Container for manufacturing tension-imparting three-dimensional artificial skin and manufacturing method

Abstract

In order to provide a culture container and a method for producing a tension-imparting three-dimensional artificial skin using the culture container, the use amount of fibroblasts is reduced, a digging step is not required, the yield is improved, and various skilled steps are excluded to significantly improve the production efficiency, a culture container is used, the culture container comprising: a lower culture container having a side wall and a bottom, the bottom part is provided with a porous membrane; and an upper insertion tool having a cylindrical side wall inserted into the lower culture vessel. The cylindrical side wall is provided with: a base which is disposed so as to protrude from the upper end of the side wall of the lower culture vessel at a position where the lower end of the cylindrical side wall inserted into the lower culture vessel is not in contact with the upper surface of the porous film; and a base which is disposed on the outer surface of the cylindrical side wall so that the inner surface of the side wall of the lower culture container and the outer surface of the cylindrical side wall are kept at a certain distance.

Description

Technical Field

[0001] The present invention relates to a container and a manufacturing method for manufacturing tension-imparting three-dimensional artificial skin. Background Art

[0002] Artificial skin has been developed so far, starting with a three-dimensional epidermal model and a Bell-type artificial skin with epidermis and dermis. In addition, artificial skin is used to conduct safety and functional evaluation tests centered on cosmetic formulation materials, as well as tests on the skin such as micro-irritation, and various artificial skin products are sold to provide these tests.

[0003] However, the artificial skin sold so far is mainly intended for use in safety assessments, and there are still issues in obtaining stable common results in terms of batch stability of products or sufficient functional assessments, reactivity, etc. In addition, since the artificial skin sold so far does not reflect the physiological environment of the skin of a living organism, there is a growing expectation for the development of more advanced three-dimensional artificial skin.

[0004] Therefore, the inventors of the present invention have improved artificial skin in order to reproduce the physiological environment of the skin. In particular, they have selected appropriate human epidermal cells and dermal fibroblasts for use in functional evaluation, and formed a three-dimensional artificial skin consisting of two layers with different dermal cell densities in order to reproduce the skin structure. Tension mechanical stress is then applied to the three-dimensional artificial skin. By adopting this technique, they have developed and proposed a tension-imparting three-dimensional artificial skin that can undergo the same safety tests as before and has further improved functional evaluation sensitivity compared to previous three-dimensional skins (see non-patent document 1).

[0005] This tension-giving type three-dimensional artificial skin has an epidermis composed of four layers of epidermal basal cell layer, spinous layer, granular layer and stratum corneum as the epidermis, and has a dermis composed of two layers of papillary layer and reticular layer with different cell density. In addition, the same as human skin, since the performance of extracellular matrix or cell-specific protein is observed, this tension-giving type three-dimensional artificial skin can also be called a model that reproduces human skin in terms of the performance of extracellular matrix or protein. In addition, this tension-giving type three-dimensional artificial skin makes the orientation of fibroblasts or extracellular matrix more similar to natural skin than the previous Bell type artificial skin by giving the mechanical stress of the tension in the lateral direction inherent to the skin.

[0006] Therefore, in addition to the cell survival test, water loss test, and conductivity test that are conventional safety tests, the tension-imparting three-dimensional artificial skin can also be subjected to gene expression or immunostaining of the epidermis or dermis as a functional evaluation of various components after stabilization. This test method uses a coating test on the epidermis layer that reproduces the coating test on the skin, or a test of adding various components to the culture medium that reproduces the blood pathway, and the feature is that any of these methods can widely evaluate the functions of various components that become the test object.

[0007] Thus, the tension-imparting 3D artificial skin can be considered as a model that reproduces the tissue structure or physiological function of the skin by imparting mechanical stress of tension. Therefore, the tension-imparting 3D artificial skin becomes a functional evaluation that can evaluate the increase or decrease of various genes or proteins as a functional evaluation, and can be applied to skin damage models such as response to oxidative stress, or models of skin micro-irritation and allergies.

[0008] [Prior art literature]

[0009] [Patent Document]

[0010] Non-patent literature 1: Communications Biology 3,637,2020. Summary of the invention

[0011] [Problems to be solved by the invention]

[0012] The tension-imparting three-dimensional artificial skin proposed by the inventors in non-patent document 1 has reproduced a skin tissue structure or physiological function similar to natural skin. The conventional method for manufacturing the tension-imparting three-dimensional artificial skin is to form a fibroblast layer in a culture dish, then dig out the fibroblast layer into the size of a Snapwell (permeable cell culture scaffold; Corning Company), then sandwich the dug fibroblast layer in the Snapwell, and then stack epidermal cells on the fibroblast layer sandwiched in the Snapwell.

[0013] Specifically, the following steps are required.

[0014] (1) A mixed solution of low-density fibroblasts and collagen that will become the subdermal layer is seeded in a 6-well cell culture dish. The number of fibroblasts required is 0.9 x 10 6 indivual.

[0015] (2) After the mixed solution of cells and collagen solidifies, a mixed solution of fibroblasts and collagen with a high cell density in the upper dermis is seeded on top. The number of fibroblasts required is 3.7 x 106 indivual.

[0016] (3) After these solidify to form a dermis layer consisting of an upper dermis layer and a lower dermis layer, the dermis layer is excavated using a circular cutter and then the excavated dermis layer is embedded in the lower container of the Snapwell.

[0017] (4) Then, the upper container of Snapwell is inserted on the upper part of the lower container of Snapwell in which the excavated dermis layer is inserted.

[0018] (5) The epidermal keratinocyte suspension is seeded on top of the dermis layer embedded in the Snapwell to laminate the epidermal keratinocytes.

[0019] (6) A tension-imparting three-dimensional artificial skin is obtained through a culture step.

[0020] However, when attempting to mass-produce tension-imparting three-dimensional artificial skin through the above steps, it is known that there are many problems including time, cost, and skill level.

[0021] In particular, in the above steps, in the steps (1) to (2), a total of 4.6 x 10 6 Therefore, in order to provide a large amount of tension-imparting three-dimensional artificial skin, a very large number of fibroblasts must be used, which consumes a great deal of cell culture cost and time, and further improvement is needed.

[0022] In addition, in the above steps, the process of digging out the dermis layer in the process (3) and inserting it into the lower container of Snapwell takes a lot of time and requires the operator to be proficient in the process. In particular, digging out the dermis layer in a perfect state in a predetermined shape requires the operator to be proficient, so the increase in labor costs has become one of the factors.

[0023] In addition, proficiency is also required for embedding the upper container into the lower container in the process (4). In particular, it is very difficult to embed the upper container into the lower container in such a way that the height of the upper container is the same each time, that is, the distance between the bottom surface of the upper container and the bottom surface of the lower container is a certain distance. Here, when the height or position of the upper container embedded above the lower container is different in each Snapwell, the three-dimensional artificial skin will have different tensions applied to each Snapwell, and the quality of the product will be unstable even after the subsequent processes (5) to (6). In addition, when the embedded upper container is tilted to produce a place where the height of the bottom surface of the upper container is different, the tension of the three-dimensional artificial skin will be distorted, and the quality of the product will be unstable even after the subsequent processes (5) to (6).

[0024] Therefore, the proficiency of the operator will greatly affect the final manufacturing pass rate of the tension-imparting three-dimensional artificial skin. The success rate of the manufacturing of the tension-imparting three-dimensional artificial skin under the above steps is about 10% to 20% for beginners, and even for skilled workers, it is only about 60% to 80%.

[0025] Thus, the steps so far have been relatively complicated in the manufacturing process and the manufacturing efficiency is not high. In order to obtain a stable tension-imparting three-dimensional artificial skin, proficiency is required, so it is difficult to establish standard operating procedures, and thus a simpler and more efficient manufacturing method is required.

[0026] Therefore, the present inventors aimed to develop a container for manufacturing tension-imparting three-dimensional artificial skin in a simple, stable and efficient manner, and to develop a method for manufacturing tension-imparting three-dimensional artificial skin, and thus completed the invention of this application through trial and error.

[0027] [Technical means to solve the problem]

[0028] The inventors of the present invention have conducted careful research to solve the above-mentioned problems of quality reduction caused by the possible positional deviation of each container in the process of digging out the dermis from the six holes or the process of embedding the upper container into the lower container. As a result, they have invented a culture embedding container as a novel culture embedding container, which comprises: a lower culture container having a side wall and a bottom, the bottom having a porous membrane; and an upper insertion tool having a cylindrical side wall inserted into the lower culture container; the cylindrical side wall comprises: a base protrudingly arranged at the upper end of the side wall of the lower culture container at a position that maintains a non-contact state between the lower end of the cylindrical side wall inserted into the lower culture container and the upper surface of the porous membrane, and a base arranged on the outer surface of the cylindrical side wall in a manner that the inner surface of the side wall of the lower culture container is kept at a certain distance from the outer surface of the cylindrical side wall, and the culture embedding container is used in the manufacture of tension-imparting three-dimensional artificial skin.

[0029] The first means for solving the problem of the present invention is a culture embedded container 1, comprising: a lower culture container 3, having a side wall 31 and a bottom 33, the bottom 33 having a porous membrane 32; and an upper insert 2, having a cylindrical side wall 21 inserted into the lower culture container; the cylindrical side wall comprises: a base 23 protrudingly arranged at the upper end of the side wall of the lower culture container at a position that maintains a non-contact state between the lower end of the cylindrical side wall inserted into the lower culture container and the upper surface of the porous membrane, and a base 25 arranged on the outer surface of the cylindrical side wall in a manner that the inner surface of the side wall of the lower culture container is kept at a certain distance from the outer surface of the cylindrical side wall.

[0030] A second means for solving the problem of the present invention is the culture insert container 1 as described in the first means, wherein the surface of the lower end portion 22 of the cylindrical side wall of the upper insert 2 is roughened.

[0031] The third means for solving the problem of the present invention is the culture insert container as described in the first or second means, wherein the base 23 for placing the cylindrical side wall of the upper insert on the upper end of the side wall of the lower culture container has a blade, that is, a wing-shaped portion 24. The base having the wing-shaped portion allows the culture insert container to be easily placed on a culture container such as a tray or a multi-well tray.

[0032] The fourth means for solving the problem of the present invention is the culture insert container as described in any one of the first to third means, wherein the base disposed on the outer surface of the cylindrical side wall of the upper insert has a rib shape. By providing a plurality of bases disposed on the outer surface of the cylindrical side wall of the upper insert having a rib shape, the upper insert does not tilt when inserted into the lower culture container, and can more stably maintain a certain distance from the side wall.

[0033] The fifth means for solving the problem of the present invention is a culture insert container as described in any one of the first to fourth means, which has a rotation stopper to prevent the rotation of the upper inserter, that is, a rotation stopper mechanism 26, 34 that fits and fixes the upper inserter to the lower culture container. The rotation stopper mechanism has, for example, a convex portion and / or concave portion 34 disposed on the outer side of the side wall of the lower culture container to form a rotation stopper, and a buckle portion 26 provided on the upper inserter that fits into the convex portion and / or concave portion. By having a rotation stopper mechanism, the situation where the upper inserter inserted into the lower culture container is accidentally rotated can be suppressed, and the tension-imparting three-dimensional artificial skin can be stably manufactured.

[0034] A sixth means for solving the problem of the present invention is the culture insert container according to any one of the first to fifth means, wherein the cylindrical side wall is cylindrical.

[0035] In addition, in the manufacturing method of tension-imparting three-dimensional artificial skin of the 7th means for solving the problem of the present invention, a culture embedded container 1 as described in any one of the 1st to 6th means of the present invention is used, and the tension-imparting three-dimensional artificial skin is manufactured through the steps shown below, wherein the culture embedded container 1 comprises: a lower culture container 3 having a side wall and a bottom, the bottom having a porous membrane; and an upper insert 2 having a cylindrical side wall inserted into the lower culture container; the cylindrical side wall comprises: a base protrudingly arranged at the upper end of the side wall of the lower culture container at a position maintaining a non-contact state between the lower end portion of the cylindrical side wall inserted into the lower culture container and the upper surface of the porous membrane, and a base arranged on the outer surface of the cylindrical side wall in a manner that the inner surface of the side wall of the lower culture container is kept at a certain distance from the outer surface of the cylindrical side wall.

[0036] The seventh method for solving the problem of the present invention is a method for producing a tension-imparting three-dimensional artificial skin, specifically using the culture embedding container as described in any one of the first to sixth methods of the present invention, and using the lower culture container as a dedicated dermis layer formation;

[0037] The culture insert container comprises: a lower culture container having a side wall and a bottom, the bottom having a porous membrane; and an upper insert having a cylindrical side wall inserted into the lower culture container; the cylindrical side wall comprises: a base protrudingly arranged at the upper end of the side wall of the lower culture container at a position that maintains a non-contact state between the lower end of the cylindrical side wall inserted into the lower culture container and the upper surface of the porous membrane, and a base arranged on the outer surface of the cylindrical side wall in a manner that the inner surface of the side wall of the lower culture container and the outer surface of the cylindrical side wall are kept at a certain distance;

[0038] And the manufacturing method is accompanied by the following steps

[0039] (1) Directly seed the solution of low cell density fibroblasts and collagen into the lower culture container. In the case of a 6-well culture insert container, the number of fibroblasts required is 1.0 x 10 6 indivual,

[0040] (2) After the solution of fibroblasts and collagen with low cell density solidifies, a solution of fibroblasts and collagen with high cell density is further seeded. In the case of a 6-well culture insert container, the required number of cells is 1.8 x 10 6 indivual,

[0041] (3) After the solution of the seeded fibroblasts and collagen with a high cell density solidifies to form a dermis layer, the upper insert is pressed tightly to stop at the lower culture container to fix it,

[0042] (4) seeding the epidermal keratinocyte suspension on the dermis layer formed above to stack the epidermal keratinocytes, and

[0043] (5) A tension-imparting three-dimensional artificial skin is obtained through a culture step.

[0044] [Effects of the Invention]

[0045] By using the culture embedding container of the present invention and the method for producing the tension-imparting three-dimensional artificial skin using the same, the culture embedding container used in the process of producing the tension-imparting three-dimensional artificial skin can be changed to the culture embedding container of the present invention, and the step of digging out the formed dermis layer can be omitted. Accordingly, in the case of a 6-well culture embedding container, the number of fibroblasts required for the production of the tension-imparting three-dimensional artificial skin is 4.6x10 6 In contrast, the method of the present invention can be reduced to 2.8x10 6 In addition, in the culture embedding container of the means of the present invention and the method for manufacturing the tension-imparting three-dimensional artificial skin using the same, since there is no embedding process into the lower container of Snapwell, for skilled people, the manufacturing efficiency is close to 100% and the time is greatly shortened. In addition, due to the shortening of time and the improvement of efficiency, the number of artificial skins that can be manufactured at one time can be increased, and the time until the technology is familiar can be greatly shortened. In addition, in the previous culture embedding container and the method for manufacturing the tension-imparting three-dimensional artificial skin using the same, it is technically difficult to adjust the height when the upper container is embedded in the lower container of Snapwell, but in the culture embedding container of the means of the present invention, the height of the upper inserter embedded in the lower culture container is set in a certain manner, and the height can be correctly controlled every time, thereby greatly improving the working efficiency and the qualified rate of the tension-imparting three-dimensional artificial skin during manufacturing. The number of production in the present invention is increased by more than 2 times per unit time, and even complete beginners have a success rate of 60% to 80%, and after several attempts, the success rate increases and the production efficiency close to that of skilled people can be obtained. In this way, the culture embedding container of the means of the present invention and the method for producing the tension-imparting three-dimensional artificial skin using the means of the present invention reduce the amount of fibroblasts used, do not need to perform the digging process to improve the pass rate, and eliminate various skilled processes to significantly improve the production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 The upper insert of the culture insert container according to the present invention is shown in Figure 1. (a) shows the schematic diagram when viewed from the top, (b) shows the schematic diagram when viewed from the front, and (c) shows the schematic diagram when viewed from the bottom.

[0047] Figure 2 An upper insert of a culture embedding container showing the means of the present invention, wherein (a) shows a plan view, (b) shows a back view, (c) shows a left side view, (d) shows a right side view, (e) shows a plan view, (f) shows a bottom view, and (g) shows the back, left side and plane.

[0048] Figure 3 The lower culture container of the culture insert container of the means of the present invention is shown, wherein (a) shows the outline when viewed from the top, (b) shows the outline when viewed from the front, and (c) shows the outline when viewed from the bottom.

[0049] Figure 4 A lower culture container of a culture embedding container showing the means of the present invention, wherein (a) shows a plan view, (b) shows a back view, (c) shows a left side view, (d) shows a right side view, (e) shows a plan view, (f) shows a bottom view, and (g) shows the back, left side and plane.

[0050] Figure 5 The diagram shows the state where the upper insert of the culture insert container of the present invention is fitted with the lower culture container. (a) shows the outline when viewed from the top, (b) shows the outline when viewed from the front, and (c) shows the outline when viewed from the bottom.

[0051] Figure 6 The diagram shows the state of the upper insert of the culture embedding container of the means of the present invention after being fitted into the lower culture container, wherein (a) shows a plan view, (b) shows a back view, (c) shows a left side view, (d) shows a right side view, (e) shows a plan view, (f) shows a bottom view, and (g) shows the back side, left side and plane.

[0052] Figure 7 The figure shows a state where the upper insert of the culture insert container according to the means of the present invention is fitted with the lower culture container.

[0053] Figure 8 The following shows the manufacturing process of conventional tension-imparting three-dimensional artificial skin.

[0054] Fig. 9 The manufacturing process of the force-imparting three-dimensional artificial skin showing the means of the present invention.

[0055] Fig.10 The results of an experiment showing that the structure of the dermis was confirmed by H&E staining.

[0056] Fig.11 The results of an experiment showing that the structure of the epidermis was confirmed by immunostaining.

[0057] Fig.12The graph shows the experimental results of measuring the mRNA expression level of HAS3 6 hours after the addition of ATRA.

[0058] Fig.13 The results of the experiment showing the expression of Collagen1A1 and Elastin 48 hours after the addition of TGF-β. DETAILED DESCRIPTION

[0059] The following describes the embodiments of the present invention in detail with reference to the description of the embodiments and the drawings as appropriate. However, the container and the manufacturing method for manufacturing the tension-imparting three-dimensional artificial skin of the present invention are not to be construed as being limited to the description.

[0060] The present invention includes combinations of the various configurations described in the above-mentioned means of the present invention within the technical scope of the present invention as long as the effects of the present invention are achieved.

[0061] The present invention is described in more detail below with reference to the following embodiments. However, the present invention is not limited to these embodiments, and many modifications can be made by a person having ordinary knowledge in the field within the technical concept of the present invention.

[0062] [Example]

[0063] Example

[0064] Made of polystyrene and porous membrane Figures 1 to 7 The following culture embedding container of the structure shown as the culture embedding container of the means of the present invention comprises: a lower culture container having a side wall and a bottom, the bottom having a porous membrane; and an upper insert having a cylindrical side wall inserted into the lower culture container; the cylindrical side wall having: a base protrudingly arranged at the upper end of the side wall of the lower culture container at a position that maintains a non-contact state between the lower end of the cylindrical side wall inserted into the lower culture container and the upper surface of the porous membrane, and a base arranged on the outer surface of the cylindrical side wall in a manner that the inner surface of the side wall of the lower culture container and the outer surface of the cylindrical side wall are kept at a certain distance. The culture embedding container of the means of the present invention can be made of materials that can be used for cell culture, such as polystyrene, polyethylene, polyethylene terephthalate, polypropylene, glass, metal, ceramics, etc.

[0065] 1) A tension-imparting three-dimensional artificial skin is manufactured by a method for manufacturing a tension-imparting three-dimensional artificial skin in a culture embedding container using the means of the present invention, and the tension-imparting three-dimensional artificial skin is compared with a tension-imparting three-dimensional artificial skin manufactured by a conventional manufacturing method.

[0066] (1) Cell culture

[0067] Cells used were dermal fibroblasts (manufactured by Kurabo) and epidermal keratinocytes (manufactured by Kurabo). Dermal fibroblasts were cultured according to the instructions of Kurabo until they reached 90% confluence, and epidermal keratinocytes were cultured according to the instructions of Kurabo until they reached 70% to 80% confluence.

[0068] (2) Artificial skin production by prior art (see also Figure 8 ).

[0069] Atelocollagen gel (manufactured by Koken Co., Ltd.) adjusted to 4 mg / mL was mixed with dermal fibroblasts and adjusted to a volume of 0.9 × 10 6 / 1.8mL / well) and upper layer (3.7x10 6 / 0.9mL / 1well).

[0070] The lower layer gel was added to the 6-well cell culture insert and allowed to stand in an incubator at 37°C, 5% CO2, 12.5% ​​CO2 for 30 minutes. The upper layer gel was added on top of the solidified lower dermis and allowed to stand in an incubator at 37°C, 5% CO2, 12.5% ​​CO2 for 30 minutes.

[0071] The dermis layer was excised using a circular cutter with a diameter of 11 mm, placed in the lower container of a Snapwell on which 50 μL of atelocollagen gel was applied, and adjusted so that the artificial skin became horizontal.

[0072] Add 200 μL of 0.5% Matrigel matrix gel solution and place in an incubator at 37°C, 5% CO2, 12.5% ​​CO2 for 1 hour. Insert the upper container of Snapwell into the lower container and fix it. Suspend epidermal keratinocytes in Humedia-KG2 (manufactured by Kurabo) and incubate at 1.1×10 6 The seeds were sown with 0.5 mL / well.

[0073] Set up in a 6-well plate, add 7 mL of artificial skin culture medium (DMEM culture medium (Dulbecco's Modified Eagle's Medium) containing 10% fetal bovine serum, 10 mg / mL b-FGF, 1 mM L-Ascorbic acid (vitamin C), 5 μg / mL Insulin, 1 μM Hydrocortisone), and then start culturing in an incubator at 37°C, 5% CO2, 12.5% ​​CO2. The culture medium on the epidermis side is replaced every day until the third day of culture. The culture medium on the dermis side is replaced every other day. On the fourth day of culture, completely remove the culture medium on the epidermis side, and start gas layer culture. After the sixth day of culture, culture is carried out in an incubator at 37°C, 5% CO2.

[0074] (3) The manufacturing method performed by the means of the present invention (see also Fig. 9 ).

[0075] Atelocollagen gel (manufactured by Koken Co., Ltd.) adjusted to 4 mg / mL was mixed with dermal fibroblasts and adjusted to a volume of 1.0 × 10 6 / 0.9mL / well) and upper layer (1.8x10 6 / 0.3mL / 1well).

[0076] The gel for the lower layer is added to the lower culture container of the present invention, and allowed to stand in an incubator at 37°C, 5% CO2, 12.5% ​​CO2 for 30 minutes.

[0077] The gel for the upper layer was added on top of the solidified lower dermis, and the mixture was placed in an incubator at 37°C, 5% CO2, 12.5% ​​CO2 for 30 minutes.

[0078] The upper insert is placed above the lower culture container, and a load is slowly applied and pressed until it stops to secure it.

[0079] 200 μL of 0.5% Matrigel matrix gel solution was added and the mixture was allowed to stand in an incubator at 37°C, 5% CO2, 12.5% ​​CO2 for 1 hour. Epidermal keratinocytes were suspended in Humedia-KG2 (manufactured by Kurabo) and incubated at 1.8×10 6 The seeding was performed with 0.7 mL / well.

[0080] Set up on a 6-well plate, add 7 mL of artificial skin culture medium (DMEM culture medium containing 10% fetal bovine serum, 10 mg / mL b-FGF, 1 mM L-Ascorbic acid, 5 μg / mL Insulin, 1 μM Hydrocortisone), and then start culturing in an incubator at 37°C, 5% CO2, 12.5% ​​CO2. The culture medium on the epidermis side is replaced every day until the third day of culture. The culture medium on the dermis side is replaced every other day. On the fourth day of culture, completely remove the culture medium on the epidermis side and start gas layer culture. After the sixth day of culture, culture is carried out in an incubator at 37°C, 5% CO2.

[0081] 2) Comparison of tissue images of the tension-imparting three-dimensional artificial skin model obtained by the means of the present invention and the tension-imparting artificial skin model manufactured by the previous method

[0082] On the 11th day of culture, each artificial skin was washed twice with 7 mL of PBS (-) and fixed overnight at 4°C with 7 mL of 4% PFA / PB. After embedding with alkane, thin sections were cut and stained with hematoxylin-eosin (HE) and immunohistochemical staining. The antibodies and staining conditions used in immunohistochemical staining are shown in Table 1.

[0083] [Table 1]

[0084]

[0085] In the artificial skin made in any one of the preparation methods, two layers of dermis with different densities of fibroblasts are formed, and the cells extend in the horizontal direction to give tension. In addition, the basal cells positive for CK5 are arranged in a neat manner, and COL4 is expressed in the form of a backing basal layer. In addition, Claudin of the stratum spinosum and Filaggrin of the stratum granulosum are formed in layers. From these results, it is shown that, similar to the previous method, even in the tension-imparting three-dimensional artificial skin obtained by the means of the present invention, an epidermal layer differentiated into four layers is formed in the same manner as the tension-imparting artificial skin manufactured by the previous method.

[0086] 3) Comparison of gene expression between the tension-imparting three-dimensional artificial skin model obtained by the present invention and the tension-imparting artificial skin model produced by the previous method

[0087] a) Expression of HAS3 gene

[0088] On the 6th day of culture, the artificial skin was replaced with a measurement medium (DMEM medium containing 10% fetal bovine serum, 5μg / mL Insulin, and 1μM Hydrocortisone). On the 8th day of culture, a gauze infiltrated with a 0.2% HPC solution or a 10μM ATRA solution was placed on the surface of the epidermis and cultured in a 37°C, 5% CO2 incubator for 1 hour. The gauze was removed after 1 hour, and then cultured in a 37°C, 5% CO2 incubator for 5 hours. After 6 hours of culture, the artificial skin was removed from the container without peeling off the epidermal tissue, and cut into half with a razor. The RNT solution of the RNeasy Plus Mini Kit (manufactured by Qiagen) was used to dissolve the tissue by bead crushing, and then the protein was removed by phenol and chloroform, and then the column was purified according to the procedure of the RNeasy Plus Mini Kit to obtain total RNA.

[0089] Based on the purified total RNA, cDNA synthesis was performed using SuperScript VILO Master Mix (manufactured by Invitrogen) and following the attached manual. The synthesized cDNA was mixed with SYBR premix Ex Taq (manufactured by TaKaRa) and Primer mix (a mixture of Forward and Reverse Primers), and 12.5 μL of the reaction solution was dispensed into each well of a 96-well plate for PCR, and then real-time PCR was performed using QuantStudio 12K Flex (Applied Biosystems). The real-time PCR reaction was performed 40 times with an initial denaturation at 95°C for 30 seconds, a PCR reaction at 95°C for 5 seconds, and a PCR reaction at 60°C for 31 seconds. Table 2 shows the arrangement of the primers for amplification of the genes used (manufactured by ThermoFisher Scientific).

[0090] [Table 2]

[0091] Gene Forward Reverse GAPDH TCTGACTTCAACAGCGACAC CCCTGTTGCTGTAGCCAAATTC HAS3 CGCAGCAACTTCCATGAGG AGTCGCACACCTGGATGTAGT COL1A1 AGGAAGGCCAAGTCGAGG CCGGGGCAGTTCTTGGTC ELN TAATGCTGTCCATCCTCCAC AAAAGACTCCTCCAGGAACTCC

[0092] Analysis of the gene expression of hyaluronic acid synthase (HAS3) has revealed that the artificial skin of the present invention shows a 3-fold increase in gene expression compared to the unstimulated method, indicating that it has the same or higher reactivity as the previous method ( Fig. 9 ).

[0093] b) Expression of Collagen1A1 and Elastin

[0094] On the 6th day of culture, the artificial skin was replaced with a measurement medium (DMEM medium containing 10% fetal bovine serum, 5μg / mL insulin, and 1μM hydrocortisone). On the 8th day of culture, the measurement medium was replaced with a measurement medium containing or not containing 10ng / mL TGF-β. The medium was replaced after 24 hours and cultured for 48 hours. After 48 hours, RNA was extracted from the artificial skin in the same manner as 3-a), and cDNA was synthesized and real-time PCR was performed. Table 2 shows the arrangement of primers (manufactured by Thermo Fisher Scientific) used for amplification of the genes.

[0095] The gene expression of collagen 1A1 (COL1A1) and elastin (ELN: Elastin) was analyzed. It was found that the artificial skin prepared by the method of the present invention showed a 1.5-fold increase in the gene expression of collagen 1A1 and a 3-fold increase in the gene expression of elastin compared to the unstimulated skin, which showed that the responsiveness was equivalent to that of the previous method ( Fig.10 ).

[0096] [Industrial Applicability]

[0097] In the means of the present invention, the amount of fibroblasts used can be reduced, the extraction process is not required to improve the yield, and various skilled processes are eliminated to significantly improve the manufacturing efficiency. In addition, since the extraction process of the formed dermis can be omitted, the number of fibroblasts required for the production of tension-imparting three-dimensional artificial skin in the case of a 6-well culture embedding container is 4.6x10 6 , which can be reduced to 2.8x10 6In addition, in the method of the present invention, since there is no embedding process into the lower container of Snapwell, for skilled personnel, the manufacturing efficiency is close to 100% and the time is greatly shortened. In addition, in the previous culture embedding container and the manufacturing method of the tension-imparting three-dimensional artificial skin using the same, the adjustment of the height when the upper container is embedded in the lower container of Snapwell is technically difficult, while in the culture embedding container of the method of the present invention, by placing the cylindrical side wall on the base of the side wall of the lower culture container, the height of the upper inserter embedded in the lower culture container is set in a certain manner, even if it is an unskilled person, the insertion height of the upper inserter can be correctly controlled at a certain value each time, thereby greatly improving the operating efficiency and the qualified rate of the tension-imparting three-dimensional artificial skin during manufacturing, and the number of tension-imparting three-dimensional artificial skins manufactured per unit time is increased to more than twice the previous number. In addition, due to the shortening of time and the improvement of efficiency, the number of artificial skins that can be manufactured at one time can also be increased, and the time until the technical proficiency is greatly shortened. By means of the present invention, even complete beginners can obtain a success rate of 60% to 80% in the manufacture of tension-imparting three-dimensional artificial skin, and after several attempts, the success rate can be increased to achieve a manufacturing efficiency close to that of skilled people, thereby significantly reducing the manufacturing cost including labor cost.

[0098] Description of Reference Numerals

[0099] 1 Cultivation Embedding Container

[0100] 2 Upper Insertion Tool

[0101] 3 Lower culture container

[0102] 21 Cylindrical side wall

[0103] 22 Lower end of cylindrical side wall

[0104] 23 The cylindrical side wall of the culture container inserted into the lower part is maintained

[0105] The bottom end of the porous membrane is in non-contact with the top surface of the porous membrane.

[0106] The position of the state is protrudingly arranged on the side wall of the lower culture container

[0107] The upper base

[0108] 24 Wing

[0109] 25 A base provided on the outer surface of the cylindrical side wall

[0110] 26 Rotation stop mechanism

[0111] 31 Sidewall

[0112] 32. Porous membrane

[0113] 33 bottom

[0114] 34 Rotation stop mechanism.

Claims

1. A culture embedding container, comprising: a lower culture container having a side wall and a bottom, the bottom having a porous membrane; and an upper insert having a cylindrical side wall inserted into the lower culture container; the cylindrical side wall comprising: a base protrudingly arranged at the upper end of the side wall of the lower culture container at a position that maintains a non-contact state between the lower end of the cylindrical side wall inserted into the lower culture container and the upper surface of the porous membrane, and a base arranged on the outer surface of the cylindrical side wall in a manner that the inner surface of the side wall of the lower culture container is kept at a certain distance from the outer surface of the cylindrical side wall.

2. The culture embedding container according to claim 1, wherein: The surface of the lower end portion of the cylindrical side wall of the upper insert is roughened.

3. The culture embedding container according to claim 1, wherein: The base for placing the cylindrical side wall of the upper inserter on the upper end of the side wall of the lower culture container has a wing-shaped portion.

4. The culture embedding container according to claim 1, wherein: The base provided on the outer surface of the cylindrical side wall of the upper inserter has a rib shape.

5. The culture insert container according to claim 1, comprising a rotation stop mechanism for fitting and fixing the upper insert tool and the lower culture container.

6. The culture embedding container according to claim 1, wherein: The cylindrical side wall is cylindrical.

7. A method for producing a tension-imparting three-dimensional artificial skin, using the culture embedding container according to any one of claims 1 to 6, The culture insert container comprises: a lower culture container having a side wall and a bottom, the bottom having a porous membrane; and an upper insert having a cylindrical side wall inserted into the lower culture container; the cylindrical side wall comprises: a base protrudingly arranged at the upper end of the side wall of the lower culture container at a position that maintains a non-contact state between the lower end of the cylindrical side wall inserted into the lower culture container and the upper surface of the porous membrane, and a base arranged on the outer surface of the cylindrical side wall in a manner that the inner surface of the side wall of the lower culture container and the outer surface of the cylindrical side wall are kept at a certain distance; And the manufacturing method has the following steps: (1) The first step is to directly seed a solution of fibroblasts and collagen at a low cell density in the lower culture container, (2) a second step of further seeding a solution of fibroblasts and collagen at a high cell density after the seeded solution of fibroblasts and collagen at a low cell density has solidified, (3) After the solution of the seeded high cell density fibroblasts and collagen solidifies to form a dermis layer, the upper insert is pressed tightly to stop on the lower culture container to fix it. (4) seeding the epidermal keratinocyte suspension onto the dermis layer formed above to stack the epidermal keratinocytes in the fourth step, and (5) A fifth step of obtaining a tension-imparting three-dimensional artificial skin through a culturing step.

Images