Method for preparing migratory locust Crz gene mutant and application of migratory locust Crz gene mutant in migratory locust prevention and control

Abstract

The invention belongs to the technical field of migratory locust biotechnology and gene editing, and particularly relates to a method for preparing migratory locust Crz gene mutants and application of the migratory locust Crz gene mutants in migratory locust prevention and control. It is found that migratory locust control can be achieved by inhibiting expression of the Crz gene in migratory locust bodies, and the Crz gene sequence is shown as SEQ ID NO: 3. A migratory locust Crz homozygous mutant strain is successfully established by applying a gene editing technology, albino migratory locust obtained after Crz deletion is found to be more easily predatory by natural enemies than wild migratory locust, the content of aggregative pheromone 4VA is also remarkably reduced, and the adaptability to low temperature is also weaker than that of the wild migratory locust, so that a new strategy is provided for biological prevention and control of migratory locust, and the application prospect is broad. And reference can be provided for biological prevention and control of other pests.

Description

Technical Field

[0001] The invention belongs to the fields of locust biotechnology and gene editing technology, and specifically relates to a method for preparing a locust Crz gene mutant and an application thereof in locust prevention and control. Background Art

[0002] Migratory locusts (Locus tamigratoria) are serious pests worldwide. During a locust outbreak, migratory locusts change from solitary to gregarious, and their body color changes from green to black. This blackened body color helps reduce the predation of locusts by natural enemies such as birds. Migratory locusts are widely distributed throughout Africa, most of Eurasia south of the Taiga forest, the East Indies, the tropical part of Oceania, and New Zealand. With the increase of latitude, the body color of migratory locusts tends to become darker and darker. It is speculated that melanization may be a strategy for migratory locusts to adapt to low temperatures.

[0003] Corazonin (Crz) is a neuropeptide composed of 11 amino acids, which is found in Diptera, Hymenoptera, Mantis, It is widely found in insects such as the order Hemiptera, Lepidoptera, Blattodea and Orthoptera, and has multiple subtypes. It has the functions of regulating metabolism, lifespan and reproduction, regulating stress response, affecting pupation, initiating molting, reducing silking, prolonging the pupal period and regulating the status of social insects in the population. 7 ]-Crz subtype, which has the function of inducing body color blackening and regulating body shape. Foreign scholars have captured albino locusts with Crz gene mutations in the wild and used them for scientific research, but it is not clear whether the albinism caused by the Crz gene mutation affects its defense against natural enemies, and the impact of Crz loss on other aspects of locusts. Considering the pest nature of locusts, it is necessary to further clarify the impact of Crz gene mutations on them, provide more basis for pest control, and lay the foundation for analyzing the regulatory mechanism of Crz in insects.

[0004] The CRISPR / Cas system is an acquired defense mechanism that exists in bacteria and archaea and relies on RNA participation. It has now been transformed into an efficient gene editing tool system. The CRISPR / Cas9 gene editing system only requires a guide RNA (sgRNA) that matches the target site of the target gene and a Cas9 protein that has the function of cutting double-stranded DNA to form a ribosomal protein complex (RNP complex), which can introduce double-strand breaks (DSBs) at specific sites in the genome. The breaks are repaired by the cell's endogenous repair mechanism, thereby achieving genome-level operations such as knocking out the target gene. It has been widely used in animals, plants, and microorganisms, greatly promoting research progress in the fields of medicine and biology. CRISPR / Cas9 technology has also been used in locust gene editing research, but there have been no reports of using this technology to knock out the Crz gene and obtain homozygous mutants. Summary of the invention

[0005] The present invention uses gene editing technology to inject RNP complexes into fertilized locust eggs to obtain locust Crz mutants, wherein microinjection is only one presentation method in the method, and other presentation methods may also achieve the same effect and belong to the scope of the method. Using the method and RNP complex provided by the present invention, a locust Crz homozygous mutant was successfully obtained, and it was found that the albino locust obtained after Crz loss was more easily preyed on by natural enemies than the wild-type locust, the content of the aggregation pheromone 4VA was also significantly reduced, and its adaptability to low temperature was also weaker than that of the wild type.

[0006] The present invention is implemented by the following technical solutions:

[0007] The present invention provides an application of the Crz gene in locust control, specifically, inhibiting the expression of the Crz gene in the locust to achieve locust control, and the coding sequence of the Crz gene is shown in SEQ ID NO: 3. Compared with the coding sequence of locust prepro-corazonin (GenBank: LC031861.1) in the GenBank database, the sequence shown in SEQ ID NO: 3 does not contain 5'UTR and 3'UTR sequences.

[0008] The above-mentioned inhibition of Crz gene expression in locusts is achieved by knocking out the Crz gene in locusts.

[0009] The steps of knocking out the locust Crz gene are:

[0010] (1) According to the coding sequence of the Crz gene, its gene structure and genome sequence are determined in the migratory locust genome, and the sgRNA target site is designed; the sgRNA target site is located in the second exon region of the Crz gene;

[0011] The sgRNA target site is located in the second exon region of the Crz gene;

[0012] The sgRNA target sites are shown in SEQ ID NO: 1 and SEQ ID NO: 2;

[0013] The sgRNA template primer sequence is:

[0014] T7-Crz T1-F: 5'-TAATACGACTCACTATAGGAGCGTGGCGCTGCTG-3',

[0015] Crz T1-R: 5'-TTCTAGCTCTAAAACCCGCCAGCAGCGCCACGCT-3';

[0016] and

[0017] T7-Crz T2-F: 5'-TAATACGACTCACTATAGCAGCCTGAGGCAGCGC-3',

[0018] Crz T2-R: 5'-TTCTAGCTCTAAAACCGTGCGCTGCCTCAGGCTG-3'.

[0019] (2) Construction of CRISPR / Cas9 knockout system: sgRNA was prepared by in vitro transcription and co-incubated with Cas9 protein to obtain a ribonucleoprotein (RNP) mixture for injection;

[0020] (3) The RNP mixture was injected into locust eggs using a microinjector, and the locust Crz gene mutants were obtained through screening.

[0021] The present invention also provides the application of the Crz gene in regulating the low temperature adaptability of migratory locusts. Knocking out the Crz gene in the migratory locust will reduce the low temperature adaptability of the migratory locust.

[0022] The beneficial effects of the present invention are:

[0023] The present invention uses CRISPR / Cas9 technology to knock out the Crz gene of locusts for the first time, successfully constructs homozygous mutant locusts of this gene in China, and provides a stable and effective homozygous mutant strain of the Crz gene. This mutation makes locusts more susceptible to predation by natural enemies, significantly reduces the content of the aggregation pheromone 4VA, and has lower adaptability to low temperature environments, which can provide a new strategy for the biological control of locusts and provide a reference for the biological control of other pests. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 : Schematic diagram of the structure and target site location of the locust Crz gene.

[0025] Figure 2 :Results of in vitro cleavage detection of the amplified products of Locust Crz gene.

[0026] Figure 3 : Sequencing results of the Crz gene of the homozygous mutant locust. M1 and M2 represent the two homozygous mutants obtained, and the red part represents the missing gene sequence.

[0027] Figure 4 :Phenotypic analysis of homozygous mutants of the Crz gene of locusts. A. The mutants are significantly albino. B. The survival rate of homozygous mutants in the predation experiment with natural enemies is lower. C. The 4VA content of mutants is significantly reduced. D. The body color of locusts becomes significantly darker under low temperatures. E. The body length of mutants is shorter under low temperatures. F. The body weight of mutants is lower under low temperatures. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution in the embodiment of the present invention will be clearly described below in conjunction with the drawings in the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0029] The migratory locusts used in the present invention are gregarious strains that have been stably raised for a long time in the insect room of the Key Laboratory of Plant Stress Biology of Henan University. They are raised in a metal cage (length, width and height are all 40 cm) with good light transmittance and air permeability under gregarious conditions, and the population density is maintained at about 250 adults per cage. The room temperature is 30±2°C, the light duration is 14 hours per day (14L:10D), the relative humidity is 15% to 25%, and the locusts are fed with wheat bran and fresh wheat seedlings, and garbage such as migratory locust feces is cleaned up in time.

[0030] Main reagents: GeneArt TM Precision gRNA Synthesis Kit (Invitrogen), TrueCut TM Cas9 Protein v2 (Invitrogen), Animal Genomic DNA Rapid Extraction Kit (Shengang), etc.

[0031] After extensive research and repeated experiments by the inventors, after selecting gene mutation sites, designing sgRNA and in vitro transcription, and preparing RNP complexes, RNP was finally introduced into locust embryos by microinjection, and combined with molecular biology techniques such as target gene fragment amplification and sequencing, the present invention used the CRISPR / Cas9 system for the first time to knock out the Crz gene of the locust and successfully obtained a homozygous mutant locust strain. Compared with the wild-type locust, the Crz gene mutant is more easily preyed upon by natural enemies, birds, and the content of its aggregation pheromone 4VA is significantly reduced, which makes it possible to use it for the prevention and control of locusts; on the other hand, the adaptability of the Crz gene mutant to low temperature is much lower than that of the wild type, and the Crz gene mutant shows lower body length and weight at low temperatures, which lays the foundation for analyzing the regulatory mechanism of Crz in insects.

[0032] The specific implementation is as follows:

[0033] 1. Construction of RNP complex for knockout of Crz gene in Locust migratory locust:

[0034] (1) With reference to the coding sequence of prepro-corazonin of Locust migratoria (GenBank: LC031861.1), the structure of Crz gene and its genomic location (GenBank: GCA_026315105.1) were preliminarily determined after comparison with the genome of Locust migratoria. It was inferred that the Crz gene of Locust migratoria is located on chromosome 3, consists of 3 exons, and the Crz coding sequence is located in the second exon, such as Figure 1 As shown. After designing primers (Table 1) based on the coding sequence of locust prepro-corazonin as a reference to amplify and sequence the genomic sequence near the Crz coding sequence, a potential target site of the CRISPR / Cas9 system was selected on both sides of the Crz coding sequence for subsequent research, which were named Target1 (SEQ ID NO: 1, GAGCGTGGCGCTGCTGGCGGTGG) and Target2 (SEQ ID NO: 2, GCAGCCTGAGGCAGCGCACGCGG).

[0035] Table 1. Primers for amplification of Crz gene

[0036] Primer name Sequence (5' to 3') Crz-F ACTGGAGCCCCTTAGTCTCC Crz-R ATTGGCCGGTAAATGTGCAG

[0037] (2) In vitro synthesis of sgRNA

[0038] a. Design sgRNA template primers according to the target site sequence (Table 2) and assemble the DNA template for in vitro transcription of sgRNA through PCR reaction (Table 3).

[0039] Table 2. sgRNA template primer sequences

[0040] Primer name Sequence (5' to 3') T7-Crz T1-F TAATACGACTCACTATAGGAGCGTGGCGCTGCTG Crz T1-R TTCTAGCTCTAAAACCCGCCAGCAGCGCCACGCT T7-Crz T2-F TAATACGACTCACTATAGCAGCCTGAGGCAGCGC Crz T2-R TTCTAGCTCTAAAACCGTGCGCTGCCTCAGGCTG

[0041] The PCR reaction system for the sgRNA in vitro transcription template is as follows:

[0042] Table 3. PCR reaction system of sgRNA template

[0043] Element Volume (μL) <![CDATA[Phusion TM High-Fidelity PCR Master Mix(2×)]]> 12.5 Tracr Fragment+T7 Primer Mix 1 0.3μM Target F1 / R1 Oligonucleotide Mix 1 Nuclease-free Water 10.5 Total Volume 25

[0044] The above system was thoroughly mixed and centrifuged briefly, and then the template for in vitro transcription of sgRNA was assembled by PCR according to the following program: 98°C, 10s; 98°C, 5s, 55°C, 15s, for a total of 32 cycles; 72°C, 1min; 4°C, forever.

[0045] b. In vitro transcription of sgRNA

[0046] Prepare the in vitro transcription reaction system according to Table 4 (add the components in the order in the table):

[0047] Table 4. sgRNA in vitro transcription reaction system

[0048]

[0049]

[0050] The components were mixed thoroughly and centrifuged instantaneously, and reacted at 37°C for 2 to 4 hours. After transcription was completed, 1 μL of deoxyribonuclease I was added to the reaction mixture, and the mixture was incubated at 37°C for 15 minutes to remove the template.

[0051] c. Purification of sgRNA

[0052] Dilute the reaction system to 200 μL with nuclease-free water, add 100 μL Binding Buffer, and mix thoroughly; add 300 μL anhydrous ethanol (>96%), and mix thoroughly; transfer the mixture to GeneJet TM In the RNA purification microcolumn, centrifuge at 14000g for 60s; add 700μL Wash Buffer 1, centrifuge at 14000g for 30s, and discard the filtrate; add 700μL WashBuffer 2, centrifuge at 14000g for 30s, and discard the filtrate; centrifuge at 14000g for 60s to completely remove the residual wash buffer, and transfer the purification microcolumn to a clean 1.5mL collection tube; add 20μL nuclease-free water to the center of the purification column filter, centrifuge at 14000g for 60s to elute the sgRNA.

[0053] Take 1 μL of sgRNA and dilute it 100 times with nuclease-free water, then measure the concentration using NanoDrop 2000. The sgRNA stock solution was placed in a -80°C refrigerator for later use.

[0054] (3) In vitro cleavage reaction to verify the activity of sgRNA

[0055] The two sgRNAs were reacted with Cas9 protein and reaction buffer and substrate at 37°C for 1 hour, and then the enzyme digestion results were tested by 1.5% agarose gel. The ability of sgRNA to guide Cas9 protein to directional cut the target site was determined based on the enzyme digestion results. In addition to the two experimental groups, four control groups were set up: substrate only, substrate and sgRNA T1, substrate and sgRNA T2, substrate and Cas9 protein. The activity of sgRNA was evaluated based on the consumption of substrate in each group.

[0056] The size of the Crz gene fragment amplified by PCR using Crz-F and Crz-R primers was 684 bp. Figure 2As shown, sgRNA T1 successfully cut the Crz gene fragment into two fragments of 188 bp and 496 bp, and sgRNA T2 successfully cut the Crz gene fragment into two fragments of 366 bp and 318 bp, which were consistent with the expected results, proving that sgRNA T1 and sgRNA T2 have biological activity.

[0057] (4) Preparation of RNP injection solution

[0058] The two sgRNAs and Cas9 proteins prepared according to the target sites were premixed and incubated at 37°C for 30 to 60 minutes to obtain the RNP complex for injection. In the RNP complex, the final concentrations of sgRNA and Cas9 protein were 150 ng / μL and 400 ng / μL, respectively (the concentrations of the two components can be adjusted according to the actual use effect), and the dosage ratio of the two sgRNAs in the sgRNA was 1:1. In this embodiment, two different sites of the Crz gene are targeted to improve the knockout efficiency of the Crz gene.

[0059] 2. Knockout of endogenous Crz gene in locust using CRISPR / Cas9 system

[0060] (1) Collection of eggs for microinjection

[0061] In order to collect fresh eggs for injection experiments, the ovipositors were replaced with new ovipositors 2 hours before egg collection. During the experiment, the collected fresh egg packages were separated with tweezers, and the fertilized eggs were taken out individually, washed with sterile distilled water until there was no sand and residual follicles, soaked in 75% alcohol for 1 min, and then washed with sterile distilled water for 3 times. Sterile water was added to a clean culture dish, and the washed eggs were placed in it for later use.

[0062] (2) Microinjection

[0063] Use a sterilized brush to arrange the cleaned and disinfected locust fertilized eggs on the injection plate, place the injection plate on the stage of the stereo microscope, and use the micromanipulation system to inject the RNP complex into the collected locust eggs. After completing the injection of a plate of fertilized eggs, use a brush to transfer the injected fertilized eggs to the prepared culture dish, seal it with plastic wrap, and then put it into a constant temperature incubator with a temperature of 30°C and a humidity of 15%. Nymphs will hatch in about 10 to 12 days.

[0064] 3. Screening and establishment of Crz gene mutant locust strains

[0065] (1) Screening and passage of G0 chimeras

[0066] The larvae hatched in the previous step grow to the adult stage (the first day after emergence), and the male and female insects are cultured and marked separately. The antennae of the migratory locust are cut off with dissecting scissors to 3-5 mm in length and placed in a 1.5 mL centrifuge tube. The genome is obtained by alkaline lysis method, that is, 45 μL 50 mM NaOH is added, and lysis is carried out at 95 ° C for 30 min; then 5 μL 1M Tris-HCl (pH = 8.0) is added. Take 1 μL of the above lysis product as a template, amplify the target gene fragment by PCR method, and sequence the PCR product. According to the sequencing results, the positive mutation G0 generation individuals with mixed peaks at the target site are screened and mated with the wild type.

[0067] (2) Screening and establishment of homozygous strains

[0068] The G1 generation individuals were screened using the above detection method, and the heterozygous individuals in the G1 generation were selected for pairing and propagation. The G2 generation individuals were identified using the same method, and the homozygous mutants were screened based on the sequencing results ( Figure 3 ) are paired and propagated to establish a locust strain with a homozygous mutation in the Crz gene.

[0069] The two homozygous mutants M1 and M2 screened in this example lacked 15 bp and 188 bp respectively compared with the wild type. Figure 3 As shown. The mutant body color is significantly white compared to the wild type, as shown Figure 4 As shown in A.

[0070] 4. Effects of homozygous mutation of Crz gene on migratory locusts

[0071] (1) Avoiding attacks from natural enemies

[0072] First, the natural enemy birds were starved for 4 hours (only water was provided, no food was provided), and then one albino locust and one wild locust were fed into the cage at the same time. Once one of them was preyed on, the other locust was taken out of the cage and fed to the next group until the natural enemy birds stopped preying on them. Each predation experiment was repeated 6 times independently, and the type and number of locusts preyed on in each experiment were recorded. The signed rank test was used for statistical analysis to compare the differences between the groups and their significance (*, P<0.05). The results showed that locusts with homozygous mutations in the Crz gene were more likely to be preyed on ( Figure 4 B).

[0073] (2) Determination of 4VA content

[0074] 4VA is widely present in locusts. In order to verify the effect of homozygous mutation of Crz gene on 4VA content of locusts, we dissected 4th instar 2-day-old female locusts, took about 50-100 mg of fresh tissue in a 1.5 mL centrifuge tube, added 200 μL of sterile water to the centrifuge tube and homogenized with an electric pestle for 1-1.5 min. After grinding, 200 μL of n-hexane was added. Next, the ground sample was stirred in a 4°C blender for 10 min and centrifuged at 13000 rpm for 10 min. 150 μL of supernatant was transferred to a specific glass sample tube, and the content of 4VA in different samples was detected by GC-MS and compared. The results showed that the 4VA content in locusts with homozygous mutation of Crz gene was significantly reduced ( Figure 4 C).

[0075] (3) Determination of duration and growth indexes under low temperature

[0076] The newly hatched 1st instar insects were placed in an incubator (they were kept in iron mesh cages (40cm*40cm*40cm), the temperature of the environment was 25℃ during the day and 20℃ at night, the light duration was 14h per day (14L:10D), the relative humidity was 15%-25%, and they were fed with wheat bran and fresh wheat seedlings, and the locust feces and other garbage were cleaned up in time.) The locusts entering the next instar were recorded every half a day, and the body length and weight of the locusts were recorded every day. The t-test was used for statistical analysis to compare the differences and their significance among the groups (*, P<0.05). The results showed that the body color of the locusts turned significantly darker under low temperatures ( Figure 4 D) Locusts with homozygous mutations in the Crz gene have lower adaptability to low temperatures ( Figure 4 E, 4F).

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. CrZ The application of genes in locust control is characterized in that: Suppressing the locust's CrZ Gene expression for locust control, CrZ The coding sequence of the gene is shown in SEQ ID NO:

3.

2. The use according to claim 1, characterized in that: Suppressing the locust's CrZ Gene expression was determined by knocking out CrZ Gene realization.

3. The use according to claim 2, characterized in that: Knockout locust CrZ The genetic steps are: (1) Based on CrZ The coding sequence of the gene is determined in the locust genome, its gene structure and genome sequence are determined, and the sgRNA target site is designed; the sgRNA target site is located at CrZ The second exon region of the gene; (2) Construction of CRISPR / Cas9 knockout system: Preparation of sgRNA by in vitro transcription and co-incubation with Cas9 protein to obtain a ribonucleoprotein mixture for injection; (3) The ribonucleoprotein mixture is injected into locust eggs through a microinjector, and locusts are obtained through screening. CrZ Gene mutants.

4. The use according to claim 3, characterized in that: The sgRNA target sites are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

5. The use according to claim 3, characterized in that: The sgRNA template primer sequence is: T7-Crz T1-F: 5'-TAATACGACTCACTATAGGAGCGTGGCGCTGCTG-3', Crz T1-R: 5'-TTCTAGCTCTAAAACCCGCCAGCAGCGCCACGCT-3'; and T7-Crz T2-F: 5'-TAATACGACTCACTATAGCAGCCTGAGGCAGCGC-3', Crz T2-R: 5'-TTCTAGCTCTAAAACCGTGCGCTGCCTCAGGCTG-3'.

6. CrZ The application of genes in regulating the low temperature adaptability of migratory locusts is characterized in that: Knockout of locusts CrZ Genes to reduce the ability of migratory locusts to adapt to low temperatures, CrZ The sequence of the gene is shown in SEQ ID NO:3.

Images