Mannan-oligosaccharide loaded porous microgel as well as preparation method and application thereof

Abstract

The invention discloses mannan-oligosaccharide-loaded porous microgel as well as a preparation method and application thereof, microspheres of the porous microgel are of a porous penetrating structure, mannan-oligosaccharide is embedded into the microspheres, and inflammatory enteritis is treated in an oral administration mode; the porous microgel disclosed by the invention has good biocompatibility and extremely low side effects when being used for treating IBD, pathogenic bacteria are directly carried out by utilizing a competitive adsorption principle, the use of antibiotics is not involved, the drug resistance is not generated, and a new method and a new idea are provided for treating IBD.

Description

Technical Field

[0001] The invention relates to the field of biomedical technology, and in particular to a preparation method of a porous microgel loaded with oligomannosaccharides and application thereof. Background Art

[0002] In recent years, with the rapid rise of the takeout industry, the incidence of inflammatory bowel disease (IBD) caused by hygiene problems has shown a trend of sustained rapid growth. IBD includes ulcerative colitis (UC) and Crohn's disease (CD). The clinical manifestations of IBD are recurrent abdominal pain, diarrhea, and mucus and blood in the stool. In severe cases, complications such as intestinal perforation, toxic megacolon, obstruction, and even cancer may occur. There is currently no specific cure for the disease, which has a certain degree of disability. The main purpose of existing treatment is to induce remission (eliminate symptoms) and maintain remission (prevent recurrence). IBD requires long-term medication, which increases the medical burden and is called a "green tumor." Given that IBD is in a period of rapid onset and the entire society is in a critical time to prevent further aggravation, the development of prevention and treatment drugs for IBD is particularly urgent.

[0003] It has been widely recognized that adherent invasive Escherichia coli (AIEC) is involved in the pathogenesis of Crohn's disease (CD). Many researchers have reported that the prevalence of AIEC in CD patients is higher than that in controls, and the pathogenic mechanism is related to the pathophysiology of CD. AIEC can not only participate in the formation of intestinal microecology as an intestinal commensal bacteria in the intestinal lumen, but also break through the intestinal barrier and colonize and adhere to intestinal epithelial cells through special biological characteristics. It works together with the abnormal intestinal barrier function of CD patients to participate in the pathogenesis of CD. In addition to its adhesion and invasion capabilities, AIEC can also survive and replicate in intestinal epithelial cells and macrophages, stimulating the production of inflammatory cytokines.

[0004] Among these pathogenic mechanisms, FimH protein, a naturally occurring bacterial type 1 fimbriae terminal protein that specifically binds to mannose on the surface of intestinal epithelial cells, plays a key role in the adhesion and subsequent invasion of AIEC to intestinal epithelial cells. FimH protein is a naturally occurring bacterial flagellar terminal protein that specifically binds to mannose on the surface of intestinal epithelial cells, mediating the first step in the pathogenic mechanism of AIEC: adhesion to intestinal epithelial cells. In addition, FimH also triggers inflammation through interaction with TLR4, inducing the production of tumor necrosis factor α (TNFα), interleukin 6 (IL-6), and interleukin 8 (IL-8) in the intestine that is independent of LPS. Therefore, the use of microcarriers to competitively adhere to and exclude bacteria that target the expression of FimH from the body is a scientific problem that needs to be solved urgently. Summary of the invention

[0005] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0006] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0007] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide a method for preparing a porous microgel loaded with oligomannosaccharides, comprising:

[0008] Adding a curing agent and oligomannosaccharide to the methacrylylated gelatin aqueous solution and mixing them evenly to obtain a solution A;

[0009] Polyethylene oxide is mixed with water to obtain solution B;

[0010] After solution A and solution B are blown evenly, they are solidified by ultraviolet light, sterile water is added and blown to disperse them into microspheres, and then centrifuged to obtain porous microgels loaded with oligomannosaccharides.

[0011] As a preferred solution of the preparation method of the present invention, the volume percentage of the methacrylylated gelatin aqueous solution is 20-30%.

[0012] As a preferred embodiment of the preparation method of the present invention, the mass percentage of the curing agent in the methacrylic gelatin aqueous solution is 0.1-0.3%, and the mass percentage of the oligomannose in the methacrylic gelatin aqueous solution is 50%-60%.

[0013] As a preferred embodiment of the preparation method of the present invention, the volume ratio of solution A:solution B is 2:1.

[0014] As a preferred embodiment of the preparation method of the present invention, the UV lamp curing time is 4s to 180s.

[0015] Another aspect of the present invention overcomes the deficiencies in the prior art and provides a porous microgel loaded with oligomannosaccharides.

[0016] As a preferred embodiment of the porous microgel of the present invention, the particle size of the porous microgel loaded with oligomannosaccharide is 100-200 μm.

[0017] As a preferred embodiment of the porous microgel of the present invention, the microspheres of the porous microgel are porous structures, and oligomannose is embedded in the microspheres.

[0018] Another aspect of the present invention overcomes the deficiencies in the prior art and provides the use of porous microgels in the preparation of drugs for treating inflammatory bowel disease.

[0019] As a preferred embodiment of the application of the present invention, the porous microgel competitively adsorbs bacteria expressing FimH to improve intestinal flora.

[0020] Beneficial effects of the present invention:

[0021] 1. The present invention designs porous microgels as carriers of oligomannosaccharides (MOS), uses microgels to competitively adsorb bacteria expressing FimH, and improves intestinal flora to achieve the purpose of preventing and treating IBD;

[0022] 2. The present invention designs and uses porous microgel as MOS microcarrier, so that the microgel loaded with MOS has a larger specific surface area and can adsorb a larger amount of bacteria;

[0023] 3. The microgel in the present invention has good biocompatibility and has extremely low side effects in the treatment of IBD. It uses the principle of competitive adsorption to directly remove pathogenic bacteria from the body without involving the use of antibiotics and without producing drug resistance, providing a new method and new idea for the treatment of IBD. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0025] Figure 1 This is a picture of the porous microgel (MOS GelMA MPs) loaded with oligomannose in Example 1 of the present invention.

[0026] Figure 2 This is an experiment of detecting the release amount of MOS by ultraviolet spectrophotometer in Example 1 of the present invention, wherein A is the Young's modulus of MOS GelMAMPs in Example 1 of the present invention; B is the elastic recovery rate of MOS GelMAMPs in Example 1 of the present invention; C is the cohesion ratio of MOS GelMAMPs in Example 1 of the present invention; D is the rebound rate of MOS GelMAMPs in Example 1 of the present invention; EG is the strain deformation capacity of MOS GelMA MPs prepared in Example 1 of the present invention; H is the release amount of MOS in Example 1 of the present invention.

[0027] Figure 3This is a microscope picture of the MOS GelMAMPs in Example 1 of the present invention after being immersed in a simulated environment.

[0028] Figure 4 Live-dead staining (left) of MOS GelMAMPs co-incubated with cells and CCK-8 detection (right) of microspheres co-incubated with cells in Example 1 of the present invention.

[0029] Figure 5 This is a growth curve experiment of co-culture of MOS GelMAMPs and AIEC in Example 1 of the present invention.

[0030] Figure 6 This is an experiment to detect the effect of MOS GelMAMPs on the adsorption of AIEC in Example 2 of the present invention; wherein AC is the binding of FimH protein to MOS in Example 2 of the present invention; DF is the adsorption of MOS GelMAMPs to AIEC under a confocal microscope in Example 2 of the present invention.

[0031] Figure 7 This is a growth curve experiment of co-incubation of bacteria and MOS GelMAMPs in Example 2 of the present invention.

[0032] Figure 8 This is an experiment to detect the effect of the microspheres in preventing and treating IBD in Example 3 of the present invention; wherein A is the treatment status of each group in Example 3 of the present invention; B is the small intestine experiment of mice before and after administration in Example 3 of the present invention; CD is the intestinal length measurement of mice before and after administration in Example 3 of the present invention; E is the body weight detection of mice before and after administration in Example 3 of the present invention; F is the DAI numerical statistics of mice before and after administration in Example 3 of the present invention.

[0033] Fig. 9 This is the HE staining picture in Example 3 of the present invention.

[0034] Fig.10 The expression levels of the main inflammatory factors (IL-6, IL-1β, TNF-α, ZO-1) detected by fluorescence quantitative PCR in Example 3 of the present invention.

[0035] Fig.11The experiment of regulating intestinal microbiome by MOS-GelMAMPs in Example 4 of the present invention; wherein, A is the Shannon index of each group in Example 4 of the present invention; B is the Chao index of each group in Example 4 of the present invention; C is the observed OTU index of each group in Example 4 of the present invention; D is the PCoA principal coordinate analysis of each group in Example 4 of the present invention; E is the partial least squares discriminant analysis of each group in Example 4 of the present invention; F is the community bar chart analysis of the intestinal microbiome of mice after different treatments in Example 4 of the present invention; GK is the relative abundance of the selected groups in the family classification after different treatments in Example 4 of the present invention; I is the LDA value determined by comparing each group using the LEfSe method in Example 4 of the present invention, and Taxa is listed. LDA (log10)>4.0, P<0.05 indicates that the relative abundance of the corresponding group is higher than that of other groups. DETAILED DESCRIPTION

[0036] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0037] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. The present invention can also be implemented in other ways different from those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited by the specific embodiments disclosed below.

[0038] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0039] The raw materials used in the present invention come from:

[0040]

[0041] Example 1

[0042] 1. Preparation method of MOS GelMAMPs

[0043] A 20% methacryloyl gelatin (GelMA) aqueous solution was prepared, 0.3% of a curing agent (Lap) and 50% of oligomannosaccharide (MOS) were added, and the mixture was mixed evenly to obtain a solution A.

[0044] A 10% PEG solution was prepared to obtain solution B.

[0045] Solution A and solution B were mixed evenly at a volume ratio of 2:1, and then cured under UV light for 3 seconds. 5 times the volume of sterile water was added, and the mixture was thoroughly mixed to disperse into microspheres; centrifuged at 500 rpm for 5 minutes, and this step was repeated 3 times to obtain MOS GelMAMPs. Figure 1 shown.

[0046] 2. Characterization of physicochemical properties, drug release and degradation performance of MOS GelMAMPs

[0047] The physical properties of MOS GelMAMPs were characterized by tensile tests, compression tests, and dynamic mechanical analyzer (DMA). The friction performance of the microspheres was tested using a Bruker friction and wear tester. The microspheres were placed in simulated gastric fluid and simulated intestinal fluid, and the release of MOS was detected by mass spectrometry. The integrity of the microspheres at different time points was observed using a confocal microscope.

[0048] like Figure 2 As shown in A, the Young's modulus of MOS GelMAMPs is 22.7±0.7 kPa, which has good compression resilience. Figure 2 As shown in BD, the elastic recovery rate, cohesion ratio and rebound rate of MOS GelMAMPs are 96.9%±0.9%, 85.4%±4.8% and 84.9%±2.5%, respectively, showing good recovery ability. Figure 2 As shown in EG, the prepared MOS GelMAMPs can achieve a strain deformation of more than 50% and immediately recover their original shape after the compression force is removed, showing good flexibility. This indicates that MOS GelMAMPs can maintain their spherical shape during intragastric administration and are ideal carriers for drug delivery.

[0049] After MOS GelMAMPs were immersed in simulated intestinal fluid (SIF), simulated gastric fluid (SFG) and phosphate buffer (PBS), the release amount of MOS was detected by UV spectrophotometer. Figure 3 , indicating that MOS will not be released outside the microspheres in sif and sgf.

[0050] Microscope images of MOS GelMAMPs after immersion in SIF, SFG, and PBS. Figure 3 As shown, it shows that the microspheres can remain intact in the body without being broken down, so the MOS inside will not leak out, and can directly adsorb AIEC and bring AIEC out of the body. In this process, MOS will not be used as a carbon source by bacteria.

[0051] 3. Evaluation of biocompatibility of MOS-loaded porous microgels

[0052] The biocompatibility of MOS GelMAMPs was detected by live-dead staining assay using cell counting kit-8 (CCK-8) and Calcein-AM and propidium iodide (PI) double staining kit. Intestinal epithelial cells were co-cultured with microspheres for 3 days. Cell viability was detected by CalceinAM / PI cell viability / cytotoxicity detection kit and CCK-8. After incubation in CalceinAM / PI buffer for 30 minutes, live cells (green) or dead cells (red) were observed under a fluorescence microscope. Cell viability was detected by incubating the cells with CCK-8 reagent for 2 hours and measuring the absorbance at 450nm using a microplate reader.

[0053] Live-dead staining and CCK-8 detection of MOS GelMA MPs co-incubated with cells Figure 4 The growth curve experiment of MOS GelMAMPs co-cultured with AIEC is as follows Figure 5 .

[0054] There was no significant difference compared with the control group without MOS GelMAMPs, which indicated that the biocompatibility of the experimental group was good.

[0055] Example 2 Detection of the effect of MOS GelMA MPs adsorbing AIEC

[0056] 1. Binding of FimH protein to MOS

[0057] The binding of FimH protein to MOS was demonstrated through molecular interaction experiments. The FimH expression strain was constructed using Escherichia coli BL21 (DE3), and then the target protein was induced and coated on the chip for molecular interaction experiments.

[0058] Glucose was used as negative control and mannose as positive control to detect the binding of FimH to MOS. The results are as follows: Figure 6 As shown in AC, it shows that FimH can bind to MOS, and the binding is better than mannose.

[0059] 2. Effect of MOS GelMAMPs on the growth of AIEC

[0060] WT was co-cultured with MOS solution, control group GelMAMPs (porous microspheres without MOS loading) and experimental group MOS GelMAMPs (porous microspheres loaded with MOS) in 96-well plates, and the growth was detected by a microplate reader.

[0061] like Figure 7 , indicating that GelMA MPs and MOS GelMAMPs would not affect the growth of AIEC as carbon sources.

[0062] 3. Adsorption effect of MOS GelMAMPs on AIEC

[0063] AIEC was co-incubated with the control group GelMA MPs (porous microspheres without MOS loading) and the experimental group MOS GelMAMPs (porous microspheres loaded with MOS). The microspheres were separated by low-speed centrifugation and then plated and the colonies were counted. To detect whether the adsorption of AIEC by MOS GelMAMPs was targeted by FimH, the ΔfimH strain was constructed, and WT and ΔfimH were incubated with porous microspheres loaded with MOS, respectively. The microspheres were removed by low-speed centrifugation and plated. The WT and ΔfimH strains with mCherry were constructed, and after incubation with the control group and the experimental group, they were observed by confocal microscopy to detect their adsorption.

[0064] The results are as follows Figure 6 As shown in DF, after incubation with AIEC (red fluorescence), AIEC and MOSGelMAMPs were observed under a confocal microscope, while there was no obvious colocalization in the control group. After the loss of fimH, this adsorption also disappeared, indicating that the porous microspheres loaded with MOS can adsorb AIEC by binding to the FimH protein.

[0065] Example 3 Detection of the effect of microspheres in preventing and treating IBD

[0066] 1. The duration of microspheres' action in mice,

[0067] C57BL / 6 female mice were fasted for 24 h, and all abdominal hair was shaved before imaging;

[0068] Mice were orally gavaged with microspheres carrying fluorescent groups, and every 6 hours, the mice were imaged under IVIS;

[0069] The IBD mouse model was constructed. After 7 days of treatment with 5% DSS (in 1985, Japanese scholars first used dextransulphate sodium (DSS) to prepare a hamster ulcerative colitis model, and a large amount of data has shown that the etiology, clinical symptoms, pathological changes and treatment response of the DSS colitis model are similar to those of human ulcerative colitis (UC)), mice were gavaged with AIEC. The amount of bacteria gavaged per mouse was CFU=10 9; AIEC was treated with microgels after oral gavage, and the control group (GelMAMPs) and the experimental group (MOS GelMAMPs) were gavaged separately; the excrement of the two groups was collected every 24 hours, homogenized, diluted and spread, and the AIEC infection status was calculated by colony counting; at the same time, the disease activity index score (DAI score), body weight measurement and intestinal length measurement were performed on the treatment group and the experimental group.

[0070] Mice were treated as Figure 8 As shown in A, the efficacy of the drug in mice is Figure 8 As shown in Figure 2, in IBD model mice, after administration, the efficacy of the MOS GelMAMPs group was significantly better than that of the GelMAMPs group, inhibiting the colonization of AIEC; in IBD model mice, the length of the small intestine was detected after administration. Figure 8 As shown in B, it was found that the length of the small intestine in the MOS GelMAMPs group was the longest and closest to that in the blank control group. Figure 8 As shown in CD, it was found that the MOS GelMAMPs group had the smallest change in body weight; Figure 8 As shown in F, the DAI score was closest to the blank control group, indicating that the treatment effect was the best.

[0071] The small intestine of the treatment group and the control group was taken for paraffin embedding and HE staining. Fig. 9 As shown, pathological analysis and scoring were performed, and according to the stained colon injury score, MOS GelMAMPs treatment also helped to maintain the integrity of the colon epithelium and reduce the infiltration of mucosal proinflammatory cells.

[0072] RNA was extracted from the small intestine of mice in the treatment group and the experimental group, and then reverse transcribed and fluorescent quantitative PCR was performed to detect the changes in the expression levels of major inflammatory factors (IL-6, IL-1β, TNF-α, ZO-1), such as Fig.10 The primers used for fluorescence quantitative PCR are shown in Table 1.

[0073] Table 1

[0074]

[0075]

[0076] Example 4 MOS-GelMAMPs regulate the intestinal microbiome

[0077] To determine whether MOS GelMAMPs treatment altered the microbiome, high-throughput gene sequencing analysis was performed on 16S rRNA in fecal bacterial DNA isolated from mice in the control (CT), DSS, MOS, GelMA, and MOS GelMA groups.

[0078] First, the alpha diversity of different methods was analyzed. Although the Shannon index did not differ among the DSS group, MOS group, GelMA group, and MOS GelMA group, the Chao1 index and observed OTU index in the MOS GelMA MPs group increased significantly compared with the DSS group, indicating that MOS GelMAMPs treatment effectively restored the dysbiosis of IBD ( Fig.11 AC). To deepen our understanding of the role of MOS GelMA MPs in microbial community diversity, we performed principal coordinate analysis (PCoA) using Bray-Curtis metric distance and partial least squares discriminant analysis (PLS-DA) to assess the similarity of microbial community structure among groups (β diversity). Notably, we observed clear clustering of microbiota composition among the five groups ( Fig.11 DE). These data indicate that MOS GelMAMPs treatment significantly altered mucosal bacterial diversity.

[0079] Subsequently, the relative abundance of gut microbiota in all available samples from each group was assessed. Changes at the family level showed that the MOS GelMAMPs treatment had a unique microbial composition compared with the DSS group ( Fig.11 F), indicating that MOS GelMAMPs treatment can reshape intestinal bacteria after DSS treatment.

[0080] Then, the dominant bacterial families were analyzed. Compared with the intestinal microbiota of the DSS-treated group, the MOS GelMAMPs treatment was characterized by a significant increase in the relative abundance of Prevotelaceae and Bifidobacteriaceae ( Fig.11 G, H). Compared with the gut microbiota of the DSS-treated group, MOS treatment significantly increased the relative abundance of Lactobacillaceae ( Fig.11 I). Meanwhile, treatment with MOS GelMAMPs significantly reduced the relative abundance of Enterobacteriaceae, which are generally known for expressing type 1 pili that mediate mannose-sensitive host cell adhesion ( Fig.11 J).

[0081] To identify which bacteria were altered by MOS GelMAMPs treatment and thus affected the disease progression of DSS-induced colitis, a high-dimensional class comparison was performed using linear discriminant analysis (LDA) with effect size (LEfSe), and significant differences in the dominance of bacterial communities among the five groups were detected. According to the analysis results, Prevotellaceae and Bifidobacteriaceae were the key bacterial types that contributed to the restoration of the intestinal microbiota in the MOS GelMAMPs group ( Fig.11 K).

[0082] In summary, treatment with MOS GelMAMPs could significantly increase the relative abundance of Bifidobacterium and decrease the relative abundance of Enterobacteriaceae.

[0083] Sequence Listing

[0084] SEQ ID NO.1

[0085] Artificial sequence

[0086] ATGGCCTTCCGTGTTCCTAC

[0087] SEQ ID NO.2

[0088] CAGATGCCTGCTTCACCAC

[0089] SEQ ID NO.3

[0090] ATGGCAACTGTTCCTGAACTCAACT

[0091] SEQ ID NO.4

[0092] CAGGACAGGTATAGATTCTTTCCTTT

[0093] SEQ ID NO.5

[0094] CTAGGTTTGCCGAGTAGATCT

[0095] SEQ ID NO.6

[0096] CACAAAGCCAGAGTCCTTCAGAGA

[0097] SEQ ID NO.7

[0098] CAACATACAGTGACGCTTCACA

[0099] SEQ ID NO.8

[0100] CACTATTGACGTTTCCCCACTC

[0101] SEQ ID NO.9

[0102] GAGGCCAAGCCCTGGTATG

[0103] SEQ ID NO.10

[0104] CGGGCCGATTGATCTCAGC

[0105] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the present invention.

Claims

1. A method for preparing a porous microgel loaded with oligomannosaccharides, characterized in that: include, Adding a curing agent and oligomannosaccharide to the methacrylylated gelatin aqueous solution and mixing them evenly to obtain a solution A; Polyethylene oxide is mixed with water to obtain solution B; After solution A and solution B are blown evenly, they are solidified by ultraviolet light, sterile water is added and blown to disperse them into microspheres, and then centrifuged to obtain porous microgels loaded with oligomannosaccharides.

2. The preparation method according to claim 1, characterized in that: The volume percentage of the methacrylated gelatin aqueous solution is 20-30%.

3. The preparation method according to claim 1 or 2, characterized in that: The mass percentage of the curing agent in the methacrylic gelatin aqueous solution is 0.1-0.3%, and the mass percentage of the oligomannosaccharide in the methacrylic gelatin aqueous solution is 50-60%.

4. The preparation method according to claim 1, characterized in that: The volume ratio of solution A to solution B is 2:

1.

5. The preparation method according to claim 1, characterized in that: The UV lamp curing time is 4s to 180s.

6. A porous microgel loaded with oligomannosaccharides prepared by the preparation method according to any one of claims 1 to 5.

7. The porous microgel according to claim 6, characterized in that: The particle size of the porous microgel loaded with oligomannosaccharide is 100-200 μm.

8. The porous microgel according to claim 7, characterized in that: The microspheres of the porous microgel are porous structures, and oligomannose is embedded in the microspheres.

9. Use of the porous microgel according to claim 6 in preparing a drug for treating inflammatory bowel disease.

10. The use according to claim 9, characterized in that: Including, the porous microgel competitively adsorbs bacteria expressing FimH and improves intestinal flora.

Images