAACGCCGCTTTCTGGGCTTTCTGCTGGG

[0057] CGTGGGCAGCGCGTGCGCGAGCGGCGTGGCGGTGAGCAAAGTGCTGC

[0058] ATCTGGAAGGCGAAGTGAACAAAATTAAAAGCGCGCTGCTGAGCACC

[0059] AACAAAGCGGTGGTGAGCCTGAGCAACGGCGTGAGCGTGCTGACCAG

[0060] CAAAGTGCTGGATCTGAAAAACTATATTGATAAACAGCTGCTGCCGAT

[0061] TGTGAACAAACCGAGCTGCAGCATTAGCAACATTGAAACCGTGATTGA

[0062] ATTTCAGCAGAAAAACAACCGCCTGCTGGAAATTACCCGCGAATTTAG

[0063] CGTGAACGCGGGCGTGACCACCCCGGTGAGCACCTATATGCTGACCAA

[0064] CAGCGAACTGCTGAGCCTGATTAACGATATGCCGATTACCAACGATCA

[0065] GAAAAAACTGATGAGCAACAACGTGCAGATTGTGCGCCAGCAGAGCT

[0066] ATAGCATTATGAGCATTATTAAAGAAGAAGTGCTGGCGTATGTGGTGC

[0067] AGCTGCCGCTGTATGGCGTGATTGATACCCCGTGCTGGAAACTGCATA

[0068] CCAGCCCGCTGTGCACCACCAACACCAAAGAAGGCAGCAACATTTGC

[0069] CTGACCCGCACCGATCGCGGCTGGTATTGCGATAACGCGGGCAGCGTG

[0070] AGCTTTTTTCCGCAGGCGGAAACCTGCAAAGTGCAGAGCAACCGCGTG

[0071] TTTTGCGATACCATGAACAGCCTGACCCTGCCGAGCGAAATTAACCTG

[0072] TGCAACGTGGATATTTTTAACCCGAAATATGATTGCAAAATTATGACC

[0073] AGCAAAACCGATGTGAGCAGCAGCGTGATTACCAGCCTGGGCGCGAT

[0074] TGTGAGCTGCTATGGCAAAACCAAATGCACCGCGAGCAACAAAAACC

[0075] GCGGCATTATTAAAACCTTTAGCAACGGCTGCGATTATGTGAGCAACA

[0076] AAGGCATGGATACCGTGAGCGTGGGCAACACCCTGTATTATGTGAACA

[0077] AACAGGAAGGCAAAAGCCTGTATGTGAAAGGCGAACCGATTATTAAC

[0078] TTTTATGATCCGCTGGTGTTTCCGAGCGATGAATTTGATGCGAGCATTA

[0079] GCCAGGTGAACGAAAAAATTAACCAGAGCCTGGCGTTTATTCGCAAA

[0080] AGCGATGAACTGCTGCATAACGTGAACGCGGGCAAAAGCACCACCAA

[0081] CATTATGATTACCACCATTATTATTGTGATTATTGTGATTCTGCTGAGC

[0082] CTGATTGCGGTGGGCCTGCTGCTGTATTGCAAAGCGCGCAGCACCCCG

[0083] GTGACCCTGAGCAAAGATCAGCTGAGCGGCATTAACAACATTGCGTTTAGCAACTGA.

[0084] The transcription system includes the content ratio of each component in the transcription reaction and the control of the reaction process. The mRNA industrial transcription system provided by the present invention can obtain mRNA with high yield and low impurities.

[0085] The steps include:

[0086] 1. After mixing the injection water and 10X Transscription Buffer, add nucleotides (ATP / GTP / CTP / N1-Me-pUTP / Cap1), RNA inhibitor, inorganic pyrophosphatase, T7 enzyme and Linearized RSV in sequence and mix well. Put them into the reactor and react at 37±5℃ for 60±30min.

[0087] 2. Template DNA digestion: After the above reaction is completed, add DNase I and continue the reaction at 37±5℃ for 5-15min. After the reaction is completed, obtain the IVT reaction solution.

[0088] Furthermore, the reactor in step 1 includes a stirred reactor and a wave reactor.

[0089] Preferably, the reactor in step 1 is a wave type reactor.

[0090] Further, in step 1, 10X Transscription Buffer includes 400-500mM PH 6-8 Tris-Hcl, 400-500Mm Mg(CH3COO)2 or 400-500Mm MgCl2, 10-30mM spermidine, and 50-150mM DTT.

[0091] Preferably, in step 1, 10X Transscription Buffer comprises 400-500mM PH 6-8 Tris-Hcl, 400-500Mm Mg(CH3COO)2, 10-30mM spermidine, and 50-150mM DTT.

[0092] Furthermore, in step 1, the working concentration of the T7 enzyme is 5-12.5 KU / ml.

[0093] Preferably, in step 1, the working concentration of T7 enzyme is 7.5-10 KU / ml.

[0094] Furthermore, in step 1, the working concentration of inorganic pyrophosphatase is 1-3 U / ml

[0095] Furthermore, in step 1, the working concentration of RNA inhibitor is 0.5-2 KU / ml

[0096] Furthermore, in step 1, the working concentrations of ATP, GTP, CTP, and N1-Me-pUTP are 4-12.5 mM, and the working concentration of Cap1 is 2-12.5 mM.

[0097] Preferably, in step 1, the working concentrations of ATP, GTP, CTP, and N1-Me-pUTP are 7.5-10 mM, and the working concentration of Cap1 is 5-10 mM.

[0098] Furthermore, in step 2, the final concentration of DNase I is 50-300 U / ml.

[0099] Continue the reaction at 37±5°C for 5-15 min. After the reaction is completed, obtain the IVT reaction solution.

[0100] The purification process of the above IVT reaction liquid.

[0101] Furthermore, the purification process includes hydrophobic chromatography, tangential flow filtration system (TFF), or one or more of the above purification processes. Through the above purification process, dsRNA, protein, small molecules, incomplete mRNA and secondary structure impurities in the mRNA stock solution can be effectively removed to obtain high-quality mRNA. It includes the following steps:

[0102] 1. After pre-treatment, the mRNA IVT reaction solution is loaded onto a hydrophobic chromatography column equilibrated with a hydrophobic chromatography equilibration solution, and eluted with a chromatography cleaning solution to obtain a hydrophobic chromatography collection solution;

[0103] 2. The hydrophobic chromatography collection liquid obtained in step 1 is subjected to tangential flow filtration, desalting and concentration to obtain an ultrafiltration collection liquid.

[0104] 3. The ultrafiltration collection liquid obtained in step 2 is sterilized and filtered to obtain the mRNA stock solution. Furthermore, the ligand of the hydrophobic chromatography medium in step 1 includes any one of butyl, phenyl, and octyl;

[0105] Preferably, the ligand of the hydrophobic chromatography medium in step 1 is butyl or phenyl;

[0106] Preferably, the hydrophobic chromatography column in step 1 is equilibrated with 1-10 column volumes of equilibration buffer;

[0107] Furthermore, the hydrophobic chromatography equilibrium solution in step 1 includes 12-36 mM NaH2PO4, 8-25 mM Na2HPO4, and 1-2.0 M KCl / NaCl / (NH4)2SO4;

[0108] Further, the loading adjustment solution in step 1 includes 24-72mM NaH2PO4, 16-50mM NaH2PO4, 2-4.0M KCl / NaCl / (NH4)2SO4;

[0109] Furthermore, the pretreatment of the affinity chromatography collection solution or the IVT reaction solution in step 1 includes mixing the affinity chromatography collection solution or the IVT reaction solution with 0-0.5M EDTA, a hydrophobic chromatography balancing solution, and a sample adjustment solution, and then balancing;

[0110] Preferably, the pretreatment of the affinity chromatography collection solution in step 1 comprises mixing the IVT reaction solution with 1%-5% 0.5M EDTA, 10-60% loading adjustment solution, and 0-80% hydrophobic chromatography equilibrium solution, and equilibrating at (4-25° C.) for 0.5-24 hours;

[0111] Furthermore, in step 1, the chromatography cleaning solution includes 12-36 mM NaH2PO4, 8-25 mM NaH2PO4, or water for injection.

[0112] Preferably, the chromatography cleaning fluid in step 1 is injection water.

[0113] Furthermore, in step 1, the elution with a chromatography cleaning fluid includes a first chromatography cleaning fluid, a hydrophobic chromatography equilibrium fluid; a second chromatography cleaning fluid, a chromatography cleaning fluid; and obtaining a chromatography collection fluid.

[0114] Preferably, the elution with a chromatography cleaning solution in step 1 comprises running a hydrophobic chromatography eluent (0%) and a hydrophobic chromatography equilibrium solution (100%) with 2-10 column volumes until the hydrophobic chromatography eluent (100%) and the hydrophobic chromatography equilibrium solution (0%) are reached, and then elution is started with a hydrophobic chromatography cleaning solution; a chromatography collection solution is obtained.

[0115] Further, in step 2, the stirring bag containing the chromatography collection liquid is connected to the system, the TFF replacement liquid is connected to the stirring bag, the chromatography and TFF concentration stirring bag is connected to the inlet end and the reflux end, the through end is connected to the waste liquid bucket, the main pump is turned on, and the flow rate is set to 80-240mL / min. When the sample volume in the stirring bag is less than the original volume, the fluid is replenished, and the operation is repeated. During the period, the conductivity of the through end is monitored, and when the conductivity is less than 50μS / cm, the injection water is stopped. The above sample is concentrated and concentrated to the sample volume in the stirring bag to the set volume, and the system is stopped.

[0116] Furthermore, the collected solution is sterilized and filtered to finally obtain the mRNA stock solution. The mRNA purification according to the above method can achieve a yield of 75%-90%.

[0117] The present invention provides an IVT transcription system that can be linearly amplified, is simple to operate, and can obtain high-yield mRNA, with a maximum yield of nearly 12 mg / ml and a purity of nearly 95%. The mRNA purification process provided in the present invention can adopt a one-step hydrophobic chromatography method in conjunction with a tangential flow ultrafiltration system, with a final recovery rate of 75%-90%, a final yield of 8-11 mg / ml, and a purity of ≥90%. It shows that the mRNA amplification process provided by the present invention has high yield and high quality, and can be applied to the preparation of mRNA vaccines and drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0118] Figure 1 a. Hydrophobic filler chromatography of IVT reaction solution of RSV sequence 1;

[0119] Figure 1 b. Hydrophobic filler chromatography of IVT reaction solution of RSV sequence 2;

[0120] Figure 2 a. Capping rate of RSV sequence 1 mRNA stock solution;

[0121] Figure 2 b. Capping rate of RSV sequence 2 mRNA stock solution;

[0122] Figure 3 a. CE purity of RSV sequence 1 mRNA stock solution;

[0123] Figure 3 b. CE purity of RSV sequence 2 mRNA stock solution;

[0124] Figure 4 a. SEC purity of RSV sequence 1 mRNA stock solution;

[0125] Figure 4 b. SEC purity of RSV sequence 2 mRNA stock solution;

[0126] Figure 5 a. RP purity of RSV sequence 1 mRNA stock solution;

[0127] Figure 5 b. RP purity of RSV sequence 2 mRNA stock solution;

[0128] Figure 6 .Summary of the mRNA quality of RSV sequence 1 and RSV sequence 2. DETAILED DESCRIPTION

[0129] The specific implementation of the present invention is described in detail below in conjunction with the accompanying drawings. It should be understood that the specific implementation described here is only used to illustrate and explain the present invention, and is not used to limit the present invention.

[0130] Example 1 mRNA amplification process of RSV molecule SEQ ID NO.1 sequence

[0131] This embodiment provides an mRNA amplification process based on the RSV molecule SEQ ID NO.1 sequence, and the specific process amplification process includes the control of the content ratio of the in vitro transcription components and the reaction process, as well as the purification process of the IVT reaction solution. It includes the following steps:

[0132] 1) After the injection water and Transcription Buffer are mixed, nucleotides (ATP / GTP / CTP / N1-Me-pUTP / Cap1), RNA inhibitor, inorganic pyrophosphatase, T7 enzyme and Linearized RSV template molecule (sequence as shown in SEQ ID NO.1) are added in sequence and mixed, and then put into the wave reactor and reacted at 37°C for 75 minutes.

[0133] The transcription buffer comprises 500 mM PH 7.5 Tris-HCL, 400 mM Mg(CH3COO)2, 20 mM spermidine, and 100 mM DTT.

[0134] In step 1, the working concentration of T7 enzyme is 10KU / ml, the working concentration of inorganic pyrophosphatase is 2U / ml, and the working concentration of RNA inhibitor is 1KU / ml

[0135] In step 1, the working concentrations of GTP, CTP and Cap1 are 7.5 mM, and the working concentrations of ATP and N1-Me-pUTP are 8.5 mM.

[0136] 2) Template DNA digestion: After the above reaction is completed, add DNase I with a final concentration of 200U / ml, and continue the reaction at 37℃ for 12min. After the reaction is completed, obtain IVT reaction solution. The yield is 10.7mg / ml.

[0137] 3) pre-treating the above IVT reaction solution, loading it onto a hydrophobic chromatography column equilibrated with a hydrophobic chromatography equilibrator, and eluting it with a chromatography cleaning solution to obtain a hydrophobic chromatography collection solution;

[0138] The ligand of the hydrophobic chromatography medium in step 3) is phenyl;

[0139] The pretreatment of the affinity chromatography collection solution in step 3) comprises mixing the IVT reaction solution with 5% 0.5M EDTA, 55% loading adjustment solution, and 0% hydrophobic chromatography equilibrium solution, and equilibrating at 4° C. for 24 hours;

[0140] The hydrophobic chromatography column in step 3 is equilibrated with 2 column volumes of equilibration buffer; the hydrophobic chromatography equilibration solution comprises 15 mM NaH2PO4, 20 mM Na2HPO4, and 2 M KCl;

[0141] The loading adjustment solution in step 3) comprises 30 mM NaH2PO4, 40 mM Na2HPO4, and 4 M KCl;

[0142] In the step 3), the chromatography cleaning fluid is injection water

[0143] The elution with chromatography cleaning fluid in step 3) comprises running the hydrophobic chromatography eluent (0%) and the hydrophobic chromatography equilibrium fluid (100%) with 4 column volumes until the hydrophobic chromatography eluent (100%) and the hydrophobic chromatography equilibrium fluid (0%) are reached, and then elution is started with water for injection; and a chromatography collection fluid is obtained.

[0144] 4) Connect the stirring bag containing the chromatography collection liquid in step 3) to the system, connect the TFF replacement liquid to the stirring bag, connect the chromatography and TFF concentration stirring bag to the inlet and reflux ends, connect the permeate end to the waste liquid bucket, turn on the main pump, set the flow rate to 80mL / min, and when the sample volume in the stirring bag is less than the original volume, perform the liquid replenishment, repeat the operation, monitor the conductivity of the permeate end during the period, and stop adding injection water when the conductivity is less than 50μS / cm. Concentrate the above samples until the sample volume in the stirring bag reaches the set volume, and stop the system.

[0145] 5) The ultrafiltration collection solution obtained in step 4 was sterilized and filtered to obtain mRNA stock solution. The final purification yield was 88.5%.

[0146] Figure 1 a is the chromatogram of the hydrophobic filler used in Example 1, showing effective separation of mRNA; Figure 2 a is the detection of the capping rate of the mRNA stock solution in Example 1, Figure 3 a is the CE purity of mRNA stock solution, which far exceeds the existing quality standards; Figure 4 a is the SEC-HPLC purity of mRNA stock solution, Figure 5 a is the original RP-HPLC purity of mRNA, which is higher than the existing quality standard.

[0147] Example 2 mRNA Amplification Process of RSV Molecular SEQ ID NO.2

[0148] This embodiment provides an mRNA amplification process based on the RSV molecule SEQ ID NO.2 sequence, and the specific process amplification process includes the control of the content ratio of the in vitro transcription components and the reaction process and the purification process of the IVT reaction solution. It includes the following steps:

[0149] 1) After the injection water and Transcription Buffer are mixed, nucleotides (ATP / GTP / CTP / N1-Me-pUTP / Cap1), RNA inhibitor, inorganic pyrophosphatase, T7 enzyme and Linearized RSV template molecule (sequence as shown in SEQ ID NO.2) are added in sequence and mixed, and then put into the wave reactor and reacted at 37°C for 85 minutes.

[0150] The transcription buffer comprises 500 mM PH 7.5 Tris-HCL, 400 mM Mg(CH3COO)2, 20 mM spermidine, and 100 mM DTT.

[0151] In step 1, the working concentration of T7 enzyme is 10KU / ml, the working concentration of inorganic pyrophosphatase is 2U / ml, and the working concentration of RNA inhibitor is 1KU / ml

[0152] In step 1, the working concentrations of GTP, CTP, ATP, N1-Me-pUTP and Cap1 are 7.5 mM.

[0153] 2) Template DNA digestion: After the above reaction is completed, add DNase I with a final concentration of 200U / ml, and continue the reaction at 37℃ for 15min. After the reaction is completed, obtain the IVT reaction solution. The yield is 12.1mg / ml.

[0154] 3) pre-treating the above IVT reaction solution, loading it onto a hydrophobic chromatography column equilibrated with a hydrophobic chromatography equilibrator, and eluting it with a chromatography cleaning solution to obtain a hydrophobic chromatography collection solution;

[0155] The ligand of the hydrophobic chromatography medium in step 3 is phenyl;

[0156] The pretreatment of the affinity chromatography collection solution in step 3 comprises mixing the IVT reaction solution with 1% 0.5M EDTA, 11% loading adjustment solution, and 78% hydrophobic chromatography equilibrium solution, and equilibrating at 4° C. for 24 hours;

[0157] The hydrophobic chromatography column in step 3 is balanced with 2 column volumes of a balance buffer; the hydrophobic chromatography balance solution comprises 15 mM NaH2PO4, 20 mM Na2HPO4, and 4 M (NH4)2SO4;

[0158] The loading adjustment solution in step 3 comprises 30 mM NaH2PO4, 40 mM Na2HPO4, and 8 M (NH4)2SO4;

[0159] In step 3, the chromatography cleaning fluid is injection water.

[0160] The elution with chromatography cleaning fluid in step 3 comprises running the hydrophobic chromatography eluent (0%) and the hydrophobic chromatography equilibrium fluid (100%) to the hydrophobic chromatography eluent (100%) and the hydrophobic chromatography equilibrium fluid (0%) using 5 column volumes, and then starting elution with water for injection; obtaining the chromatography collection fluid.

[0161] 4) Connect the stirring bag containing the chromatography collection liquid in step 3 to the system, connect the TFF replacement liquid to the stirring bag, connect the chromatography and TFF concentration stirring bag to the inlet and reflux ends, connect the permeate end to the waste liquid bucket, turn on the main pump, set the flow rate to 120mL / min, and replenish the liquid when the sample volume in the stirring bag is less than the original volume. Repeat the operation, monitor the conductivity of the permeate end during the process, and stop adding water for injection when the conductivity is less than 50μS / cm. Concentrate the above samples until the sample volume in the stirring bag reaches the set volume, and stop the system.

[0162] 5) The ultrafiltration collection liquid obtained in step 4 is subjected to sterile filtration treatment to obtain an mRNA stock solution.

[0163] The final purification yield was 89.1%.

[0164] The present invention illustrates the process method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned process steps, that is, it does not mean that the present invention must rely on the above-mentioned process steps to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of the raw materials selected by the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. An in vitro transcription method for RSV molecules, characterized in that, The steps include: 1) After mixing the injection water and 10X Transcription Buffer, ATP, GTP, CTP, N1-Me-pUTP, Cap1 nucleotide, RNA inhibitor, inorganic pyrophosphatase, T7 enzyme and Linearized RSV molecule are added in sequence and mixed; wherein the sequence of the RSV molecule is a nucleotide sequence having 70%-100% identity with SEQ ID NO.1 or a nucleotide sequence having 70%-100% identity with SEQ ID NO.2; 2) Put it into the reactor and react at 37±5℃ for 60±30min; 3) Template DNA digestion: After the above reaction is completed, add DNase I and continue the reaction at 37±5℃ for 5-15 minutes. After the reaction is completed, obtain the IVT reaction solution; 4) Purifying the IVT reaction solution to obtain the mRNA stock solution of the RSV molecule.

2. The in vitro transcription method according to claim 1, characterized in that The 10XTranscription Buffer includes 400-500 mM pH 6-8 Tris-HCl, 400-500 Mm Mg(CH3COO)2 or 400-500 Mm MgCl2, 10-30 mM spermidine, and 50-150 mM DTT.

3. The in vitro transcription method according to claim 1, characterized in that The working concentration of the T7 enzyme is 5-12.5 KU / ml, the working concentration of inorganic pyrophosphatase is 1-3 U / ml, the working concentration of RNA inhibitor is 0.5-2 KU / ml, the working concentration of ATP, GTP, CTP, N1-Me-pUTP is 4-12.5 mM, and the working concentration of Cap1 is 2-12.5 mM.

4. The in vitro transcription method according to claim 1, characterized in that The final concentration of DNase I is 50-300 U / ml.

5. The in vitro transcription method according to claim 1, characterized in that The 10XTranscription Buffer includes 500mM pH 7.5 Tris-HCL, 400mM Mg(CH3COO)2, 20mM spermidine, 100mM DTT, the working concentration of the T7 enzyme is 10KU / ml, the working concentration of the inorganic pyrophosphatase is 2U / ml, the working concentration of the RNA inhibitor is 1KU / ml, the working concentration of the GTP, CTP, Cap1 is 7.5mM, the working concentration of the ATP, N1-Me-pUTP is 8.5mM, and the sequence of the RSV molecule is shown in SEQ ID NO.1; or, the Transcription Buffer includes 500mM pH 7.5 Tris-HCL, 400mM Mg(CH3COO)2, 20mM spermidine, 100mM DTT, the working concentration of the T7 enzyme is 10KU / ml, the working concentration of inorganic pyrophosphatase is 2U / ml, the working concentration of the RNA inhibitor is 1KU / ml, the working concentration of the GTP, CTP, ATP, N1-Me-pUTP, and Cap1 is 7.5mM, and the sequence of the RSV molecule is shown in SEQ ID NO.

2.

6. The in vitro transcription method according to any one of claims 1 to 5, characterized in that: The purification process includes hydrophobic chromatography and tangential flow filtration.

7. The in vitro transcription method according to claim 6, characterized in that The method also includes pre-treating the IVT reaction solution before the hydrophobic chromatography.

8. The in vitro transcription method according to claim 7, characterized in that The ligand of the medium used in the hydrophobic chromatography is butyl or phenyl.

9. The in vitro transcription method according to claim 8, characterized in that The chromatography cleaning liquid used in the hydrophobic chromatography is injection water.

10. The in vitro transcription method according to claim 1, characterized in that The reactor includes a stirred reactor or a wave reactor.

Images