Method for identifying Russian wild ginseng

Abstract

The invention relates to a method for identifying Russian wild ginseng, which comprises the following steps: screening a plurality of SNP (Single Nucleotide Polymorphism) loci of the Russian wild ginseng, taking a sequence fragment of a chromosome where the SNP loci are located as a target gene fragment, and designing a plurality of primers according to the target gene fragment; carrying out PCR (Polymerase Chain Reaction) amplification on the target gene segment by utilizing a primer, carrying out sequencing analysis on an amplification product, and verifying whether an SNP (Single Nucleotide Polymorphism) site exists or not; sNP specific site primer design is carried out on the gene segment which verifies that the SNP site exists, and the SNP specific site primer design method comprises the following steps that SNP site bases are placed at the tail from the 5'end to the 3 'end of a primer; the penultimate site or the third site at the tail part of the 3'end of the primer is replaced by a mismatched basic group, so that the target gene segment of the Russian wild ginseng sample to be identified generates two-basic-group mismatch by the primer, a specific band cannot be generated after amplification, and the identification of the Russian wild ginseng sample to be identified is realized.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a method for identifying Russian wild ginseng. Background Art

[0002] Ginseng (Panax ginseng CAMey.) is a plant of the genus Panax in the Araliaceae family. According to the Chinese Pharmacopoeia, ginseng is sweet, slightly bitter, and slightly warm. It enters the spleen, lung, heart, and kidney meridians. It has the effects of greatly replenishing vital energy, restoring the pulse and strengthening the body, and tonifying the spleen and lungs. The main active ingredients are ginsenoside Rg1, ginsenoside Re, and ginsenoside Rb1.

[0003] Ginseng has anti-cancer, anti-fatigue, and immunity-enhancing effects as medicine. Ginseng can also be added to poultry and livestock feed to help improve animal immunity and has broad market development prospects.

[0004] At present, the wild ginseng resources are on the verge of depletion, and most of the ginseng used as medicine is cultivated. Due to natural evolution and artificial cultivation, different cultivated varieties have been formed, such as big horse teeth, two horse teeth, red fruit ginseng, yellow fruit ginseng, etc. And through artificial selection, a number of approved varieties that meet national standards have been successfully cultivated, such as Jishen No. 1, Kangmei No. 1, Zhongda Linxia Ginseng, etc.

[0005] Differences in cultivation conditions affect the quality of ginseng, which further leads to uneven quality of ginseng on the market. It is necessary to evaluate and preserve ginseng germplasm resources, and develop methods for breeding and rapid identification of excellent ginseng varieties. Currently, the identification of ginseng germplasm resources has developed from traditional methods to molecular technology identification. Single nucleotide polymorphism molecular marker technology (SNP) has the advantages of stable genetic loci and rapid detection, and is suitable for research in genetic diversity analysis, germplasm resource identification, and kinship identification.

[0006] There are two main methods for ginseng identification: Chloroplast whole genome analysis: Chloroplast genetic information is maternally inherited, and its genome is relatively stable and conservative. It consists of a large single copy region (LSC), a small single copy region (SSC) and two inverted repeat regions (IRa; IRb) to form a typical tetrad structure, which is easy to sequence, assemble and splice. Local mutations, insertions, and transversions in the chloroplast genome can provide a theoretical basis for the study of molecular identification and genetic development of closely related plants, and improve the resolution of inter-species systematic evolution at low taxonomic levels. DNA barcoding technology: DNA barcoding is a molecular biological technology that uses recognized, relatively short DNA fragments for species identification. It has the advantages of small intraspecific variation, large enough interspecific variation, easy amplification, and relatively conservative ends for easy primer design. At present, ITS / ITS2 in the ribosomal genome and matK and rbcL sequences in the chloroplast genome are used as the core sequences for plant DNA barcode molecular identification. By comparing a section or extreme DNA barcode to the "most similar" sequence of known species, unknown samples can be identified and distinguished.

[0007] Traditional marker methods can only provide limited information on mutations, have low sensitivity, poor interspecies compatibility, or conflict due to different evolutionary rates caused by different pressures between selection markers. The study of the genetic characteristics of the research population is not comprehensive and objective, and the identification at the variety level is not accurate enough. SNP: single nucleotide polymorphism, that is, DNA sequence polymorphism caused by the variation of a single nucleotide site. Population-specific SNP: A site with completely identical base sequences at this site within a population, but more than 80% of the base sequences are different from those of individuals outside the population. There is currently no existing technology for identifying Russian wild ginseng using SNP. Summary of the invention

[0008] The purpose of the present invention is to provide a method for identifying Russian wild ginseng.

[0009] In order to achieve the above purpose, the technical solution adopted by the present invention is:

[0010] A method for identifying Russian wild ginseng, comprising the following steps:

[0011] 1) Screening multiple SNP sites of Russian wild ginseng, the sequence fragment of the chromosome where the SNP site is located is the target gene fragment, and designing multiple primers according to the target gene fragment;

[0012] 2) using the primers in step 1) to perform PCR amplification on the target gene fragment in step 1), and sequencing and analyzing the amplified product to verify whether the SNP site exists;

[0013] 3) For gene fragments that have been verified to have SNP sites, SNP-specific site primers are designed. The SNP-specific site primer design method is as follows: the SNP site base is placed at the end of the primer from the 5' end to the 3' end; the penultimate or third site at the 3' end of the primer is replaced with a mismatched base, resulting in a two-base mismatch in the primer for the target gene fragment of the Russian wild ginseng sample to be identified, and no specific bands can be generated after amplification, thereby achieving the identification of the Russian wild ginseng sample to be identified.

[0014] Further, the target gene fragments in step 1) include scaffold106-123324, scaffold1696-28255, scaffold5738-13895, scaffold6230-16617, scaffold8114-63630, scaffold12689-74110, scaffold13396-40523, scaffold27211-50459, scaffold caffold29078-25601, scaffold33094-17553, scaffold37790-3693, scaffold11704-227, scaffold146 90-59975, scaffold35529-12090, scaffold4010-47561, scaffold22750-27703, scaffold22169-22594.

[0015] Further, 20 pairs of primers were designed based on the sequences of scaffold106-123324, scaffold1696-28255, scaffold5738-13895, scaffold6230-16617, scaffold8114-63630, scaffold12689-74110, scaffold13396-40523, scaffold27211-50459, scaffold29078-25601, scaffold33094-17553, and scaffold37790-3693, and the sequences of the 20 pairs of primers are shown in SEQ ID No: 1-SEQ ID No: 40; 4 pairs of primers were designed based on the sequence of scaffold11704-227, and the sequences of the 4 pairs of primers are shown in SEQ ID No: 41-SEQ ID No: 48; 10 pairs of primers were designed based on the sequences of scaffold14690-59975, scaffold35529-12090, scaffold4010-47561, scaffold22750-27703, and scaffold22169-22594, and the sequences of the 10 pairs of primers are shown in SEQ ID No: 49-SEQ ID No: 68.

[0016] Furthermore, when designing SNP-specific site primers in step 3), the Tm value of the primers is not less than 54, the length is 20±2 bp, and the size of the PCR amplification product is in the range of 200 to 300 bp.

[0017] Furthermore, when screening multiple SNP sites of Russian wild ginseng in step 1), the Russian wild ginseng DNA is first extracted and an electronic enzyme cutting prediction test is performed. Then, the Russian wild ginseng genomic DNA is recognized and cut with a restriction endonuclease, and bases are added to the 3' end of DNA fragments of different lengths obtained by enzyme cutting. Then, this fragment is connected to a sequencing adapter, PCR amplification is performed, and the target fragment is recovered by gel electrophoresis. SLAF sequencing is performed using the Illumina platform, and the population SNP sites are obtained by collating and analyzing the sequencing data.

[0018] Furthermore, the reaction system for PCR amplification of the target gene fragment in step 2) is: 2×TaqPCRMasterMix 10 μL, upstream primer 1 μL, downstream primer 1 μL, template DNA 1 μL, dd H2O 7 μL, a total of 20 μL, the concentration of the upstream primer is 10 μM, and the concentration of the downstream primer is 10 μM.

[0019] Furthermore, the reaction procedure for PCR amplification of the target gene fragment in step 2) is: pre-denaturation: 94°C, 4 min; denaturation: 94°C, 30 s; annealing: 58°C, 30 s; extension: 72°C, 30 s, a total of 35 cycles, and continued extension: 72°C, 7 min.

[0020] Furthermore, the method for sequencing and analyzing the amplified products in step 2) is: using SeqMan software to splice the sequencing result sequences, then using BioEdit software to correct the spliced ​​sequences, using Chromas software to check the sequencing quality and results, and using Multalin online software to compare and analyze the sequencing results.

[0021] Furthermore, in step 3), the reaction system for SNP-specific site primer PCR verification of the SNP site is: 10 μL 2×TaqPCR Master Mix, 1 μL forward primer, 1 μL reverse primer, 1 μL Russian wild ginseng template DNA, 7 μL dd H2O, a total of 20 μL, the concentration of the forward primer is 10 μM, and the concentration of the reverse primer is 10 μM.

[0022] Furthermore, in step 3), the reaction procedure of SNP-specific site primer PCR to verify the SNP site is: pre-denaturation: 94°C, 4 min; denaturation: 94°C, 30 s; annealing: 58°C, 30 s; extension: 72°C, 30 s, a total of 35 cycles, and continued extension: 72°C, 7 min, 4°C, ∞.

[0023] Beneficial effects of the present invention:

[0024] The method for identifying Russian wild ginseng of the present invention adopts SNP molecular markers, which have the advantages of high density, high throughput, co-dominant inheritance, etc. The identification result is accurate, fast and highly sensitive. As shown in the phylogenetic tree, Russian wild ginseng K1-K7 form independent branches in the phylogenetic tree, and 0.1 ng of American ginseng impurities mixed into Russian wild ginseng can be detected, a small amount of DNA is required, and false positives can be avoided. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the electrophoresis diagram of the genome of Russian wild ginseng samples; bands 1-7 are the DNA bands of KTZ-01-Russian wild ginseng, KTZ-02-Yumu ginseng, KTZ-07-Fusong ginseng, KTZ-04-yellow fruit ginseng, KTZ-05-orange fruit ginseng, KTZ-06-pink fruit ginseng, and KTZ-03-Korean ginseng.

[0026] Figure 2The electrophoresis diagram of the PCR products of 10 pairs of primers KTZ-04 to KTZ-06; wherein bands 1-10 are the PCR product bands of the primers No. 49-68 in Table 1, respectively;

[0027] Figure 3 The electrophoresis diagram of the PCR products of four pairs of primers of KTZ-01; wherein bands 1-4 are the PCR product bands of the primers No. 41-48 in Table 1, respectively;

[0028] Figure 4 The figure is the electrophoresis diagram of PCR products of 20 pairs of primers of KTZ-02; wherein bands 1-20 are the PCR product bands of primers No. 1-40 in Table 1, respectively;

[0029] Figure 5 It is the specific PCR electrophoresis diagram of SER / F; among them, bands 1-7 are the DNA bands of KTZ-01-Russian wild ginseng, KTZ-02-Yumu ginseng, KTZ-07-Fusong ginseng, KTZ-04-yellow fruit ginseng, KTZ-05-orange fruit ginseng, KTZ-06-pink fruit ginseng, and KTZ-03-Korean ginseng.

[0030] Figure 6 It is the specific PCR electrophoresis diagram of SYR / F; among them, bands 1-7 are the DNA bands of KTZ-02-Yumu ginseng, KTZ-011-Russian wild ginseng, KTZ-07-Fusong ginseng, KTZ-04-yellow fruit ginseng, KTZ-05-orange fruit ginseng, KTZ-06-pink fruit ginseng, and KTZ-033-Korean ginseng.

[0031] Figure 7 This is the peak diagram of the sequencing of the PCR product of E-3F / R in KTZ-01;

[0032] Figure 8 This is the sequencing peak diagram of the PCR product of E-3F / R in the KTZ-01 control sample;

[0033] Fig. 9 This is the sequencing peak diagram of the PCR product of M-11F / R in KTZ-02;

[0034] Fig.10 This is the sequencing peak diagram of the PCR product of M-11F / R in the KTZ-02 control sample;

[0035] Fig.11 is the fluorescence quantitative PCR amplification curve of SEF / R;

[0036] Fig.12 is the fluorescence quantitative PCR amplification curve of SYF / R;

[0037] Fig.13The results of the analysis of impurities of American ginseng and Panax notoginseng in ginseng;

[0038] Fig.14 The results of SEF / R specific amplification; bands 1-7 are the amplified bands of SEF / R in KTZ-01, KTZ-02, KTZ-07, KTZ-04, KTZ-05, KTZ-06, and KTZ-03, respectively;

[0039] Fig.15 The results of SYF / R specific amplification are shown in Figure 1. Bands 1 to 7 are the amplified bands of SEF / R in KTZ-02, KTZ-01, KTZ-07, KTZ-04, KTZ-05, KTZ-06, and KTZ-03, respectively.

[0040] Fig.16 For the phylogenetic tree. DETAILED DESCRIPTION

[0041] The present invention will be further described below in conjunction with the embodiments of the present invention and the accompanying drawings.

[0042] Example 1

[0043] The method for identifying Russian wild ginseng in this embodiment comprises the following steps:

[0044] 1. DNA extraction from wild ginseng in Russia:

[0045] (1) Take 40 mg of dry weight tissue or 200 mg of fresh tissue and grind it into powder in liquid nitrogen quickly. Add 700 μL of CTAB (Cetyl Trimethyl Ammonium Brmide) extraction buffer (2%) and keep it at 65°C for 30 min. Gently turn it over 2-3 times during the process.

[0046] (2) Cool at room temperature for 10 min, add 700 μL of phenol-chloroform-isoamyl alcohol (volume ratio of 25:24:1), gently invert to mix, let stand at room temperature for 10 min, and centrifuge at 10,000 rpm for 10 min;

[0047] (3) Transfer the supernatant to another centrifuge tube, add 700 μL of chloroform-isoamyl alcohol (volume ratio of 24:1), gently invert to mix, let stand at room temperature for 10 min, and centrifuge at 10,000 rpm for 10 min;

[0048] (4) Carefully aspirate the supernatant, add an equal volume of cold isopropanol to the supernatant, mix gently until DNA flocs are visible, let stand at room temperature for 15 min, centrifuge at 10,000 rpm for 10 min, and discard the supernatant;

[0049] (5) Wash the DNA precipitate twice with 700 μL 70% ethanol, dry slightly at room temperature, and dissolve with sterile water;

[0050] (6) Add RNase (ribonuclease) at a final concentration of 50 μg / mL and incubate at 37°C for 1 h;

[0051] (7) Extract twice with equal volumes of chloroform-isoamyl alcohol (volume ratio 24:1);

[0052] (8) Take the supernatant, add 2 times the volume of 70% ethanol, leave at room temperature for 1 h, centrifuge at 12000 rpm for 10 min, and discard the supernatant;

[0053] (9) Wash the precipitate twice with 500 μL of 70% ethanol. After discarding the washing solution, invert the centrifuge tube on a paper towel and dry the DNA at room temperature.

[0054] (10) Add 100 μL ddH2O to dissolve the DNA and set aside.

[0055] 2. Construction of SLAF library:

[0056] Using the genome of Russian wild ginseng as the reference genome, and using information such as the size and GC content of the Russian wild ginseng genome, an electronic enzyme digestion prediction test of Russian wild ginseng was conducted. Restriction endonucleases were used to recognize and cut the genomic DNA of Russian wild ginseng, and bases were added to the 3' end of DNA fragments of different lengths obtained by enzyme digestion. The fragments were then connected to sequencing adapters, and PCR amplification and electrophoresis gel cutting were performed to recover the target fragments. SLAF sequencing was performed using the Illumina platform. In order to calibrate the accuracy of the test, Nipponbare (rice) was set as a control.

[0057] 3. Discovery of SNP-specific sites:

[0058] By collating and analyzing the sequencing data, the population SNP sites are obtained based on the population structure and genetic evolution analysis.

[0059] 4. Design primers:

[0060] Primers were designed according to the sequence fragment of the chromosome where the SNP site was located in the sequencing data. The sequence fragment of the chromosome where the SNP site was located was the target gene fragment. 34 pairs of universal primers were designed in the conserved region of the nuclear genome by PrimerPremier 5.0 software. 20 pairs of KTZ-02 primers were designed according to the sequences of scaffold106-123324, scaffold1696-28255, scaffold5738-13895, scaffold6230-16617, scaffold8114-63630, scaffold12689-74110, scaffold13396-40523, scaffold27211-50459, scaffold29078-25601, scaffold33094-17553, and scaffold37790-3693. The sequences of the 20 pairs of primers are as shown in SEQ ID No: 1-SEQ ID No: 40; 4 pairs of KTZ-01 primers were designed based on the sequence of scaffold11704-227, and the sequences of the 4 pairs of primers are shown in SEQ ID No: 41-SEQ ID No: 48; 10 pairs of KTZ-04, KYZ-05 and KTZ-06 primers were designed based on the sequences of scaffold14690-59975, scaffold35529-12090, scaffold4010-47561, scaffold22750-27703, and scaffold22169-22594, and the sequences of the 10 pairs of primers are shown in SEQ ID No: 49-SEQ ID No: 68.

[0061] KTZ-01 is Russian wild ginseng, KTZ-02 is Yumu ginseng, KTZ-03 is Korean ginseng, KTZ-04 is yellow fruit ginseng, KTZ-05 is orange fruit ginseng, KTZ-06 is pink fruit ginseng, and KTZ-07 is Fusong ginseng.

[0062] 5. PCR amplification of target gene fragment:

[0063] Reaction system: The reaction was carried out in a 200 μL centrifuge tube. 10 μL of 2×TaqPCRMasterMix, 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), 1 μL of template DNA, and 7 μL of dd H2O were added, for a total of 20 μL.

[0064] Reaction procedure: Place a 200 μL centrifuge tube into the PCR instrument and set the PCR reaction parameters as follows: pre-denaturation: 94°C, 4 min; denaturation: 94°C, 30 s; annealing: 58°C, 30 s; extension: 72°C, 30 s, a total of 35 cycles, and continued extension: 72°C, 7 min.

[0065] Agarose gel electrophoresis: This test selected a 25-well gel plate and used 1.0% agarose gel.

[0066] (1) Wash and dry the gelatin tank and place it on the laboratory bench. Assemble the plastic gelatin plate and insert a 25-hole comb for later use.

[0067] (2) Use a balance to weigh 0.6 g of agarose powder and place it in a conical flask. Add 60 mL of 1× TBE buffer, shake well, and heat in a microwave oven for 1 to 2 minutes until the agarose powder is completely dissolved in the liquid and the liquid is uniform and clear without bubbles or colloid.

[0068] (3) Take the conical flask out of the microwave oven and place it on the laboratory bench to cool down. When the outer wall of the flask feels hot but bearable, add 6 μL of 10000×Solargelred nucleic acid dye and gently rotate the conical flask to evenly mix the nucleic acid dye in the liquid gel.

[0069] (4) Pour the liquid gel into the prepared gelatin plate. Be gentle when pouring. Pay attention to whether there are small bubbles and use the gun tip to remove the bubbles. After letting it stand for 40 minutes, gently pull up the comb vertically.

[0070] (5) Place the agarose gel in an electrophoresis tank filled with 1× TBE buffer. The electrophoresis buffer should cover the agarose gel by about 0.5 to 1 cm. Use a pipette to inject 6 μL of sample into each well of the gel. Add 6 μL of DNA Marker of appropriate specifications to the wells on both sides as a standard. Note that a new pipette tip should be used each time a sample is added.

[0071] (6) Set the voltage of the electrophoresis instrument to 150 V and turn on the power for about 30 minutes. When the DNA fragment containing bromophenol blue dye is observed to move to 2 cm away from the edge of the gel, stop the electrophoresis.

[0072] (7) Place the agarose gel under the ultraviolet light of the Bio-rad gel imaging system to observe the electrophoresis pattern. After adjusting parameters such as contrast, take a photo, save it, and export the image.

[0073] The results are as follows Figure 2 , Figure 3 , Figure 4 As shown, Figure 2The lengths of product amplification bands 1-10 are 1106bp, 1119bp, 1150bp, 1249bp, 1047bp, 1328bp, 1547bp, 1516bp, 1031bp and 1051bp respectively, and the sizes of the main band products amplified by the 10 pairs of primers are all between 1000 and 1600bp. Figure 3 The lengths of the amplified bands of products 1-4 were 1793bp, 1799bp, 1235bp, and 1791bp, respectively, and the sizes of the main band products amplified by the four pairs of primers were between 1000 and 1800bp. The amplified band of the primers E-3F / R was single and bright, with no nonspecific amplification. The amplified bands of the primers E-1F / R, E-2F / R, and E-4F / R were very weak, indicating that the amount of amplified product was too small, so it did not meet the next test standard and was excluded. Figure 4 The lengths of the amplified bands of products 1-20 are 892bp, 918bp, 920bp, 1220bp, 1275bp, 1273bp, 886bp, 1422bp, 979bp, 1338bp, 1036bp, 802bp, 898bp, 954bp, 1087bp, 956bp, 902bp, 1226bp, 843bp and 859bp, respectively. The amplified bands of primers M-5F / R, M-6F / R, M-12F / R and M-13F / R have obvious non-specific amplification, indicating that the primers are not specific, so they do not meet the next test standard and are excluded. The bands of other primers are clear and bright, without obvious miscellaneous bands, and can be used for the subsequent gel excision purification sequencing test.

[0074] 6. First-generation sequencing and sequence alignment:

[0075] The PCR product in step 5 was sent to Shanghai Sangon Biotechnology Co., Ltd. for first-generation sequencing, and the universal primers designed in step 4 were used as primers for the first-generation sequencing reaction. The sequencing result sequences were spliced ​​using SeqMan software, and then the spliced ​​sequences were corrected using BioEdit software. The sequencing quality and results were checked using Chromas software, and the sequencing results were compared and analyzed using Multalin online software to determine whether there were specific single nucleotide polymorphism (SNP) sites.

[0076] Figure 7 This is the peak diagram of the sequencing of the PCR product of E-3F / R in KTZ-01; Figure 8 This is the sequencing peak diagram of the PCR product of E-3F / R in the KTZ-01 control sample; Fig. 9 This is the sequencing peak diagram of the PCR product of M-11F / R in KTZ-02; Fig.10 This is the sequencing peak diagram of the PCR product of M-11F / R in the KTZ-02 control sample; Figure 7-10The results showed that the sequencing peaks were regular, without overlapping peaks, and the signals were obvious, indicating that the sequencing quality was good and the obtained sequences were accurate and effective for sequence alignment. The primer amplification bands of E-3F / R and M-11F / R were single and bright, with no nonspecific amplification and no obvious miscellaneous bands.

[0077] 7. SNP-specific primer design:

[0078] Using Primer Premier 5.0 software, population-specific SNP primers for KTZ-01 and KTZ-02 were designed based on the first-generation sequencing SNP sequences, and the SNP site bases were placed at the end of the primers from the 5' end to the 3' end. At the same time, in order to make the primers highly specific, the penultimate or third site at the 3' end of the primers was replaced with mismatched bases, resulting in two base mismatches in the primers for other samples, and no specific bands could be produced after amplification, thereby completing the identification of Russian wild ginseng samples. When designing primers, it is important to note that the Tm value of the primers should not be less than 54, the length should be 20±2bp, the product size should be in the range of 200-300bp, and the generation of incorrect priming points and hairpin structures should be controlled as much as possible.

[0079] 8. Conventional PCR verification of SNP sites:

[0080] Based on the SNP-specific site primer design principles in step seven, two sets of primers were designed.

[0081] Primers for KTZ-01:

[0082] Forward primer SEF: TTGATCTTGAAGGCCATG, reverse primer SER: GCATGATCTGGTCCAGCTCA;

[0083] Primers for KTZ-02:

[0084] Forward primer SYF: TGAGTTTCACGTCCTGAGTA, reverse primer SYR: GGAAGCAAATAGAAGGCACC

[0085] Reaction system:

[0086] (1) KTZ-01: Add 10 μL 2× TaqPCR Master Mix, 1 μL forward primer SEF (10 μM), 1 μL reverse primer SER (10 μM), and 1 μL ginseng template DNA to be tested into an EP tube; add 7 μL dd H2O, for a total of 20 μL system.

[0087] (2) KTZ-02: Add 10 μL 2× TaqPCR Master Mix, 1 μL forward primer SYF (10 μM), 1 μL reverse primer SYR (10 μM), 1 μL ginseng template DNA, and 7 μL dd H2O to the EP tube in sequence, for a total of 20 μL system.

[0088] Reaction procedure: Place the EP tube in a centrifuge and centrifuge for 30 seconds to mix, then transfer it to a PCR instrument. The reaction parameters are set as follows: pre-denaturation: 94°C, 4 min; denaturation: 94°C, 30 s; annealing: 58°C, 30 s; extension: 72°C, 30 s, a total of 35 cycles, continued extension: 72°C, 7 min, 4°C, ∞, and the reaction system is set to 20 μL.

[0089] The reaction results are as follows Fig.11 and Fig.12 shown. Fig.11 Among them, only KTZ-01 produced an amplification curve, which peaked at about the 16th cycle and entered the reaction growth phase. The reaction entered the plateau phase at the 30th cycle, while the other samples did not show changes in the amplification curve, further verifying the population-specific SNP site of KTZ-01. Fig.12 Only KTZ-02 produced an amplification curve, which peaked at about the 20th cycle and entered the reaction growth phase. The reaction entered the plateau phase at the 34th cycle, while no amplification curve appeared in other samples, further verifying the population-specific SNP site of KTZ-02.

[0090] Fluorescence quantitative PCR verification of SNP sites:

[0091] Reaction system: Use eight tubes and add 2μL template DNA, 10μL Perfect StartGreen Super Mix, 2μL Passive Reference Dye 50× (option), 0.4μL forward primer (10μM); 0.4μL reverse primer (10μM); 6.8μL dd H2O to each tube in sequence, for a total of 20μL system.

[0092] Reaction procedure: This test adopts a three-step method with the following parameter settings: 94°C, 30 s; 94°C, 5 s; 55°C, 30 s, for a total of 40 cycles.

[0093] The reaction results are as follows Fig.14 and Fig.15 shown. Fig.14 In the experiment, when the KTZ-01 specific primer pair SEF / R was added to the seven samples at the same time, only KTZ-01 produced a band at 271 bp after PCR amplification, while the other samples had no bands. Fig.15In the experiment, when the KTZ-02 specific primer pair SYF / R was added to the seven samples at the same time, only KTZ-02 produced a specific band at 250 bp after PCR amplification, while the other samples had no band. The two primer pairs have good specificity and can be used for conventional PCR identification.

[0094] Table 1 SEQ ID No: 1-SEQ ID No: 68 Primer sequences

[0095]

[0096]

Claims

1. A method for identifying Russian wild ginseng, characterized in that: The following steps are involved: 1) Screening multiple SNP sites of Russian wild ginseng, the sequence fragment of the chromosome where the SNP site is located is the target gene fragment, and designing multiple primers according to the target gene fragment; 2) using the primers in step 1) to perform PCR amplification on the target gene fragment in step 1), and sequencing and analyzing the amplified product to verify whether the SNP site exists; 3) For gene fragments that have been verified to have SNP sites, SNP-specific site primers are designed. The SNP-specific site primer design method is as follows: the SNP site base is placed at the end of the primer from the 5' end to the 3' end; the penultimate or third site at the 3' end of the primer is replaced with a mismatched base, resulting in a two-base mismatch in the primer for the target gene fragment of the Russian wild ginseng sample to be identified, and no specific bands can be generated after amplification, thereby achieving the identification of the Russian wild ginseng sample to be identified.

2. The method for identifying Russian wild ginseng according to claim 1, characterized in that: The target gene fragments in step 1) include scaffold106-123324, scaffold1696-28255, scaffold5738-13895, scaffold6230-16617, scaffold8114-63630, scaffold12689-74110, scaffold13396-40523, scaffold27211-50459, scaffold ffold29078-25601, scaffold33094-17553, scaffold37790-3693, scaffold11704-227, scaffold1469 0-59975, scaffold35529-12090, scaffold4010-47561, scaffold22750-27703, scaffold22169-22594.

3. The method for identifying Russian wild ginseng according to claim 2, characterized in that: Twenty pairs of primers were designed based on the sequences of scaffold106-123324, scaffold1696-28255, scaffold5738-13895, scaffold6230-16617, scaffold8114-63630, scaffold12689-74110, scaffold13396-40523, scaffold27211-50459, scaffold29078-25601, scaffold33094-17553, and scaffold37790-3693. The sequences of the 20 pairs of primers are shown in SEQ ID No: 1 to SEQ ID No:

40. Four pairs of primers were designed based on the sequence of scaffold11704-227, and the sequences of the four pairs of primers are shown in SEQ ID No: 41-SEQ ID No: 48; ten pairs of primers were designed based on the sequences of scaffold14690-59975, scaffold35529-12090, scaffold4010-47561, scaffold22750-27703, and scaffold22169-22594, and the sequences of the ten pairs of primers are shown in SEQ ID No: 49-SEQ ID No:

68.

4. The method for identifying Russian wild ginseng according to claim 1, characterized in that: When designing SNP-specific site primers in step 3), the Tm value of the primers is not less than 54, the length is 20±2 bp, and the size of the PCR amplification product is in the range of 200 to 300 bp.

5. The method for identifying Russian wild ginseng according to claim 1, characterized in that: When screening multiple SNP sites of Russian wild ginseng in step 1), first extract the Russian wild ginseng DNA and perform an electronic enzyme cutting prediction test. Then, use a restriction endonuclease to recognize and cut the Russian wild ginseng genomic DNA, add bases to the 3' end of DNA fragments of different lengths obtained by enzyme cutting, and then connect this fragment to the sequencing adapter, perform PCR amplification, and recover the target fragment by gel cutting by electrophoresis. Perform SLAF sequencing on the Illumina platform, and obtain the population SNP site by sorting and analyzing the sequencing data.

6. The method for identifying Russian wild ginseng according to claim 1, characterized in that: The reaction system for PCR amplification of the target gene fragment in step 2) is: 2×TaqPCRMasterMix 10 μL, upstream primer 1 μL, downstream primer 1 μL, template DNA 1 μL, dd H2O 7 μL, a total of 20 μL, the concentration of the upstream primer is 10 μM, and the concentration of the downstream primer is 10 μM.

7. The method for identifying Russian wild ginseng according to claim 1, characterized in that: The reaction program for PCR amplification of the target gene fragment in step 2) is: pre-denaturation: 94°C, 4 min; denaturation: 94°C, 30 s; annealing: 58°C, 30 s; extension: 72°C, 30 s, a total of 35 cycles, and continued extension: 72°C, 7 min.

8. The method for identifying Russian wild ginseng according to claim 1, characterized in that: The method for sequencing and analyzing the amplified products in step 2) is: using SeqMan software to splice the sequencing result sequences, then using BioEdit software to correct the spliced ​​sequences, using Chromas software to check the sequencing quality and results, and using Multalin online software to compare and analyze the sequencing results.

9. The method for identifying Russian wild ginseng according to claim 1, characterized in that: In step 3), the reaction system for SNP-specific site primer PCR verification of the SNP site is: 10 μL 2×TaqPCR Master Mix, 1 μL forward primer, 1 μL reverse primer, 1 μL Russian wild ginseng template DNA, 7 μL dd H2O, a total of 20 μL, the concentration of the forward primer is 10 μM, and the concentration of the reverse primer is 10 μM.

10. The method for identifying Russian wild ginseng according to claim 1, characterized in that: The reaction procedure of SNP-specific site primer PCR verification of SNP sites in step 3) is: pre-denaturation: 94°C, 4 min; denaturation: 94°C, 30 s; annealing: 58°C, 30 s; Extension: 72°C, 30s, a total of 35 cycles, continued extension: 72°C, 7min, 4°C, ∞.

Images