QKCMP peptide based on triangular DNA origami nanostructure and application of QKCMP peptide in drug delivery

Abstract

The invention relates to the technical field of biological medicine, discloses a QKCMP peptide based on a triangular DNA origami nano structure and application of the QKCMP peptide in drug delivery, and designs and synthesizes a novel triangular DNA origami nano material. And the QKCMP peptide with dual functions of a VEGF (vascular endothelial growth factor) simulated structural domain and a collagen simulated structural domain is successfully loaded on the surface to synthesize the composite material QKCMP peptide-tDONs, and the composite material shows controllable QKCMP peptide release capacity in a neutral environment. The QKCMP Peptide-tDONs system based on the DNA origami nanometer material, provided by the invention, provides a new strategy for treating related diseases of blood vessels.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a QKCMP peptide based on a triangular DNA origami nanostructure and an application thereof in drug delivery. Background Art

[0002] Angiogenesis refers to the process of new blood vessel formation, which is of vital importance to the success of tissue engineering. In the field of regenerative medicine and tissue engineering (TE), the constructed tissue needs to have a functional vascular network to provide essential nutrients and oxygen to ensure its long-term survival. However, currently constructed tissues often do not have the ability to form such a functional vascular network. Angiogenesis is a complex biological process that includes the conduction of growth factor signals and the degradation of the extracellular matrix (ECM), which further promote the proliferation, migration and differentiation of endothelial cells (EC). In clinical practice, poor angiogenesis is closely related to the occurrence and development of a variety of diseases, such as cardiovascular and cerebrovascular diseases and peripheral vascular lesions caused by diabetes. Therefore, promoting angiogenesis has become one of the focuses of current medical research, among which vascular endothelial growth factor (VEGF) plays a vital role in the angiogenesis process.

[0003] Vascular endothelial growth factor (VEGF) triggers endothelial cell proliferation, migration and angiogenesis by binding to corresponding receptors. In addition, VEGF can promote the expression of anti-apoptotic proteins, thereby exerting an anti-apoptotic effect on endothelial cells. Since Thompson et al. first published related research in 1988, a large amount of preclinical and clinical research evidence has shown that recombinant VEGF can effectively promote the formation of new blood vessels through direct administration or gene therapy. VEGF is considered to be the most intensively studied and generally recognized key promoter of early endothelialization, which can enhance the adhesion, differentiation and proliferation of endothelial progenitor cells (EPC). However, to induce the formation of new blood vessels in ischemic areas, VEGF needs to be applied locally for three to four weeks. Due to the inherent instability of VEGF protein and its short half-life in vivo (average 33.7±13.7 minutes), its effectiveness as a therapeutic agent is limited. In order to achieve the ideal level of VEGF through systemic administration, multiple administrations are necessary. However, excessive use of VEGF may lead to bleeding, abnormal angiogenesis, atherosclerosis, carcinogenesis, nonspecific toxic reactions, and negative feedback inhibition (receptor downregulation leads to termination of VEGF signaling). The administration of recombinant VEGF protein without a carrier may cause a variety of adverse reactions to the human body, which limits its use in clinical applications. Therefore, different carrier systems must be used to ensure the continuous and stable release of VEGF throughout the treatment process. The clinical efficacy of VEGF depends on the appropriate administration method to ensure a continuous effective dose while minimizing any potential adverse reactions.

[0004] Currently, there are relatively few technologies that can accurately encapsulate VEGF and achieve its subsequent sustainable and controlled release. Existing studies include systems such as polymers, liposomes, hydrogels, inorganics, multiple chains, and microfluidics. Researchers have also tried to fix VEGF on scaffolds through various methods (such as covalent conjugation chemistry) to prolong its biological activity, but these methods usually involve non-specific chemical reactions, and the use of organic solvents may damage the activity of VEGF and the physicochemical integrity of the scaffold. In addition, these fixation methods are insufficient in the precise control of the spatial distribution of VEGF, which may be crucial for directional angiogenesis.

[0005] Therefore, it is particularly important to develop a new carrier system that can precisely control the release of VEGF. Summary of the invention

[0006] The extracellular matrix (ECM) is a key support structure for endothelial cell attachment and migration, among which collagen, as the main protein, plays a vital regulatory role in the angiogenesis process. Type I collagen, together with vascular endothelial growth factor (VEGF), can promote cell reorganization, activate actin polymerization, and induce the formation of endothelial stress fibers, which are essential for the morphogenesis of capillaries. There are three major isoforms of VEGF - VEGF121, VEGF165 and VEGF189, which have different biological activities and binding affinities to ECM. The different binding affinities of these isoforms to ECM are determined by the presence or absence of the heparin binding domain, among which VEGF189 has the highest ECM affinity, VEGF165 has a moderate affinity, and VEGF121 exists only as a soluble factor. Collagen mimetic peptides (CMPs) are polypeptides with different degrees of collagen affinity. It contains a structure similar to the Gly-XY sequence commonly found in natural triple-helical collagen, but unlike natural collagen, these peptides form a thermoreversible triple-helical structure. The melting temperature and collagen binding affinity of CMPs can be adjusted by changing the number of repeated Gly-XY units. Its different degrees of collagen affinity can be used to mimic the different heparin binding affinities of natural VEGF isoforms. In order to achieve the collagen affinity of QK peptides, Tania R. Chan et al. designed and synthesized a bifunctional peptide QKCMP, which contains an EC activation domain (QK) and a collagen binding domain (CMP), directly mimics the angiogenic activity and ECM binding affinity of matrix-bound VEGF, enhances or spatially guides microvessel formation, and produces organized blood vessels that are more similar to natural tissues. However, how to effectively and stably deliver QKCMP peptides to target cells and achieve their controlled release remains an urgent problem to be solved.

[0007] Deoxyribonucleic acid (DNA) origami technology, as a cutting-edge nanotechnology, provides an innovative strategy for the field of drug delivery. The technology was first proposed by Rothemund in 2006. Its core is to use a long-chain scaffold DNA and a number of short-chain DNAs with precisely controlled sequences to form a predetermined DNA structure through self-assembly. This process relies on weak intermolecular interactions such as hydrogen bonds, hydrophilic and hydrophobic forces, and electrostatic forces. DNA origami technology has significantly reduced the difficulty of implementing DNA nanotechnology due to its simple operation process and high structural controllability, and has laid a solid foundation for its widespread application. The technology strictly follows the Watson-Crick base pairing principle and constructs complex structures with nanometer-level precision, greatly expanding the complexity, dimension and functional diversity of DNA nanostructures. Thanks to its high programmability and addressability, DNA origami has become a multifunctional nanomaterial that is widely used in transportation, sensing, and computing. In addition, DNA origami nanostructures constructed based on the Watson-Crick base pairing principle have shown a wide range of properties in in vitro and in vivo experiments, including excellent adaptability, precise programmability and extremely low cytotoxicity, which makes DNA origami technology have great application potential in the field of drug encapsulation and delivery. DNA origami technology can form a variety of complex nanostructures by precisely folding and assembling single-stranded DNA. These structures not only have high programmability and self-assembly capabilities, but can also be functionalized through chemical modification. In recent years, DNA origami technology has shown broad application prospects in the fields of drug delivery and nanotherapy. In the present invention, we refer to the synthesis method and sequence of triangular DNA origami nanomaterials published by Rothemund, and design and self-assemble triangular DNA origami nanomaterials (tDONs) containing hinge sequences with peptide capture capabilities after amino modification. Due to the self-addressing properties of DNA, these hinges are orderly arranged in the DNA origami structure, and after mixed reaction with the QKCMP peptide containing a carboxyl group, the directional loading of the QKCMP peptide is achieved, thereby synthesizing DNA origami nanomaterials loaded with QKCMP peptide (QKCMP Peptide-tDONs). QKCMP Peptide-tDONs can slowly release QKCMP peptide in a neutral solution, achieving its precise spatial positioning and directional release. Immobilizing the QKCMP peptide on DNA origami can significantly improve its stability in vivo, reduce the risk of its rapid degradation, and maintain its environmental concentration for a period of time. DNA origami materials also have natural biocompatibility and low immunogenicity, and can be delivered to target tissues through a variety of routes, including intravenous injection, local injection, etc., with flexible delivery methods to meet different clinical needs, thereby effectively and stably delivering the QKCMP peptide to the target environment and achieving its controlled release.

[0008] In view of this, the present invention proposes a QKCMP peptide based on a triangular DNA origami nanostructure and its application in drug delivery. The purpose of the present invention is to design and develop a QKCMP peptide release control system based on DNA origami nanomaterials, which can effectively promote angiogenesis by precisely controlling the spatial distribution and release of QKCMP peptides, thereby providing a new type of bioactive scaffold material for the field of tissue engineering. The specific research content covers the design, self-assembly and purification process of DNA origami, the synthesis and characterization of DNA origami nanomaterials (QKCMP Peptide-tDONs) loaded with VEGF mimetic peptide QKCMP, and the experimental study of the angiogenesis efficacy of the material in vitro and in vivo.

[0009] The present invention proposes a method for preparing a QKCMP peptide based on a triangular DNA origami nanostructure, comprising:

[0010] The QKCMP peptide is mixed with the triangular DNA origami, and then annealed to obtain the QKCMP peptide based on the triangular DNA origami nanostructure;

[0011] The triangular DNA origami is tDONs; the amino acid sequence of the QKCMP peptide is Ac-KLTWQELYQLKYKGIGGG(POG.

[0012] Preferably, the molar concentration ratio of the QKCMP peptide to the triangular DNA origami is 5-9:1-5.

[0013] Preferably, the method for preparing the triangular DNA origami comprises:

[0014] The M13mp18 scaffold chain, the staple chain and the capture chain are mixed in a buffer solution, and slowly cooled from 95°C to 25°C at a rate of 0.1°C / 10s for assembly to obtain the triangular DNA origami;

[0015] The staple chain is as shown in SEQ ID NO: 1-208;

[0016] The capture strands are shown in SEQ ID NOs: 209-211.

[0017] Preferably, the step of mixing the QKCMP peptide with the triangular DNA origami and then performing an annealing treatment comprises:

[0018] After mixing the QKCMP peptide with the triangular DNA origami, annealing was performed from 70-90°C to 25°C, and the mixture was repeated for at least three cycles;

[0019] Wherein, the annealing rate of the annealing treatment is 1°C / 8-10min.

[0020] The present invention also proposes a QKCMP peptide based on a triangular DNA origami nanostructure. The QKCMP peptide based on a triangular DNA origami nanostructure is prepared according to the above-mentioned preparation method.

[0021] The present invention also proposes an application of the QKCMP peptide based on the triangular DNA origami nanostructure, wherein the application comprises at least any one of the following:

[0022] A1) Application in promoting angiogenesis;

[0023] A2) Application in the preparation of products promoting angiogenesis;

[0024] A3) Application in promoting cell proliferation;

[0025] A4) Application in the preparation of products promoting cell proliferation;

[0026] A5) Application in the preparation of products for repairing vascular loss;

[0027] A6) Application in nano drug delivery;

[0028] A7) Application in establishing nano drug delivery system;

[0029] A8) Application in bioactive scaffolds.

[0030] The present invention also provides a nano drug delivery system, which comprises the QKCMP peptide based on the triangular DNA origami nanostructure.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] The present invention relates to the design and development of a QKCMP peptide release control system based on DNA origami nanomaterials. The system effectively promotes angiogenesis by precisely controlling the spatial distribution and release of QKCMP peptides, and provides an innovative bioactive scaffold material for the field of tissue engineering. The research work covers the design, self-assembly and purification process of DNA origami, as well as the synthesis and characterization of DNA origami nanomaterials (QKCMP Peptide-tDONs) loaded with vascular endothelial growth factor mimetic peptide QKCMP. In addition, it also includes the efficacy experiments of the material in promoting angiogenesis in vitro and in vivo. The present invention has opened up a new research direction for drug delivery systems based on DNA origami technology, and provides important theoretical support and experimental data for basic research and clinical application of angiogenesis. It is expected that through this research, an efficient, safe and controllable VEGF mimetic peptide delivery system can be developed to provide an innovative solution strategy for promoting angiogenesis and treating related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Various other advantages and benefits will become apparent to those of ordinary skill in the art by reading the detailed description of the preferred embodiments below. The accompanying drawings are only for the purpose of illustrating the preferred embodiments and are not to be considered as limiting the present invention. Moreover, the same reference symbols are used throughout the accompanying drawings to represent the same components. In the accompanying drawings:

[0034] Figure 1 The results of the synthesis and characterization of QKCMP Peptide-tDONs; A is the agarose gel electrophoresis analysis of QKCMP Peptide-tDONs (1) and tDONs (2) synthesized at different annealing temperatures; B is the morphology of QKCMP Peptide-tDONs at 5μm, 1μm and 300nm observed by atomic force microscopy (AFM); C is the bionic nanofibers of QKCMP Peptide-tDONs at different magnifications observed by scanning electron microscopy (SEM); D is the circular dichroism analysis of the spatial structure of QKCMP Peptide-tDONs and QKCMP Peptide; E is the Fourier transform infrared spectroscopy (FTIR) of QKCMP Peptide-tDONs, QKCMP Peptide and tDONs; F is the UV-vis analysis of QKCMP Peptide-tDONs at different concentrations; G is the UV-vis analysis of QKCMP Peptide-tDONs and QKCMP Zeta potential test results of peptide and tDONs;

[0035] Figure 2The peptide release profile of QKCMP Peptide-tDON and its ability to promote endothelial cell growth; A is the time-release percentage change curve of QKCMP Peptide released by QKCMP Peptide-tDONs in neutral (pH 7.4) and acidic (pH 1.2) environments; B is the quantitative analysis of CCK8 staining of HUVECs after treatment with different concentrations of QKCMP Peptide-tDONs and QKCMP Peptide for 48 hours; C is the EdU staining of HUVECs treated with 4μM QKCMP Peptide-tDONs, QKCMP Peptide, and tDONs for 48 hours, and a blank control group was set up; D is the quantitative analysis of EdU staining. Data are expressed as mean ± standard deviation; E is a scatter plot of apoptotic cells in each group detected by flow cytometry using Annexin V / PI double staining method; F is analysis of cell apoptosis rate (number of apoptotic cells / total number of cells × 100%); G is flow cytometry cell cycle analysis using propidium iodide (PI) DNA staining method; H is quantitative analysis of the proportion of cells in G0 / G1 phase (%); I is quantitative analysis of the proportion of cells in S phase (%);

[0036] Figure 3 QKCMP Peptide-tDONs promotes HUVECs activation ability; A is the number of HUVECs migrating from the upper chamber to the lower chamber of each group observed by crystal violet staining; B is the quantitative analysis of the number of migrating cells. Data are expressed as mean ± standard deviation; C is the tubular morphology of HUVECs in each group observed by Calcein staining; D is the quantitative analysis of the number of tubes formed in each group;

[0037] Figure 4 The effects of QKCMP Peptide-tDONs on the expression of angiogenesis-related proteins; A is the expression of Ki67, a proliferation-related protein observed in each group of HUVECs by immunofluorescence staining; B is the quantitative analysis of Ki67 protein expression (mean optical density); C is the expression of Erk1 / Erk2 protein observed in each group of HUVECs by immunofluorescence staining;

[0038] Figure 5 QK peptide-tDON promotes angiogenesis in zebrafish vascular defect model; A is the formation of subintestinal blood vessels (indicated by arrows in the area encircled by yellow dotted circles) of transgenic green fluorescent Fli-1 zebrafish in each group observed under a fluorescence microscope; B is the quantitative analysis of the area (pixels) of subintestinal blood vessels in zebrafish; C is the quantitative analysis of the number of subintestinal blood vessels in zebrafish;

[0039] Figure 6Figure 3 is the ability of QK peptide-tDON to promote rapid endothelialization of blood vessels in the mouse endothelial injury model; A is the Evans blue staining result of the vascular endothelium in the surgical site of the internal carotid artery of each group of mice; B is the HE staining image of the surgical site of the internal carotid artery of each group of mice, the black arrow points to the vascular endothelium, the blue arrow points to the plaque formation, and the red arrow points to the inflammatory infiltration. DETAILED DESCRIPTION

[0040] Exemplary embodiments of the present disclosure will be described in more detail below with reference to the accompanying drawings. Although exemplary embodiments of the present disclosure are shown in the accompanying drawings, it should be understood that the present disclosure can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present disclosure and to fully convey the scope of the present disclosure to those skilled in the art. It should be noted that, in the absence of conflict, the embodiments of the present invention and the features described in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0041] Example 1

[0042] 1. Materials and Instruments

[0043] All nucleotide chains (including staple chains and aptamers) were purchased from Shanghai Bioengineering Co., Ltd. (Shanghai, China). The staple chains were dissolved to a concentration of 100 μmol / L and stored in tubes. M13mp18 viral DNA was purchased from New England Biolabs, Inc., USA. Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) was purchased from Aladdin, Shanghai, China. All reagents were used directly without further purification. The ultrapure water used in the experiment was prepared by a Millipore ultrapure water purification system (resistivity of 18 MΩ·cm). Ultra-0.5mL 100kD ultrafiltration tubes were purchased from Merck Millipore, Germany. All origami or origami arrays were synthesized and annealed using a Bio-Rad T100 PCR instrument from the United States. Agarose gel electrophoresis (AGE) was characterized by a DYY-15D electrophoresis instrument from Beijing Liuyi Biotechnology Co., Ltd. and an Amersham Image 680 gel imager from the United States. The origami morphology was characterized by a Bruker Biotech, Germany. Icon TMAtomic force microscopy (AFM) was used to record the morphology of the composites. The morphology of the composites was characterized by a Sigma-500 scanning electron microscope from the United States. The Zeta potential was measured by a Zeta potential measuring instrument from Malvern Panalytical, UK, and the infrared spectra were recorded by a Fourier transform infrared spectrometer from PerkinElmer, USA. The ultraviolet-visible light spectrum (UV–VIS) was recorded by a Japanese SHIMADZU-1901 spectrometer. The spatial structural changes of the samples were observed by scanning with a circular dichroism spectrometer from Jasco, Japan. Human primary umbilical vein endothelial cells (HUVEC) were purchased from OBiO Biotechnology, China. HUVEC cell culture medium was provided by icellbioscience (China), EdU staining kit and PI staining agent were purchased from Beyotime, China, CCK8 detection kit and Annexin V-FITC / PI apoptosis detection kit were purchased from YEASEN, China, Matrigel was purchased from Corning, USA, 4% paraformaldehyde, 0.1% Triton, Hoechst33258 and H&E staining kit were purchased from Beyotime, China, Erk1 / Erk2 and Ki67 antibodies were purchased from Abcam, USA, FITC–conjugated Affinipure Goat and CY3–conjugated Affinipure Goat were purchased from Proteintech, USA. An inverted fluorescence microscope (OLYMPUS, Japan) was used to observe the fluorescence staining. Zebrafish were processed and observed under the microscope using a dissecting microscope (SZX7), a microinjector (IM300, Narishige, Japan) and a motorized focus continuous zoom fluorescence microscope (AZ100, Nikon, Japan) from OLYMPUS, Japan.

[0044] The amino acid sequence of the QKCMP peptide is Ac-KLTWQELYQLKYKGIGGG(POG.

[0045] SEQ ID NO: 1-208:

[0046] A01: CGGGGTTTCCTCAAGAGAAGGATTTTGAATTA;

[0047] A02: AGCGTCATGTCTCTGAATTTACCGACTACCTT;

[0048] A03:TTCATAATCCCCTTATTAGCGTTTTTCTTACC;

[0049] A04:ATGGTTTATGTCACAATCAATAGATATTAAAC;

[0050] A05:TTTGATGATTAAGAGGCTGAGACTTGCTCAGTACCAGGCG;

[0051] A08:GACGGGAGAATTAACTCGGAATAAGTTTATTTCCAGCGCC;

[0052] A09:GATAAGTGCCGTCGAGCTGAAACATGAAAGTATACAGGAG;

[0053] A10:TGTACTGGAAATCCTCATTAAAGCAGAGCCAC;

[0054] A11:CACCGGAAAGCGCGTTTTCATCGGAAGGGCGA;

[0055] A12:CATTCAACAAACGCAAAGACACCAGAACACCCTGAACAAA;

[0056] A13:TTTAACGGTTCGGAACCTATTATTAGGGTTGATATAAGTA;

[0057] A14:CTCAGAGCATATTCACAAACAAATTAATAAGT;

[0058] A15:GGAGGGAATTTAGCGTCAGACTGTCCGCCTCC;

[0059] A16:GTCAGAGGGTAATTGATGGCAACATATAAAAGCGATTGAG;

[0060] A17:TAGCCCGGAATAGGTGAATGCCCCCTGCCTATGGTCAGTG;

[0061] A20:TTGACGGAAATACATACATAAAGGGCGCTAATATCAGAGA;

[0062] A21:CAGAGCCAGGAGGTTGAGGCAGGTAACAGTGCCCG;

[0063] A22:ATTAAAGGCCGTAATCAGTAGCGAGCCACCCT;

[0064] A23:GATAACCCACAAAGATGTTAGCAAACGTAAAATTATTC!

[0065] A24:GCCGCCAGCATTGACACCACCCTC:

[0066] A25:AGAGCCGCACCATCGATAGCAGCATGAATTAT;

[0067] A26:CACCGTCACCTTATTACGCAGTATTGAGTTAAGCCATA;

[0068] A27: ACCATTTAAACGTCACCAATGAACACCAGAACCA!

[0069] A28:ATAAGAGCAAAAACATGGCATGATTAAGACTCCGACTTG?

[0070] A29:CCATTAGCAAGGCCGGGGGAATTA!

[0071] A30:GAGCCAGCGAATACCCAAAAGAACATGAAATAGCAATAGC:

[0072] A31: TATCTTACCGAAGCCCAAACGCAATAATAACGAAAATCACCAG:

[0073] A32:CAGAAACCGAGGTTTTTAAAAAGTAAGCAGATAGCCG?

[0074] A33:CCTTTTTTCATTTAACAATTTCATAGGATTAG:

[0075] A34:TTTAACCTATCATAGGTCTGAGAGTTCCAGTA!

[0076] A35:AGTATAAAATATGCGTTACAAAGCCATCTT!

[0077] A36:CAAGTACCTCATTCCAAGAACGGGAAAATTCAT;

[0078] A37:GAGAATAACATAAAAACAGGGAAGCGCATTA!

[0079] A38:AAAACAAAATTAATTAAATGGAAACAGTACATTAGTGAAT;

[0080] A41:TTTCCTTAGCACTCATCGAGAACAATAGCAGCCTTTACAG;

[0081] A42:AGAGTCAAAAATCAATATATGTGATGAAACAAACATCAAG;

[0082] A43:ACTAGAAATATATAACTATATGTACGCTGAGA;

[0083] A44:TCAATAATAGGGCTTAATTGAGAATCATAATT;

[0084] A45:AACGTCAAAAATGAAAAGCAAGCCGTTTTTATGAAACCAA;

[0085] A46:GAGCAAAAGAAGATGAGTGAATAACCTTGCTTATAGCTTA;

[0086] A47:GATTAAGAAATGCTGATGCAAATCAGAATAAA;

[0087] A48:CACCGGAATCGCCATATTTAACAAAATTTACG;

[0088] A49:AGCATGTATTTCATCGTAGGAATCAAACGATTTTTTGTTT;

[0089] A50:ACATAGCGCTGTAAATCGTCGCTATTCATTTCAATTACCT;

[0090] A53:TCCCAATCCAAATAAGATTACCGCGCCCAATAAATAATAT;

[0091] A54:TCCCTTAGAATAACGCGAGAAAACTTTTACCGACC;

[0092] A55:GTGTGATAAGGCAGAGGCATTTTCAGTCCTGA;

[0093] A56:ACAAGAAAGCAAGCAAATCAGATAACAGCCATATTATTTA;

[0094] A57:GTTTGAAATTCAAATATATTTTAG;

[0095] A58:AATAGATAGAGCCAGTAATAAGAGATTTAATG;

[0096] A59:GCCAGTTACAAAATAATAGAAGGCTTATCCGGTTATCAAC;

[0097] A60:TTCTGACCTAAAATATAAAGTACCGACTGCAGAAC;

[0098] A61:GCGCCTGTTATTCTAAGAACGCGATTCCAGAGCCTAATTT;

[0099] A62:TCAGCTAAAAAAGGTAAAGTAATT;

[0100] A63:ACGCTAACGAGCGTCTGGCGTTTTAGCGAACCCAACATGT;

[0101] A64:ACGACAATAAATCCCGACTTGCGGGAGATCCTGAATCTTACCA;

[0102] A65:TGCTATTTTGCACCCAGCTACAATTTTGTTTTGAAGCCTTAAA;

[0103] B01:TCATATGTGTAATCGTAAAACTAGTCATTTTC;

[0104] B02:GTGAGAAAATGTGTAGGTAAAGATACAACTTT;

[0105] B03:GGCATCAAATTTGGGGCGCGAGCTAGTTAAAG;

[0106] B04:TTCGAGCTAAGACTTCAAATATCGGGAACGAG;

[0107] B05:ACAGTCAAAGAGAATCGATGAACGACCCCGGTTGATAATC;

[0108] B08:GAATACCACATTCAACTTAAGAGGAAGCCCGATCAAAGCG;

[0109] B09:AGAAAAGCCCCAAAAAGAGTCTGGAGCAAACAATCACCAT;

[0110] B10:CAATATGACCCTCATATATTTTAAAGCATTAA;

[0111] B11:CATCCAATAAATGGTCAATAACCTCGGAAGCA;

[0112] B12:AACTCCAAGATTGCATCAAAAAGATAATGCAGATACATAA;

[0113] B13:CGTTCTAGTCAGGTCATTGCCTGACAGGAAGATTGTATAA;

[0114] B14:CAGGCAAGATAAAAATTTTTAGAATATTCAAC;

[0115] B15:GATTAGAGATTAGATACATTTCGCAAATCATA;

[0116] B16:CGCCAAAAGGAATTACAGTCAGAAGCAAAGCGCAGGTCAG;

[0117] B17:GCAAATATTTAAATTGAGATCTACAAAGGCTACTGATAAA;

[0118] B20:TAATTGCTTTACCCTGACTATTATGAGGCATAGTAAGAGC;

[0119] B21:ATAAAGCCTTTGCGGGAGAAGCCTGGAGAGGGTAG;

[0120] B22:TAAGAGGTCAATTCTGCGAACGAGATTAAGCA;

[0121] B23:AACACTATCATAACCCATCAAAAATCAGGTCTCCTTTTGA;

[0122] B24:ATGACCCTGTAATACTTCAGAGCA;

[0123] B25:TAAAGCTATATAACAGTTGATTCCCATTTTTG;

[0124] B26:CGGATGGCACGAGAATGACCATAATCGTTTACCAGACGAC;

[0125] B27:TAATTGCTTGGAAGTTTCATTCCAAATCGGTTGTA;

[0126] B28:GATAAAAACCAAAATATTAAACAGTTCAGAAATTAGAGCT;

[0127] B29:ACTAAAGTACGGTGTCGAATATAA;

[0128] B30:TGCTGTAGATCCCCCTCAAATGCTGCGAGAGGCTTTTGCA;

[0129] B31:AAAGAAGTTTTGCCAGCATAAATATTCATTGACTCAACATGTT;

[0130] B32:AATACTGCGGAATCGTAGGGGGTAATAGTAAAATGTTTAGACT;

[0131] B33:AGGGATAGCTCAGAGCCACCACCCCATGTCAA;

[0132] B34:CAACAGTTTATGGGATTTTGCTAATCAAAAGG;

[0133] B35:GCCGCTTTGCTGAGGCTTGCAGGGGAAAAGGT;

[0134] B36:GCGCAGACTCCATGTTACTTAGCCCGTTTTAA;

[0135] B37:ACAGGTAGAAAGATTCATCAGTTGAGATTTAG;

[0136] B38:CCTCAGAACCGCCACCCAAGCCCAATAGGAACGTAAATGA;

[0137] B41:CGACCTGCGGTCAATCATAAGGGAACGGAACAACATTATT;

[0138] B42:AGACGTTACCATGTACCGTAACACCCCTCAGAACCGCCAC;

[0139] B43:CACGCATAAGAAAGGAACAACTAAGTCTTTCC;

[0140] B44:ATTGTGTCTCAGCAGCGAAAGACACCATCGCC;

[0141] B45:TTAATAAAACGAACTAACCGAACTGACCAACTCCTGATAA;

[0142] B46:AGGTTTAGTACCGCCATGAGTTTCGTCACCAGGATCTAAA;

[0143] B47:GTTTTGTCAGGAATTGCGAATAATCCGACAAT;

[0144] B48:GACAACAAGCATCGGAACGAGGGTGAGATTTG;

[0145] B49:TATCATCGTTGAAAGAGGACAGATGGAAGAAAAATCTACG;

[0146] B50:AGCGTAACTACAAACTACAACGCCTATCACCGTACTCAGG;

[0147] B53:ACCAGTCAGGACGTTGGAACGGTGTACAGACCGAAACAAA;

[0148] B54:ACAGACAGCCCAAATCTCCAAAAAAAAATTTCTTA;

[0149] B55:AACAGCTTGCTTTGAGGACTAAAGCGATTATA;

[0150] B56:CCAAGCGCAGGCGCATAGGCTGGCAGAACTGGCTCATTAT;

[0151] B57:CGAGGTGAGGCTCCAAAAGGAGCC;

[0152] B58:ACCCCCAGACTTTTTCATGAGGAACTTGCTTT;

[0153] B59:ACCTTATGCGATTTTATGACCTTCATCAAGAGCATCTTTG;

[0154] B60:CGGTTTATCAGGTTTCCATTAAACGGGAATACACT;

[0155] B61:AAAACACTTAATCTTGACAAGAACTTAATCATTGTGAATT;

[0156] B62:GGCAAAAGTAAAATACGTAATGCC;

[0157] B63:TGGTTTAATTTCAACTCGGATATTCATTACCCACGAAAGA;

[0158] B64:ACCAACCTAAAAAATCAACGTAACAAATAAATTGGGCTTGAGA;

[0159] B65:CCTGACGAGAAACACCAGAACGAGTAGGCTGCTCATTCAGTGA;

[0160] Link-A1C:TTAATTAATTTTTTACCATATCAAA;

[0161] Link-A2C:TTAATTTCATCTTAGACTTTACAA;

[0162] Link-A3C:CTGTCCAGACGTATACCGAACGA;

[0163] Link-A4C:TCAAGATTAGTGTAGCAATACT;

[0164] Link-B1A:TGTAGCATTCCTTTTATAAACAGTT;

[0165] Link-B2A:TTTAATTGTATTTCCACCAGAGCC;

[0166] Link-B3A:ACTACGAAGGCTTAGCACCATTA;

[0167] Link-B4A:ATAAGGCTTGCAACAAAGTTAC;

[0168] Link-C1B:GTGGGAACAAATTTCTATTTTTGAG;

[0169] Link-C2B:CGGTGCGGGCCTTCCAAAAACATT;

[0170] Link-C3B:ATGAGTGAGCTTTTAAATATGCA;

[0171] Link-C4B:ACTATTAAAGAGGATAGCGTCC;

[0172] Loop:GCGCTTAATGCGCCGCTACAGGGC;

[0173] C01:TCGGGAGATATACAGTAACAGTACAAATAATT;

[0174] C02:CCTGATTAAAGGAGCGGAATTATCTCGGCCTC;

[0175] C03:GCAAATCACCTCAATCAATATCTGCAGGTCGA;

[0176] C04:CGACCAGTACATTGGCAGATTCACCTGATTGC;

[0177] C05:TGGCAATTTTTAACGTCAGATGAAAACAATAACGGATTCG;

[0178] C08:TTGACGAGCACGTATACTGAAATGGATTATTTAATAAAAG;

[0179] C09:CCTGATTGCTTTGAATTGCGTAGATTTTCAGGCATCAATA;

[0180] C10:TAATCCTGATTATCATTTTGCGGAGAGGAAGG;

[0181] C11:TTATCTAAAGCATCACCTTGCTGATGGCCAAC;

[0182] C12:AGAGATAGTTTGACGCTCAATCGTACGTGCTTTCCTCGTT;

[0183] C13:GATTATACACAGAAATAAAGAAATACCAAGTTACAAAATC;

[0184] C14:TAGGAGCATAAAAGTTTGAGTAACATTGTTTG;

[0185] C15:TGACCTGACAAATGAAAAATCTAAAATATCTT;

[0186] C16:AGAATCAGAGCGGGAGATGGAAATACCTACATAACCCTTC;

[0187] C17:GCGCAGAGGCGAATTAATTATTTGCACGTAAATTCTGAAT;

[0188] C20:GAATACGTAACAGGAAAAACGCTCCTAAACAGGAGGCCGA;

[0189] C21:TCAATAGATATTAAATCCTTTGCCGGTTAGAACCT;

[0190] C22:CAATATTTGCCTGCAACAGTGCCATAGAGCCG;

[0191] C23:TTAAAGGGATTTTAGATACCGCCAGCCATTGCGGCACAGA;

[0192] C24:ACAATTCGACAACTCGTAATACAT;

[0193] C25:TTGAGGATGGTCAGTATTAACACCTTGAATGG;

[0194] C26:CTATTAGTATATCCAGAACAATATCAGGAACGGTACGCCA;

[0195] C27:CGCGAACTAAAACAGAGGTGAGGCTTAGAAGTATT;

[0196] C28:GAATCCTGAGAAGTGTATCGGCCTTGCTGGTACTTTAATG;

[0197] C29:ACCACCAGCAGAAGATGATAGCCC;

[0198] C30:TAAAACATTAGAAGAACTCAAACTTTTTATAATCAGTGAG;

[0199] C31:GCCACCGAGTAAAAGAACATCACTTGCCTGAGCGCCATTAAAA;

[0200] C32:TCTTTGATTAGTAATAGTCTGTCCATCACGCAAATTAACCGTT;

[0201] C33:CGCGTCTGATAGGAACGCCATCAACTTTTACA;

[0202] C34:AGGAAGATGGGGACGACGACAGTAATCATATT;

[0203] C35:CTCTAGAGCAAGCTTGCATGCCTGGTCAGTTG;

[0204] C36:CCTTCACCGTGAGACGGGCAACAGCAGTCACA;

[0205] C37:CGAGAAAGGAAGGGAAGCGTACTATGGTTGCT;

[0206] C38:GCTCATTTTTTAACCAGCCTTCCTGTAGCCAGGCATCTGC;

[0207] C41:TTTCACCAGCCTGGCCCTGAGAGAAAGCCGGCGAACGTGG;

[0208] C42:GTAACCGTCTTTCATCAACATTAAAATTTTTGTTAAATCA;

[0209] C43:ACGTTGTATTCCGGCACCGCTTCTGGCGCATC;

[0210] C44:CCAGGGTGGCTCGAATTCGTAATCCAGTCACG;

[0211] C45:TAGAGCTTGACGGGGAGTTGCAGCAAGCGGTCATTGGGCG;

[0212] C46:GTTAAAATTCGCATTAATGTGAGCGAGTAACACACGTTGG;

[0213] C47:TGTAGATGGGTGCCGGAAACCAGGAACGCCAG;

[0214] C48:GGTTTTCCATGGTCATAGCTGTTTGAGAGGCG;

[0215] C49:GTTTGCGTCACGCTGGTTTGCCCCAAGGGAGCCCCCGATT;

[0216] C50:GGATAGGTACCCGTCGGATTCTCCTAAACGTTAATATTTT;

[0217] C53:CTAAATCGGAACCCTAAGCAGGCGAAAATCCTTCGGCCAA;

[0218] C54:CGGCGGATTGAATTCAGGCTGCGCAACGGGGGATG;

[0219] C55:TGCTGCAAATCCGCTCACAATTCCCAGCTGCA;

[0220] C56:TTAATGAAGTTTGATGGTGGTTCCGAGGTGCCGTAAAGCA;

[0221] C57:TGGCGAAATGTTGGGAAGGGCGAT;

[0222] C58:TGTCGTGCACACAACATACGAGCCACGCCAGC;

[0223] C59:CAAGTTTTTTGGGGTCGAAATCGGCAAAATCCGGGAAACC;

[0224] C60:TCTTCGCTATTGGAAGCATAAAGTGTATGCCCGCT;

[0225] C61:TTCCAGTCCTTATAAATCAAAAGAGAACCATCACCCAAAT;

[0226] C62:GCGCTCACAAGCCTGGGGTGCCTA;

[0227] C63:CGATGGCCCACTACGTATAGCCCGAGATAGGGATTGCGTT;

[0228] C64:AACTCACATTATTGAGTGTTGTTCCAGAAACCGTCTATCAGGG;

[0229] C65:ACGTGGACTCCAACGTCAAAGGGCGAATTTGGAACAAGAGTCC:

[0230] A51-A15:AAAAAAAAAAAAAAAAGTTAAATACAATCGCAAAAGCCTTGAAA;

[0231] A39-A15:AAAAAAAAAAAAAAATTATCAAACCGGCTTAGGTTGGGTAAGCCTGT;

[0232] A06-A15:AAAAAAAAAAAAAAAAACCGGACCCAGAATGGAAAAGCGCAACATGGCT?

[0233] A18-A15:AAAAAAAAAAAAAAACCTTGAGTCAGACGATTGGCCTTGCGCACCC!

[0234] A52-A15:AAAAAAAAAAAAAAAAACCCATCCTCGCCAACATGTAATTTAATAAGGC;

[0235] A40-A15:AAAAAAAAAAAAAAAAATTAGTATCGCCAACGCTCAACAGGTCGGCTGTC?

[0236] A07-A15:AAAAAAAAAAAAAAAAAAAAGAACATTTCGGTCATAGCCAAAATCA!

[0237] A19-A15:AAAAAAAAAAAAAAAAATCAGAACCCAATCAAGTTTGCCGGTAAATA;

[0238] B51-A15:AAAAAAAAAAAAAAAAATAGTTGCGAATTTTTTCCACGTTGATCATAGTT;

[0239] B39-A15:AAAAAAAAAAAAAAAATTCTCTCAGCGGAGTGAGAATACCCATAT;

[0240] B06-A15:AAAAAAAAAAAAAAAAAATAGTAGTATGCAATGCCTGAGTAGGCCGGAG!

[0241] B18-A15:AAAAAAAAAAAAAAATTAATGCCTTATTTCAACGCAAGGGCAAAGAA;

[0242] B52-A15:AAAAAAAAAAAAAAAGTACAACGAGCAACGGCTACAGAGGATACCGA;

[0243] B40-A15:AAAAAAAAAAAAAAAATTCGGTCTGCGGGATCGTCACCCGAAATCCG;

[0244] B07-A15:AAAAAAAAAAAAAAAAACCAGACGTTTAGCTATATTTTCTTCTACTA;

[0245] B19-A15:AAAAAAAAAAAAAAATTAGCAAATAGATTTAGTTTGACCAGTACCTT;

[0246] C51-A15:AAAAAAAAAAAAAAAAGTTGGGTCAAAGCGCCATTCGCCCCGTAATG;

[0247] C39-A15:AAAAAAAAAAAAAAACAGTTTGACGCACTCCAGCCAGCTAAACGACG;

[0248] C06-A15:AAAAAAAAAAAAAAAAAGGAATTACAAAGAAACCACCAGTCAGATGA;

[0249] C18-A15:AAAAAAAAAAAAAAAAATGGAAGCGAACGTTATTAATTTCTAACAAC;

[0250] C52-A15:AAAAAAAAAAAAAAACGCGCGGGCCTGTGTGAAATTGTTGGCGATTA;

[0251] C40-A15:AAAAAAAAAAAAAAAGCCAGTGCGATCCCCGGGTACCGAGTTTTTCT;

[0252] C07-A15:AAAAAAAAAAAAAAAGGACATTCACCTCAAATATCAAACACAGTTGA;

[0253] C19-A15:AAAAAAAAAAAAAAAATAATAGATCGCTGAGAGCCAGCAGAAGCGTAA;

[0254] The capture strands are SEQ ID NOs: 208-211:

[0255] A01': CGGGGTTTCCTCAAGAGAAGGATTTTAAAAAAAAAAAAAAAAAAAAAAAAAAA;

[0256] B01':TCATATGTGTAATCGTAAAACTAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAA;

[0257] C01': TCGGGAGATATACAGTAACAGTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.

[0258] 2. Preparation and Experiment of QKCMP Peptide-tDONs

[0259] The following experiments were performed using one-way or two-way analysis of variance (ANOVA) and Tukey post hoc test to determine statistical significance. (*P < 0.05, **P < 0.01, ***P < 0.005 or ****P < 0.001). (Prism 9.0, GraphPad Software). All research results are combined and presented as mean and standard deviation.

[0260] 1. Design, self-assembly and purification of tDONs origami

[0261] According to the research results published by Rothemund in the journal Nature in 2006, this study selected the more mature triangular DNA origami (tDONs) as the research object, and further modified the short chains on its surface. The construction of tDONs is based on a single DNA strand containing 7249 bases as the scaffold chain and 208 short chains of complementary sequences as the connecting chain, which are formed through the PCR annealing process. The specific operation steps are as follows: First, mix equal volumes of short chains and dilute to 500nmol / L for use; similarly, the capture chains are also mixed and diluted to the same concentration for use. Next, the M13mp18 scaffold chain (concentration of 100nmol / L) is mixed with the connecting chain and the capture chain in a molar ratio of 1:10:10 and in 1×TAE-Mg 2+The buffer solution (containing Tris 40mmol / L, acetic acid 20mmol / L, EDTA-2Na 2mmol / L, magnesium acetate 12.5mmol / L, pH 8.0) was slowly cooled from 95℃ to 25℃ in a PCR instrument at a rate of 0.1℃ per 10 seconds to complete the assembly. The synthesized origami mixture was centrifuged through an Ultra-0.5mL 100kD ultrafiltration tube to remove excess short chains, thereby obtaining high-purity tDONs. The mixing ratio of the scaffold chain M13mp18 and the connecting chain was a molar concentration ratio of 1:10 (for detailed reaction system and nucleic acid sequence, please refer to Tables 1 and 2).

[0262] Table 1

[0263] Element Volume (μL) M13mp18 scaffolding chain 2.5 Staples Strands 5 Capture Strands 5 10×TAE-Mg2+ buffer solution 10 Ultrapure water 77.5

[0264] Table 2

[0265] Name Sequence(5'to3') A01’ CGGGGTTTCCTCAAGAGAAGGATTTTAAAAAAAAAAAAAAAAAAAAAAAAAAA B01’ TCATATGTGTAATCGTAAAACTAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAA C01’ TCGGGAGATATACAGTAACAGTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0266] 2. Preparation of QKCMP Peptide-tDONs

[0267] The QKCMP peptide was mixed with the triangular DNA origami equipped with the polypeptide capture chain at a molar concentration ratio of 9:1, 8:2, 7:3, 6:4, and 5:5, and then placed in a PCR instrument for annealing. The annealing program was cooling from 90°C, 80°C, or 70°C to 25°C, and the cooling rate was 1°C every 8 minutes. This process was repeated three times. The purified QKCMP peptide-tDONs were analyzed by agarose gel electrophoresis and separated using 1% agarose gel (using Gene Green staining, the electrophoresis buffer was 0.5×TBE, containing 1mmol / L Mg 2+ , electrophoresis at 100 volts for 40 minutes in an ice-water bath), and then imaging under ultraviolet irradiation. The clarity of the band reflects the purity, and the appropriate annealing temperature is selected accordingly. At the same time, the mixture of QKCMP polypeptide and tDONs in different ratios was co-cultured with human bone marrow mesenchymal stem cells (BMSCs), and cytotoxicity was tested according to the instructions of the CCK-8 kit (Biyuntian, China) to screen out the best synthesis ratio.

[0268] Figure 1The experimental results of A showed that both tDON and QKCMP Peptide-tDONs exhibited clear DNA bands with molecular weights between approximately 2500-2700bp. The band position of tDON was slightly higher than that of QKCMP Peptide-tDONs, because the introduction of the polypeptide led to a slowdown in the electrophoretic migration rate, thus verifying the successful synthesis of QKCMP Peptide-tDONs. No other bands were observed in the two lanes, indicating that the DNA origami treated with three centrifugations and the origami with added polypeptides had successfully removed most of the excess short chains and had good dispersion without adhesion or agglomeration. By optimizing the four annealing temperatures, it was found that there was an obvious band at 8000bp under 70°C, indicating that the purity of the purified material was insufficient. Under 90°C, the bands appeared clearer.

[0269] 3. Characterization of tDONs and QKCMP Peptide-tDONs

[0270] The sample needs to be 1×TAE-Mg 2+ The buffer solution was diluted twenty times, and then 5 μl was placed on the newly dissociated mica sheet. After adsorption for five minutes, it was rinsed with 200 μl of ultrapure water and dried with nitrogen. After that, the atomic force microscope (AFM) was used for imaging in the gas phase ScanAsyst mode. Another 5 μl sample was placed on a copper grid, adsorbed for five minutes, dried with nitrogen and sprayed with gold, and finally imaged in a Sigma-500 scanning electron microscope. The spatial structure of the QKCMP peptide-tDON complex and the QKCMP peptide was analyzed by circular dichroism. The infrared absorption peak position and intensity of the QKCMP peptide-tDON complex, QKCMP peptide and tDON were detected by Fourier transform infrared spectrometer to characterize the structural characteristics of the sample. The absorbance of the QKCMP peptide-tDON complex of different concentrations was analyzed by UV-vis for qualitative and quantitative analysis, and the Zeta potential distribution of the QKCMP peptide-tDON complex, QKCMP peptide and tDON in the buffer was further characterized.

[0271] The QKCMP Peptide-tDON morphology was carefully observed using an atomic force microscope (AFM). The results showed that at 5μm, 1μm and 300nm, the texture of the material was clearly visible, the morphology was complete, the synthesis efficiency was high and the dispersion was good, and there was no significant reduction in the material structure. The height was analyzed using the section function of the NanoScope Analysis software, and it was found that the height of the origami was about 10nm. The size measurement showed that the outer length of the triangle was about 120nm (see Figure 1B), which is consistent with the tDONs reported in previous studies, indicating that the addition of QKCMP Peptide did not change the overall structural characteristics of tDON. Scanning electron microscopy further revealed the biomimetic nanofiber structure of QKCMPPeptide-tDON (see Figure 1 C). The results of circular dichroism analysis showed that the spatial structure of QKCMP Peptide-tDONs was similar to that of QKCMP Peptide, indicating that tDONs did not affect the spatial structure of QKCMP Peptide (see Figure 1 D). FTIR infrared spectrum detection results also showed that QKCMP Peptide-tDONs had characteristic peaks similar to those of QKCMP Peptide and tDONs, further confirming the successful synthesis of QKCMPPeptide-tDONs (see Figure 1 E). In addition, DNA and polypeptide have UV absorption peaks at 260nm and 280nm respectively. UV absorption spectra of QKCMP Peptide-tDONs with different concentrations were detected by UV-vis analysis, and it was found that the UV absorption peak value was between the two and showed a single peak (see Figure 1 F), indicating that a complex of tDON and QKCMP Peptide was formed, and the absorbance increased gradually with increasing concentration. Furthermore, the surface charge distribution of tDONs, QKCMP Peptide, and QKCMP Peptide-tDONs in buffer was evaluated by Zeta potential analysis (see Figure 1 G), since the pH value of the buffer is higher than the isoelectric point of QKCMP Peptide, the potentials of QKCMP Peptide and QKCMP Peptide-tDONs are both negative.

[0272] 4. CCK8 assay to detect cell viability

[0273] Human umbilical vein endothelial cells (HUVEC) were cultured at 1×10 4The cells were seeded in 96-well plates at a density of 10 cells / mL and cultured in a complete medium (DMEM / F12, containing 10% fetal bovine serum and 1% antibiotic-antimycotic) at 37°C in a 5% CO2 incubator until the cells reached 70-80% adhesion. Except for the control group, the other groups were added with corresponding treatments: 0, 0.125, 0.25, 0.5, 1, 2, and 4 nanomoles of tDON nanomaterials were added to the tDON group; 0, 0.125, 0.25, 0.5, 1, 2, and 4 nanomoles of QKCMP peptides were added to the peptide-tDON group; 0, 0.125, 0.25, 0.5, 1, 2, and 4 nanomoles of QKCMP peptide-tDON were added to the peptide-tDON group. The culture was then continued for 48 hours to evaluate the long-term effects of the treatments on the cells. The absorbance was measured using the CCK8 kit to evaluate cell viability. 20 μl of CCK-8 reagent was added to each well and incubated for 2 hours in the dark. The optical density was measured at 450 nm using an ELISA reader to analyze cell growth. The experiment was repeated three times and the data are presented as mean ± standard deviation.

[0274] In order to further study the optimization of the synthesis ratio, we used CCK8 experiments and live-dead cell staining techniques to anneal the mixture of QKCMP peptide and tDONs at different ratios (9:1, 8:2, 7:3, 6:4, 5:5) at 90°C to 25°C, and annealed at a rate of 1°C / 8 minutes for three cycles, and then further analyzed the cytotoxicity of bone marrow mesenchymal stem cells (BMSCs). The study found that QKCMP peptide-tDONs synthesized in different ratios showed a proliferation-promoting effect on BMSCs, with improved cell viability and an increase in the number of live cells. Among them, the QKCMP peptide-tDONs synthesized at a ratio of 8:2 had the most significant effect, indicating that when the QKCMP peptide and tDONs were mixed and reacted at a ratio of 8:2, the amount of QKCMP peptide-tDONs generated was the largest. Based on this, we finally decided to mix QKCMP peptide and tDONs in a ratio of 8:2, and perform annealing treatment from 90°C to 25°C, repeating three cycles at a rate of 1°C / 8 minutes to synthesize QKCMP peptide-tDONs for subsequent in vitro and in vivo experimental studies.

[0275] 5. EdU assay to detect cell proliferation ability

[0276] By implementing EdU (5-ethynyl-2'-deoxyuridine) staining experiments, the DNA synthesis activity of cells can be evaluated, and then the proliferation ability of cells can be determined. In this experiment, a 10μM concentration of EdU labeling solution was added to the culture medium. After the cells absorbed EdU, the Click-iT EdU staining kit (provided by Thermo Fisher Scientific, USA) was used to detect the status of DNA synthesis in the cells. By quantitatively analyzing the number of cells marked as EdU positive, and ensuring that the experiment was repeated three times, the obtained data were presented in the form of mean plus or minus standard deviation.

[0277] Figure 2 The data shown in A reveal that in a neutral solution environment, the immediate peptide release of QKCMP Peptide-tDONs accounted for 4.40±0.44% of the total loaded peptides, and the release reached 20.60%±0.60% after 2 hours. In the next 12 hours, the peptide release increased significantly, with a total release of 62.77%±0.50%. At 24 hours, the cumulative release reached 69.83%±0.30%. The release process showed a curve growth trend over time. In contrast, in an acidic solution, the immediate, 2-hour, 12-hour and 24-hour releases of QKCMP Peptide were 1.13%±0.06%, 3.20%±0.17%, 18.07%±0.21% and 27.4%±0.26%, respectively, and its release rate was significantly lower than that in a neutral solution. This phenomenon can be attributed to the fact that polypeptide proteins tend to be released at the isoelectric point, while acidic conditions are not conducive to the dissociation of QKCMP Peptide. In addition, these results also indicate the potential application value of QKCMP Peptide-tDONs in promoting angiogenesis in vivo.

[0278] We dissolved QKCMP Peptide-tDONs in phosphate buffered saline (PBS), and after two hours of preparation, co-acted with equal concentrations of QKCMP peptide on human umbilical vein endothelial cells (HUVEC). The effects of different concentration gradients of QKCMP Peptide and its derivative QKCMP Peptide-tDONs on the viability of HUVECs cells were detected by cell counting kit-8 (CCK8) after 48 hours of intervention. The results showed that compared with the control group, both could promote the viability of HUVEC cells and showed dose-dependency within a certain concentration range. However, the cell viability of the QKCMP Peptide-tDONs group was significantly higher than that of the QKCMP Peptide group at the same concentration (P < 0.001), indicating that QKCMP Peptide-tDONs has a significant QKCMP Peptide sustained-release effect (see Figure 2B). Based on this finding, we selected 4 μg / ml QKCMPPeptide-tDONs for subsequent in vitro experiments. Further EdU staining results also showed that compared with QKCMP Peptide, QKCMP Peptide-tDONs showed a more significant ability to promote HUVEC cell proliferation, and the proportion of EdU-positive cells increased significantly (P < 0.001, see Figure 2 C. Figure 2 D).

[0279] 6. Annexin V-FITC / PI method to detect cell apoptosis

[0280] First, the cells were digested using EDTA-free trypsin to prevent the digestion time from being too long, thereby avoiding adverse effects on the binding ability of phosphatidylserine on the cell membrane to Annexin V-FITC. After digestion, the cells were collected by centrifugation at 1500 rpm for 5 minutes at room temperature. Subsequently, the cells were resuspended in 1×PBS precooled to 4°C and centrifuged again for 5 minutes under the same conditions to wash the cells. The cells were resuspended in 300 μL of 1×BindingBuffer, 5 μL of Annexin V-FITC was added, mixed well, and incubated at room temperature for 15 minutes in the dark. Then, 10 μL of PI dye was added, the cells were gently mixed, and incubated at room temperature for 10 minutes in the dark. Finally, flow cytometry was used for detection, and the results were analyzed with the help of FlowJo 7.6 software. According to the fluorescence intensity of Annexin V-FITC and PI, the cell population was divided into live cells, early apoptotic cells, and late apoptotic or necrotic cells. The results were visualized by double-staining scatter plots (Annexin V-FITC vs. PI), and the proportion of each cell population was calculated, and then the cell apoptosis rate among different experimental groups was statistically analyzed.

[0281] Flow cytometry analysis showed that QKCMP peptide-tDONs showed a more significant anti-apoptotic effect compared with QKCMP peptide, and the proportion of apoptotic cells was significantly lower (P < 0.005, see Figure 2 E. Figure 2 F).

[0282] 7. PI method to detect cell cycle

[0283] The cell cycle of each group of cells was detected. After the cells were collected, 100 μL of 50 μg / mL RNase solution was added and incubated in a water bath at 37 degrees Celsius for 30 minutes. Subsequently, 400 μL of 50 μg / mL PI solution was added and stained at 4 degrees Celsius for 30 minutes in the dark. Flow cytometry was used for detection. The results were analyzed using FlowJo 7.6 software to exclude cell debris and aggregated cells to ensure that the analysis object was a single cell. According to the fluorescence intensity of PI staining, the cells were divided into G0 / G1 phase, S phase and G2 / M phase, and the proportion of cells in each phase was calculated, and then the differences in cell cycle distribution between different experimental groups were statistically analyzed.

[0284] Further cell cycle analysis revealed that the proportion of HUVECs in the G0 / G1 phase in the QKCMP peptide-tDONs group was significantly decreased compared with that in the QKCMP peptide group (P < 0.01, see Figure 2 G. Figure 2 H), while the proportion of HUVEC in S phase increased significantly (P < 0.005, see Figure 2 G. Figure 2 I). These results indicate that QKCMP peptide-tDONs have superior effects on promoting HUVEC proliferation and anti-apoptosis compared with QKCMP peptide.

[0285] 8. In vitro angiogenesis assay

[0286] Matrigel matrix gel needs to be completely melted overnight at 4°C, and the 24-well plate and pipette tip need to be pre-cooled. Add 200 microliters of Matrigel matrix gel to each well, then sterile centrifuge at low speed to remove bubbles, and then incubate at 37°C for 30 to 60 minutes. Select cells with good growth conditions, digest them with 0.25% trypsin, and then prepare a single cell suspension with serum-free medium. After the cell count is completed, 1×10 5 The cells were evenly distributed in a 24-well plate pre-coated with matrix gel and treated according to different experimental groups. They were cultured overnight at 37°C and 5% carbon dioxide saturated humidity. The next day, after calcein staining, the blood vessel formation in each group was observed and the number of lumen formation was statistically analyzed.

[0287] In this study, we compared the ability of QKCMP Peptide-tDONs and QKCMP Peptide to promote the activation of human umbilical vein endothelial cells (HUVECs), covering both cell migration and in vitro vascular morphogenesis. First, we evaluated the migration ability of HUVECs by transwell migration assay (see Figure 3 A), the experimental results showed that compared with the QKCMP Peptide group, the number of cell migration in the QKCMP Peptide-tDONs group was significantly increased (P < 0.001, see Figure 3 B). Subsequently, we used Matrigel to study morphogenesis. We added 100,000 cells to the culture medium containing 4 μg / ml QKCMPPeptide and QKCMP Peptide-tDONs, respectively, and evenly seeded them into 24-well plates pre-coated with Matrigel. After overnight culture, calcein staining was performed and the vascular morphogenesis of each group was observed using a fluorescence microscope. The results showed that compared with the QKCMP Peptide group, the number of tubes formed in the QKCMP Peptide-tDONs group was significantly increased (P < 0.001, see Figure 3 C. Figure 3 D), which showed that QKCMP Peptide-tDONs exhibited a significant ability to promote angiogenesis in morphogenesis experiments.

[0288] 9. Immunofluorescence staining

[0289] The cell samples will be processed according to the predetermined protocol for 48 hours. First, rinse with phosphate buffered saline (PBS) and then fix with 4% paraformaldehyde for 15 minutes. After fixation, rinse again with PBS three times for 5 minutes each time. Then, treat the samples with 0.1% Triton X-100 at room temperature for 10 minutes. After treatment, add 5% fetal bovine serum (FBS) and incubate at 37°C for 1 hour. After that, incubate the primary antibody at 4°C overnight. After the incubation, rinse three times with PBS for 5 minutes each time. Then add the secondary antibody and incubate at 37°C for 1 hour in the dark. After the incubation, incubate with Hoechst dye at room temperature for 15 minutes in the dark, and finally collect images under a fluorescence microscope.

[0290] The results showed that compared with the peptide group, the expression of Ki67 in the peptide-tDONs group was significantly increased (P < 0.01, see Figure 4 A. Figure 4B), indicating that the cell proliferation ability was enhanced. Extracellular signal-regulated kinases 1 and 2 (ERK1 / 2) are key proteins that induce angiogenesis in endothelial cells (EC) during VEGF-dependent activation. Immunofluorescence staining analysis showed that the expression level of ERK1 / 2 in the peptide-tDONs group was also higher than that in the peptide group (P < 0.01, see Figure 4 C) These results collectively indicate that QKCMP Peptide-tDONs exhibit a stronger ability to promote endothelial cell angiogenesis than QKCMP Peptide.

[0291] 10. Zebrafish vascular deficiency model and treatment

[0292] Zebrafish have been widely used in medical research in recent years due to their small size, low cost, in vitro development, transparent body, and highly homologous genome with humans. Due to the optical transparency of embryos and larvae, the morphological and functional changes of blood vessels can be observed non-invasively in living animals. Zebrafish are raised in water at a temperature of 28°C. The water quality standard of the water body is: 200 mg of instant sea salt is added to each liter of reverse osmosis water, and the conductivity is maintained at 450 to 550 microsiemens per centimeter; the pH range is 6.5 to 8.5; the hardness is 50 to 100 mg per liter of calcium carbonate. The zebrafish was provided by the HuterBiotech Breeding Center in Hangzhou, China, with a license for the use of experimental animals, numbered SYXK (Zhejiang) 2022-0004. The breeding management follows the international AAALAC certification standards, with the certification number 001458, and has passed the IACUC ethics review, numbered IACUC-2023-7624-01.

[0293] In the experiment, transgenic vascular green fluorescent Fli-1 strain zebrafish at one day post-fertilization (dpf) were randomly selected and placed in 6-well plates, with 30 fish per well and a volume of 3 ml per well. The zebrafish in each well received yolk sac injection, which included an equal amount of bevacizumab to induce embryonic vascular loss, and an equal amount of solvent, tDON (4 nanomoles), QKCMP peptide (0.25, 1, 4 nanomoles) or QKCMP peptide-tDONs (0.25, 1, 4 nanomoles). In addition, a normal zebrafish control group without any treatment was set up, totaling 9 groups with 270 zebrafish. Two days after injection, 10 zebrafish were randomly selected from each group and photographed under a fluorescence microscope, and data were collected using NIS-Elements D 3.20 advanced image processing software. The vascular loss of zebrafish induced by bevacizumab injection was evaluated by statistically analyzing the area of ​​the intestinal blood vessels (in pixels) and the number of intestinal blood vessel branches. Statistical results were expressed as mean ± standard error.

[0294] In the study, Bevacizumab (at a concentration of 1 μg / ml) was introduced into zebrafish to combine with VEGF, which successfully inhibited angiogenesis and established a zebrafish vascular defect model. Figure 5 As shown in A, compared with the control group, after two days of Bevacizumab intervention, the area and number of intestinal blood vessels in the experimental group of zebrafish were significantly reduced (P < 0.001, see Figure 4 B. Figure 4 C), thus verifying that the establishment of the zebrafish vascular defect model was successful. On this basis, the researchers added tDON or different concentrations (0.25, 1, 4 μg / ml) of QKCMP peptide or QKCMP peptide-tDON complex to the model. The study found that QKCMP peptide or QKCMP peptide-tDON complex can counteract the effects of Bevacizumab, especially the QKCMP peptide-tDON complex, which exhibited the ability to promote angiogenesis, significantly increased the area and number of branches of the zebrafish's intestinal blood vessels, and showed a certain dose dependence. When the intervention concentration of the QKCMP peptide-tDON complex reached 1 μg / ml or 4 μg / ml, there was no significant difference in the number of intestinal blood vessel branches in zebrafish compared with the control group (see Figure 4 C). In addition, all zebrafish survived after the above treatments, indicating that the intervention concentrations used had no obvious toxicity to zebrafish.

[0295] 11. Mouse vascular endothelial injury model and sample processing

[0296] SPF C57BL / 6J mice (6 weeks old, male) were provided by Jicui Yaokang Biological Co., Ltd. (Nanjing, China). These mice were raised in an SPF barrier system in the animal room of Ningbo University and enjoyed free access to food and water. After one week of adaptive training, the experiment officially began. The mice were randomly assigned to four experimental groups. After anesthesia, the mice were fixed on the operating table in a supine position, and the neck was shaved and disinfected with alcohol iodine. The skin was opened through a midline incision in the neck, and the subcutaneous tissue was separated to fully expose the left common carotid artery, internal carotid artery, and external carotid artery. A 5-0 silk thread was used to tie a slipknot at the proximal end of the common carotid artery and the distal end of the internal carotid artery to block blood flow, and the distal end of the external carotid artery was ligated at the same time. A small hole was pierced with a fine needle at the proximal end of the external carotid artery ligature, and then a modified 0.014-inch diameter elastic guide wire was used to puncture the external carotid artery. After the guidewire entered the external carotid artery, it was pushed to the ligature that crossed the arterial bifurcation and reached the proximal end of the common carotid artery. The guidewire was pushed back and forth three times and then withdrawn. Subsequently, the proximal end of the external carotid artery puncture was ligated, and the slipknots of the common carotid artery and the internal carotid artery were loosened to restore the blood flow of the common carotid artery. Except for the control group, the other three groups of mice received intravascular injections of different concentrations of tDON, QKCMP peptide, or QKCMP peptide-tDON complex. Finally, the neck incision was sutured. On the 7th and 14th days after surgery, the mice were sampled in batches, with 8 mice in each batch. After anesthesia, 4 mice were perfused with 5% Evans blue dye and 1xPBS, and then fixed with 10% formaldehyde. The common carotid arteries on both sides were separated and cut for photography, and the blue staining of the blood vessels was observed to assess the degree of endothelial barrier damage. After euthanasia, the other four mice were isolated and cut from the common carotid arteries on both sides, embedded in paraffin and sliced, followed by H&E staining to observe and evaluate the pathological conditions of vascular endothelial tissue, including intimal integrity, plaque formation, and inflammatory infiltration. This study was approved by the Animal Ethics Committee of Ningbo University, with approval number No. 13077.

[0297] In this study, we induced endothelial injury in the internal carotid artery of mice by using an elastic guidewire, and then injected tDON, QKCMP peptide, or QKCMP peptide-tDONs into these mice. On days 7 and 14, we extracted the surgical carotid artery vessels after perfusion and staining with Evans blue dye to evaluate the integrity and permeability of the vascular endothelium. In addition, we also performed HE staining to observe the structure of the vascular endothelial tissue on day 14. Evans blue staining results (see Figure 6A) shows that the mouse internal carotid artery endothelial injury model was successfully established, and the vascular endothelium of the control group showed blue staining, indicating that there was endothelial injury and impairment of barrier function. Compared with the 7th day, the blue staining of the vascular endothelium on the 14th day was reduced, indicating that the endothelial barrier function was restored. Furthermore, under the intervention of QKCMP peptide or QKCMP peptide-tDONs, the blue staining of the vascular endothelium on the 7th and 14th days was significantly reduced. Compared with QKCMP peptide, the blue staining of the QKCMP peptide-tDONs group was further reduced, indicating that QKCMP peptide-tDONs showed a superior effect of promoting vascular endothelialization in vivo than QKCMP peptide. Further results of HE staining showed that the common carotid artery of mice in the control group and tDON group was abnormal in structure, with rough intima (indicated by black arrows), obvious plaque formation (indicated by blue arrows), accompanied by severe inflammatory cell infiltration (indicated by red arrows), and obvious vascular endothelial damage. The common carotid artery structure of mice in the peptide group was slightly abnormal, with a rough intima and no obvious plaque formation, but with obvious inflammatory cell infiltration and obvious endothelial damage. Compared with the peptide group, the common carotid artery structure of mice in the peptide-tDONs group was basically normal, with a smooth and intact intima, no obvious plaque formation, no obvious inflammatory infiltration, and a significantly reduced area of ​​vascular damage (see Figure 6 B).

[0298] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, ordinary technicians in the relevant field should understand that the specific implementation methods of the present invention can still be modified or replaced by equivalents. Any modification or equivalent replacement that does not depart from the spirit and scope of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. A method for preparing a QKCMP peptide based on a triangular DNA origami nanostructure, characterized in that: include: The QKCMP peptide is mixed with the triangular DNA origami, and then annealed to obtain the QKCMP peptide based on the triangular DNA origami nanostructure; The triangular DNA origami is tDONs; the amino acid sequence of the QKCMP peptide is Ac-KLTWQELYQLKYKGIGGG(POG.

2. The method for preparing the QKCMP peptide based on the triangular DNA origami nanostructure according to claim 1, characterized in that: The molar concentration ratio of the QKCMP peptide to the triangular DNA origami is 5-9:1-5.

3. The method for preparing the QKCMP peptide based on the triangular DNA origami nanostructure according to claim 1, characterized in that: The preparation method of the triangular DNA origami comprises: The M13mp18 scaffold chain, the staple chain and the capture chain are mixed in a buffer solution, and slowly cooled from 95°C to 25°C at a rate of 0.1°C / 10s for assembly to obtain the triangular DNA origami; The staple chain is as shown in SEQ ID NO: 1-208; The capture strands are shown in SEQ ID NOs: 209-211.

4. The method for preparing the QKCMP peptide based on the triangular DNA origami nanostructure according to claim 1, characterized in that: The steps of mixing the QKCMP peptide with the triangular DNA origami and then annealing the same include: After mixing the QKCMP peptide with the triangular DNA origami, annealing was performed from 70-90°C to 25°C, and the mixture was repeated for at least three cycles; Wherein, the annealing rate of the annealing treatment is 1°C / 8-10min.

5. A QKCMP peptide based on a triangular DNA origami nanostructure, characterized in that: The QKCMP peptide based on triangular DNA origami nanostructure is prepared according to the preparation method according to any one of claims 1-4.

6. An application of the QKCMP peptide based on the triangular DNA origami nanostructure according to claim 5, characterized in that: The application includes at least one of the following: A1) Application in promoting angiogenesis; A2) Application in the preparation of products promoting angiogenesis; A3) Application in promoting cell proliferation; A4) Application in the preparation of products promoting cell proliferation; A5) Application in the preparation of products for repairing vascular loss; A6) Application in nano drug delivery; A7) Application in establishing nano drug delivery system; A8) Application in bioactive scaffolds.

7. A nano drug delivery system, characterized in that: The nano drug delivery system comprises the QKCMP peptide based on the triangular DNA origami nanostructure according to claim 5.

Images