Product
Patsnap Eureka
For R&D, Patsnap Eureka makes reading and utilizing patents & technical documents easy.
Patsnap Eureka AIR
Designed for self-driven R&D workflows. Generate viable solutions, solve complex R&D challenges, empower your innovation with AI.
Patsnap Eureka Materials
Designed for material experts only. Revolutionize your material R&D, from search, analyze, to developing new materials.
Feature
TechResearch
Generate reliable direction feasibility study reports for your R&D in just a few steps.
TechSeek
Discover and master advanced knowledge NOW. Basics, ideas, possibilities, all at once.
TechMind
As an expert in R&D Theories, TechMind can generates customized viable solutions instantly.
TechRisk
Analyze your overall solution with one click, know your potential R&D risks in advance.
TechMonitor
Get weekly tech updates, stay abreast of the latest tech innovations and key insights.
Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
57results about How to "Potential for clinical application" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
Mesoporous polydopamine loaded manganese carbonyl multifunctional nano diagnosis and treatment agent and preparation method and application thereof
ActiveCN108434462ASolve the problem of high circulating toxicityImprove light-to-heat conversion efficiencyEnergy modified materialsInorganic active ingredientsMedicineBiocompatibility Testing
The invention discloses a mesoporous polydopamine loaded manganese carbonyl multifunctional nano diagnosis and treatment agent and a preparation method and an application thereof. The multifunctionalnano diagnosis and treatment agent is a water-soluble mesoporous polydopamine carrier-coated hydrophobic manganese carbonyl drug, wherein the mass ratio of mesoporous polydopamine to manganese carbonyl is 1-8:1. The multifunctional nano diagnosis and treatment agent realizes gas and photo-thermal collaborative treatment under MRI and photoacoustic imaging guiding, is hopeful for increasing tumourtreatment effect, has good biocompatibility, and has clinical application potential.
Owner:SUN YAT SEN UNIV
Immunostimulatory oligonucleotide that induces interferon alpha
ActiveUS7718623B2Less side effectsImprove the immunityAntibacterial agentsBiocideInterferon alphaBiology
An immunostimulatory oligonucleotide that is represented by the general formula 5′-Gm-GACGATCGTC-Gn-3′ or 5′-Gm-CACGATCGTG-Gn-3′ (in the formula, m and n are each independently an integer from 1 to 9 and m+n=10) and that comprises any of the following base sequences: GGACGATCGTCGGGGGGGGG (SEQ. ID. NO.: 1), GGGACGATCGTCGGGGGGGG (SEQ. ID. NO.: 2), GGGGACGATCGTCGGGGGGG (SEQ. ID. NO.: 3), GGGGGGGACGATCGTCGGGG (SEQ ID NO: 4), GGGGGGGGACGATCGTCGGG (SEQ. ID. NO.: 5), GGGGGGGGGACGATCGTCGG (SEQ. ID. NO.: 6), GGGGGGGGGGACGATCGTCG (SEQ. ID. NO.: 7), and GGGGGGGGGCACGATCGTGG (SEQ. ID. NO.: 8).
Owner:IHO SUMIKO
Isobenzazole compounds derived from marine fungi, preparation method of isobenzazole compounds and application of isobenzazole compounds in preparation of anti-inflammatory drugs
ActiveCN107721990APotential for clinical applicationInhibitionOrganic chemistryAntipyreticAnti inflammatory treatmentStructural formula
The invention discloses isobenzazole compounds derived from marine fungi, a preparation method of the isobenzazole compounds and application of the isobenzazole compounds in the preparation of anti-inflammatory drugs. The structural formulae of the isobenzazole new compounds are represented by a formula I, II, III or IV. The new compounds are capable of remarkably inhibiting the generation of LPS-induced NO and can be used for preparing the anti-inflammatory drugs, and the IC50 of the compounds are respectively 8.9mM(I), 12.4mM(II), 18.2mM(III) and 22.7mM(IV). Therefore, the isobenzazole compounds have the clinical application potential in the anti-inflammatory treatment.
Owner:SUN YAT SEN UNIV
Synthesis of 8h-3a-aza-cyclopenta[a]indenes and 5,10-dihydropyrrolo[1,2-b]isoquinolines derivatives and their use as antitumor therapeutic agents
InactiveUS20090117125A1Potent therapeutic efficacyPotential for clinical applicationBiocideOrganic chemistryCarbamateHuman tumor
The present disclosure relates to a series of bis(hydroxymethyl) and its bis(carbamate) of 8H-3a-azacyclopenta[a]indene-1-yl and 5,10-dihydropyrrolo-[1,2-b]isoquinolines derivatives (Formula I-Formula IV) as DNA di-alkylating agents. The preliminary antitumor studies indicated that compounds disclosed herein could exhibit potent cytotoxicity in vitro and antitumor therapeutic efficacy in human tumor xenografts and could have little or no cross-resistance to either Taxol or Vinblastine. The results demonstrated that compounds disclosed herein possess potent antitumor therapeutic efficacy and are expected to have potential for clinical applications.
![Synthesis of 8h-3a-aza-cyclopenta[a]indenes and 5,10-dihydropyrrolo[1,2-b]isoquinolines derivatives and their use as antitumor therapeutic agents](https://images-eureka.patsnap.com/patent_img/5ff64d09-3cd6-4b58-a304-bcfd4fcdb6f0/US20090117125A1-20090507-D00001.png "Synthesis of 8h-3a-aza-cyclopenta[a]indenes and 5,10-dihydropyrrolo[1,2-b]isoquinolines derivatives and their use as antitumor therapeutic agents")
![Synthesis of 8h-3a-aza-cyclopenta[a]indenes and 5,10-dihydropyrrolo[1,2-b]isoquinolines derivatives and their use as antitumor therapeutic agents](https://images-eureka.patsnap.com/patent_img/5ff64d09-3cd6-4b58-a304-bcfd4fcdb6f0/US20090117125A1-20090507-D00002.png "Synthesis of 8h-3a-aza-cyclopenta[a]indenes and 5,10-dihydropyrrolo[1,2-b]isoquinolines derivatives and their use as antitumor therapeutic agents")
![Synthesis of 8h-3a-aza-cyclopenta[a]indenes and 5,10-dihydropyrrolo[1,2-b]isoquinolines derivatives and their use as antitumor therapeutic agents](https://images-eureka.patsnap.com/patent_img/5ff64d09-3cd6-4b58-a304-bcfd4fcdb6f0/US20090117125A1-20090507-D00003.png "Synthesis of 8h-3a-aza-cyclopenta[a]indenes and 5,10-dihydropyrrolo[1,2-b]isoquinolines derivatives and their use as antitumor therapeutic agents")
Owner:MEMORIAL SLOAN KETTERING CANCER CENT
Upconversion fluorescence resonance energy transfer detection composition and detection method based on dopamine polymerization reaction regulation
ActiveCN107402198AShorten the energy transfer distanceRealize detectionFluorescence/phosphorescenceComplex systemQuenching
The invention discloses upconversion fluorescence resonance energy transfer detection composition and a detection method. An upconversion fluorescence nanomaterial without oleic acid ligand is adopted as a fluorescence donor in the method, the energy transfer distance between the fluorescence donor and a fluorescence receptor is effectively shortened, the quenching capacity is excellent, and the detection sensitivity can be effectively improved. Besides, the adopted upconversion fluorescence resonance energy transfer system can effectively avoid interference of background fluorescence in a complex biological system, can be used for detecting hydrogen peroxide or hydrogen peroxide generation system related substances, can also be used for further detecting hydrogen peroxide or hydrogen peroxide generation system related substances in serum or whole blood samples, has the advantages of being convenient to operate, good in anti-interference performance, rapid, sensitive, economical, practical and the like, can provide theoretical basis and technological support for real-time monitoring of hydrogen peroxide and glucose in complex systems and has certain clinical application potentials.
Owner:FUJIAN INST OF RES ON THE STRUCTURE OF MATTER CHINESE ACAD OF SCI
Preparation method of zeolite imidazole framework structure material
The invention discloses a preparation method of a zeolite imidazole framework structure material. According to the method, a zeolite imidazole framework structure is subjected to ion exchange to become a composite of two metal ions, wherein post-exchanged particles have a nuclear magnetic resonance effect. The method is mild in reaction condition, easy to operate and low in raw material cost and comprises simple steps. The zeolite imidazole framework structure contrast medium prepared with the method has good water solubility, improved application safety, small toxicity to normal cells and efficient contrast effects.
Owner:NINGBO INST OF MATERIALS TECH & ENG CHINESE ACADEMY OF SCI
Di-sesquiterpene compound derived from marine fungi, preparation method of di-sesquiterpene compound and application of di-sesquiterpene compound in preparation of anti-inflammatory drugs
ActiveCN109970538APotential for clinical applicationRich sourcesFungiOrganic chemistryPositive controlStructural formula
The invention belongs to the technical field of pharmaceutical compounds, and particularly discloses a di-sesquiterpene compound derived from marine fungi, a preparation method of the di-sesquiterpenecompound and application of the di-sesquiterpene compound in preparation of anti-inflammatory drugs. The structural formula of the di-sesquiterpene compound is shown in formulas I, II and III, and the di-sesquiterpene compound is prepared by fermenting marine fungus Aspergillus sp. ZJ-68, wherein the marine fungus Aspergillus sp. ZJ-68 was preserved in Guangdong Culture Collection Center on Jan.21, 2019 with the preservation number of GDMCC No: 60541; the production of NO induced by LPS can be significantly inhibited by compounds I, II, and III, specifically, IC50 is 16.48 micrometer, 20.7 micrometer and 24.4 micrometer, respectively, and the IC50 of the positive control indomethacin was 37.5 micrometer. Therefore, the di-sesquiterpene compound can be used for preparing the anti-inflammatory drugs and has the clinical application potential of anti-inflammatory treatment.
Owner:SUN YAT SEN UNIV
Benzophenone derivatives derived from marine fungi, preparation method of benzophenone derivatives and application of benzophenone derivatives in preparation of antituberculosis drugs
ActiveCN107721972APotential for clinical applicationInhibitory activityAntibacterial agentsOrganic chemistryDrugProtein tyrosine phosphatase
The invention discloses benzophenone derivatives derived from marine fungi, a preparation method of the benzophenone derivatives and application of the benzophenone derivatives in the preparation of antituberculosis drugs. The structural formulae of the benzophenone derivatives are represented by a formula I or II. The compounds have the activities of remarkably inhibiting protein tyrosine phosphatase secreted by mycobacterium tuberculosis and can be used for preparing the antituberculosis drugs, and IC50 of the compounds are respectively 5.2mM(I) and 4.2mM(II). Therefore, the benzophenone derivatives derived from marine fungi have the clinical application potential in the treatment of tuberculosis.
Owner:SUN YAT SEN UNIV
Application of compound sclerotiorin in preparing antituberculosis medicine
InactiveCN106420755APrevent proliferationReduce proliferationAntibacterial agentsOrganic active ingredientsMicroorganismTreating tuberculosis
The invention discloses an application of a compound sclerotiorin in preparing antituberculosis medicine. Research discovers that the compound sclerotiorin can inhibit proliferation of mycobacterium tuberculosis in cells, the compound sclerotiorin is combined with rifampicin or isoniazide, proliferation of mycobacterium tuberculosis in macrophage can be effectively reduced, the compound sclerotiorin is a natural metabolic activity micromolecule product separated from marine microorganisms, the structure of the compound sclerotiorin is analyzed, the compound sclerotiorin can be produced through large-scale fermentation and separation, sources are rich, and the production cost is low; under treatment of the compound sclerotiorin of 40 microns and rifampicin of 0.025 mg / L, or under treatment of the compound sclerotiorin of 40 microns and isoniazide of 0. 05 mg / L, the number of the mycobacterium tuberculosis in cells is reduced by 84% and 45% respectively. The compound sclerotiorin has the clinical application potential for treating tuberculosis.
Owner:SUN YAT SEN UNIV
Organic and inorganic hybrid composite silver nanoparticle as well as preparation method and application of organic and inorganic hybrid composite silver nanoparticle
ActiveCN109481678AEasy to prepareMild conditionsAntibacterial agentsEnergy modified materialsConductive polymerNear infrared absorption
The invention discloses an organic and inorganic hybrid composite silver nanoparticle as well as a preparation method and an application of the organic and inorganic hybrid composite silver nanoparticle. The preparation method comprises the steps: firstly, preparing a conductive polymer nanoparticle from a near-infrared conductive polymer by using a re-sedimentation method, then, adding the conductive polymer nanoparticle into a Tris-HCl solution containing dopamine, carrying out stirring for polydopamine modification, carrying out centrifugal purification and reducing silver nitrate by usingglucose to finally form a silver-loaded nanoparticle. The conductive polymer nanoparticle disclosed by the invention has a strong near-infrared adsorption effect so as to have efficient photothermal properties; a polydopamine modification layer not only provides a reduction site of the silver nanoparticle by utilizing abundant functional groups on the surface, but also can further enhance the photothermal properties of the nanoparticle; and the silver nanoparticle has efficient antibacterial property, and the composite silver nanoparticle simultaneously has photothermal antibacterial and silver nanometer antibacterial effects after overcoming the defect of poor stability.
Owner:NANJING UNIV OF POSTS & TELECOMM
Method for detecting hydrogen peroxide and relevant target object on the basis of nanoprobe
ActiveCN110411990AAccurate determination of concentrationEasy to operateFluorescence/phosphorescenceOxidation reductionUric acid
The invention belongs to the technical field of biological detection, and discloses a method for detecting a hydrogen peroxide and a relevant target object on the basis of a nanoprobe. The method adopts a water-soluble rare earth doped NaCeF4 nanomaterial as a fluorescence probe, rare earth ion luminescence is quenched through the oxidation-reduction reaction of the hydrogen peroxide and a ceriumion, and the change of doped rare earth ion fluorescence intensity is used for realizing the detection of hydrogen peroxide concentration. The method can be used for detecting the hydrogen peroxide instandard solution or reactants in an enzymatic reaction for generating the hydrogen peroxide, and the detection of the hydrogen peroxide, biological enzymes or zymolyte (such as uric acid) in serumscan be realized. The method has the advantages of being convenient in operation, good in anti-interference performance, quick, sensitive, economic, practical and the like, a theoretical foundation andtechnical support are provided for solving the real-time detection of the relevant substances of uric acid and hydrogen peroxide generation systems in a complex system, and the method has certain clinic application potential.
Owner:FUJIAN INST OF RES ON THE STRUCTURE OF MATTER CHINESE ACAD OF SCI
Complex bone cement
InactiveCN103656759AImprove biological activityReduce releaseProsthesisCalcium biphosphatePowder mixture
The present application provides a complex bone cement including a powder mixture and an aqueous solution. The powder mixture includes calcium sulfate and a calcium phosphate salt. The aqueous solution includes water, collagen and a pharmaceutical ingredient in effective dose. By adding collagen and the pharmaceutical ingredient to the aqueous solution of the bone cement, the drug will release in a long-acting manner and induce differentiation of osteoblast as well as the healing of bone defects.
Owner:FAR EASTERN MEMORIAL HOSPITAL
Polypeptide with morphine tolerance and side effect relieving function and application of polypeptide
ActiveCN110128527AInterference interactionPotential for clinical applicationCell receptors/surface-antigens/surface-determinantsBacteriaSide effectΜ-opioid receptor
The invention discloses a polypeptide with a morphine tolerance and side effect relieving function and an application of the polypeptide. The polypeptide is named as TAT-mu1 and as shown in following(1) or (2): (1) a polypeptide of a (12-58) amino acid residue of an amino acid sequence as shown in SEQ ID NO:1; (2) a polypeptide of an amino acid sequence as shown in SEQ ID NO:1. The polypeptide TAT-mu1 comes from a mu opioid receptor carboxyl terminal, the TAT-mu1 and the mu opioid receptor carboxyl terminal can be competitively phosphorylated by G protein-coupled receptor kinase when morphine acts on a mu opioid receptor, the phosphorylated TAT-mu1 can be combined with beta-arrestin2, and interaction of the mu opioid receptor and the beta-arrestin2 is interfered, so that beta-arrestin2 mediated morphine tolerance and side effect symptoms are relieved. The polypeptide TAT-mu1 has clinical application potential in prevention and treatment of morphine tolerance, side effects and thelike.
Owner:XUZHOU MEDICAL UNIV
Application of OLC1 gene expression level in prognosis evaluation of bladder cancer
PendingCN114045338APredict prognosisPotential for clinical applicationHealth-index calculationMicrobiological testing/measurementBladder cancer patientRecurrence prediction
The invention discloses application of an OLC1 gene expression level in prognosis evaluation of bladder cancer. The invention provides an application of an OLC1 gene as a marker in any one of the following applications: (A1) an application in preparation of a product for prognosis risk assessment of a bladder cancer patient; (A2) application in prognosis risk assessment of bladder cancer patients. The recurrence prediction model constructed by the embodiment of the invention can better predict the prognosis of the bladder urothelial carcinoma patient, and has the potential of clinical application.
Owner:CHINA JAPAN FRIENDSHIP HOSPITAL +2
A kind of sodium tetradecyl sulfate injection and preparation method thereof
ActiveCN104840419BImprove stabilityHigh content of active ingredientsOrganic active ingredientsPharmaceutical delivery mechanismBULK ACTIVE INGREDIENTSodium tetradecyl sulfate
The invention discloses a tetradecyl sodium sulfate injection and a preparation method thereof. Sodium tetradecyl sulfate injection of the present invention, its raw material formula comprises following components: disodium hydrogen phosphate, sodium tetradecyl sulfate, benzyl alcohol, water and pH adjusting agent; Said sodium tetradecyl sulfate injection The pH of the liquid=7.5~7.9. The preparation method of sodium tetradecyl sulfate injection of the present invention comprises the following steps: mixing the aqueous solution of disodium hydrogen phosphate with pH=8.4 to 8.8 and the mixed solution of benzyl alcohol with the tetradecyl sodium Alkyl sodium sulfate is mixed evenly, and the pH regulator is added to make the pH of the mixed system to 7.5-7.9. The sodium tetradecyl sulfate injection of the invention has good stability, high content of active ingredients, meets the requirements of pharmacopoeia standards, and has the potential of clinical application.
Owner:SPH NO 1 BIOCHEM & PHARMA CO LTD +1
Marine fungus-derived meroterpenoids and application thereof in preparation of anti-inflammatory drugs
ActiveCN113121557AInhibitionPotential for clinical applicationFungiOrganic chemistryInflammatory factorsChemical compound
The invention discloses marine fungus-derived meroterpenoids and application thereof in preparation of anti-inflammatory drugs. According to the invention, the meroterpenoids are separated from a fermentation product of a marine fungus Aspergillus terreus GZU-31-1, and the structural formulas of the meroterpenoids are respectively as shown in formulas 1-5. The novel compounds can significantly inhibit the generation of LPS-induced inflammatory factor NO, and the IC50 of the compounds 1-5 is 6.74 + / -0.77 [mu] mol / L, 22.18 + / -0.94 [mu] mol / L, 25.87 + / -3.1 [mu] mol / L, 26.47 + / -0.98 [mu] mol / L, and 29.59 + / -3.9 [mu] mol / L. The compounds have the clinical application potential of anti-inflammatory treatment, can be used for developing novel anti-inflammatory drugs, and have good application prospects.
Owner:GUANGZHOU UNIVERSITY OF CHINESE MEDICINE
Bionic glycopolypeptide hydrogel as well as preparation method and application thereof
ActiveCN113214476ASolve the adhesionFix compatibility issuesPharmaceutical delivery mechanismBandagesHemolysisBiocompatibility
The invention belongs to the field of biomedical materials, and particularly relates to bionic glycopolypeptide hydrogel as well as a preparation method and application thereof. The bionic glycopolypeptide hydrogel takes polylysine as a skeleton macromolecule, catechol groups and oligosaccharide are modified in a polymer molecular chain to obtain bionic glycopolypeptide, and under the action of dynamic crosslinking of coordinate bonds or crosslinking of covalent bonds, the coordinate bond bionic glycopolypeptide hydrogel or the covalent bond bionic glycopolypeptide hydrogel is prepared. The hydrogel not only has an extremely low hemolysis rate and excellent biocompatibility, but also realizes the dual effects of quickly stopping bleeding and promoting wound healing, and has clinical application potential in the aspects of wound bleeding stopping and tissue healing.
Owner:SHANGHAI JIAO TONG UNIV
Application of betulinic acid in synergistically inducing apoptosis of multidrug-resistant breast cancer cells
PendingCN111281876AGrowth inhibitionPromote apoptosisOrganic active ingredientsAntineoplastic agentsDocetaxelApoptosis
The invention discloses an application of betulinic acid in synergistically inducing apoptosis of multidrug-resistant breast cancer cells. The betulinic acid can inhibit the growth of a multidrug-resistant breast cancer cell strain MCF-7-AR; the betulinic acid can be used as a chemotherapy sensitizer, enhances the sensitivity of MCF-7-AR to adriamycin, docetaxel and other chemotherapy drugs, promotes apoptosis of multidrug-resistant breast cancer cells, and can be used for preparing tumor inhibitors according to the characteristic of synergistically inducing apoptosis of multidrug-resistant cells.
Owner:SHAANXI UNIV OF SCI & TECH
A class of benzophenone derivatives derived from marine fungi, their preparation methods and their application in the preparation of anti-tuberculosis drugs
ActiveCN107721972BPotential for clinical applicationInhibitory activityAntibacterial agentsOrganic chemistryAntituberculous drugsBenzophenone
Owner:SUN YAT SEN UNIV
Marine fungus-derived meroterpenoid compound and application in preparation of anti-hepatic fibrosis drugs
ActiveCN113173969AGood application prospectPotential for clinical applicationFungiDigestive systemChemical compoundHepatic stellate cell
The invention discloses a marine fungus-derived meroterpenoid compound and application in preparation of anti-hepatic fibrosis drugs. According to the present invention, the meroterpenoid derivative is separated from a fermentation product of a strain of marine fungi Aspergillus terreus GZU-31-1, and the novel compound can significantly down-regulate expression of alpha-SMA induced by TGF-beta1, shows relatively strong activity of inhibiting activation of hepatic stellate cells, has clinical application potential in anti-hepatic fibrosis treatment, can be used for preparing anti-hepatic fibrosis drugs, and has a good application prospect.
Owner:GUANGZHOU UNIVERSITY OF CHINESE MEDICINE
Polypeptide compound taking PD-1 receptor as target point as well as preparation method and application thereof
ActiveCN113416232AEnhanced inhibitory effectEasy to synthesizePeptide/protein ingredientsAntipyreticAnalgesics drugsReceptor
The invention discloses a polypeptide compound taking a PD-1 receptor as a target spot. The polypeptide compound comprises a compound 1, a compound 2, a compound 3, a compound 4 and a compound 5, wherein the amino acid sequences of the compounds 1-5 are as shown in SEQ ID NO: 1-5. The invention also discloses a preparation method of the polypeptide compound taking the PD-1 receptor as the target spot, and the preparation method comprises the following processes: coupling amino acids of compounds 1-5 to solid-phase resin in sequence according to a peptide sequence by utilizing a solid-phase synthesis mode, cracking by a cutting reagent, freeze-drying, preparing and purifying to obtain the target compound. The invention also discloses application of the polypeptide compound taking the PD-1 receptor as the target spot in preparation of analgesic drugs. According to the small molecule polypeptide, compounds 1-5 can be combined with PD-1, and the obvious inhibition effect on inflammatory pain and visceral pain is achieved under intrathecal administration; and synthesis is simple, purification is easy, and large-scale synthesis is facilitated.
Owner:NANTONG UNIVERSITY
Fluorescence analysis method for determinating artemisinin content
ActiveCN108844933ARealize trace detectionGood linear relationshipFluorescence/phosphorescenceCatalytic oxidationOxygen
The invention belongs to the technical field of spectral analysis and detection, and particularly relates to a fluorescence analysis method using a novel nanomaterial, namely graphene quantum dots, inparticular to a fluorescence analysis method for determinating the artemisinin content. A peroxy bridge structure of artemisinin reacts with p-aminophenylboronic acid, a catalytic oxidation reactionis further performed in the presence of oxygen to form p-iminobenzoquinone, and the fluorescence of the graphene quantum dots is quenched. The fluorescence detection method provided by the invention is low in cost, easy to operate, low in detection limit, good in selectivity and high in sensitivity. By the fluorescence analysis method, application of the graphene quantum dots to the field of medicine analysis and detection is expanded, and a convenient and accurate technical means is provided for evaluation and supervision of the quality of an artemisinin medicine.
Owner:湘西自治州奥瑞克医药化工有限责任公司
A class of isoindolinone compounds derived from marine fungi, their preparation methods and their application in the preparation of anti-inflammatory drugs
ActiveCN107721990BPotential for clinical applicationInhibitionOrganic chemistryAntipyreticChemical compoundMicrobiology
Owner:SUN YAT SEN UNIV
Method for detecting hydrogen peroxide and related targets based on CaS nano fluorescent probe
PendingCN111829993AAccurate determination of concentrationEasy to operateFluorescence/phosphorescenceFluoProbesRare earth ions
The invention belongs to the technical field of biological detection, and discloses a method for detecting hydrogen peroxide and related targets based on a nanoprobe. According to the method, a water-soluble rare earth doped CaS: Ce<3+> / Ln<3+> nano material is used as a fluorescent probe, rare earth ion luminescence is quenched through an oxidation-reduction reaction of hydrogen peroxide and cerium ions, and the concentration of hydrogen peroxide is detected by utilizing the change of the fluorescence intensity of doped rare earth ions. The method can be used for detecting hydrogen peroxide ina standard solution or reactants in an enzymatic reaction for generating hydrogen peroxide, can further realize the detection of hydrogen peroxide, biological enzyme or substrate (such as xanthine) in the serum, has the advantages of being simple and convenient to operate, good in anti-interference performance, rapid, sensitive, economical, practical and the like, can provide theoretical basis and technical support for real-time detection of hydrogen peroxide and hydrogen peroxide generation system related substances in a complex system, and has certain clinical application potential.
Owner:FUJIAN INST OF RES ON THE STRUCTURE OF MATTER CHINESE ACAD OF SCI
Application of gentiopicroside (Gen) in reversing multidrug resistance of hepatoma cell HepG2
PendingCN111214479AGrowth inhibitionPromote apoptosisOrganic active ingredientsInorganic active ingredientsDoxorubicinMolecular biology
The invention discloses application of gentiopicroside (Gen) in reversing multidrug resistance of hepatoma cell HepG2. The Gen can not only inhibit growth of the multidrug resistant hepatoma cell lineHepG2R, but also be used as a chemosensitizer to enhance sensitivity of the HepG2R to chemotherapy drugs such as fluorouracil and doxorubicin, promote multidrug resistant hepatoma cell apoptosis, andcan be applied to preparation of a tumor inhibitor according to the characteristic of reversing the multidrug resistance of cells.
Owner:SHAANXI UNIV OF SCI & TECH
Thyroid malignant nodule detection method based on deep learning
PendingCN112001877ARealize Auxiliary DetectionImprove detection accuracyImage enhancementImage analysisMalignancyAided diagnosis
The invention relates to a thyroid malignant nodule detection method based on deep learning, the method is used for the auxiliary diagnosis of thyroid malignant nodules, and the automatic labeling ofa region of interest can be achieved after the training of a large amount of data under the characteristics of low medical image resolution, low precision and low target and background identificationdegree. Errors caused by subjective factors can be effectively reduced, and radiologists can be helped to diagnose quickly and accurately. The detection precision and speed are considerable, and the method has the potential of clinical application.
Owner:TIANJIN UNIV
A kind of polydopamine nanodiagnostic agent and preparation method thereof
ActiveCN109364245BWith photothermal effectImprove hypoxiaEnergy modified materialsEchographic/ultrasound-imaging preparationsTumor therapySinglet oxygen
The invention discloses a polydopamine nanometer diagnosis and treatment preparation and a preparation method thereof. The nano-therapeutic agent uses mesoporous polydopamine as a carrier, and carries rhodium nanoparticles in the pores and surfaces of mesoporous polydopamine respectively through hydrothermal synthesis reaction, and then absorbs photosensitizer chlorin (Ce6) on polydopamine and polydopamine. The polydopamine nanometer therapeutic agent with good dispersion is obtained on the composite nanoparticle of rhodium. The invention utilizes the photothermal effect of the carrier mesoporous polydopamine and the rhodium nanoparticle itself to locally heat up the tumor site. Combined with the catalytic properties of rhodium nanoparticles, it catalyzes the decomposition of hydrogen peroxide in the tumor microenvironment to generate oxygen. Under the conditions of photosensitizer Ce6 and external laser, it can realize the generation of singlet oxygen and effectively kill cancer cells. At the same time, combined with the photoacoustic imaging properties of polydopamine, the purpose of photoacoustic imaging-guided photothermal therapy and photodynamic synergistic therapy can be realized, which is expected to improve the effect of tumor treatment and has good biocompatibility, which has the potential for clinical application.
Owner:SUN YAT SEN UNIV
Heterterpene compounds derived from marine fungi and their application in the preparation of anti-inflammatory drugs
ActiveCN113121557BInhibitionPotential for clinical applicationFungiOrganic chemistryBiotechnologyInflammatory factors
The invention discloses a heteroterpene compound derived from a marine fungus and its application in the preparation of anti-inflammatory drugs. The present invention separates the heteroterpenoids from the fermentation product of a marine fungus, Aspergillus terreus GZU-31-1, and its structural formulas are shown in formulas 1-5. These new compounds can significantly inhibit the production of inflammatory factor NO induced by LPS, and the ICs of compounds 1-5 50 They are: 6.74±0.77μmol / L, 22.18±0.94μmol / L, 25.87±3.1μmol / L, 26.47±0.98μmol / L, 29.59±3.9μmol / L, which have clinical application potential for treating and anti-inflammation and can be used for development A new type of anti-inflammatory drug with good application prospect.
Owner:GUANGZHOU UNIVERSITY OF CHINESE MEDICINE
Targeted-MMSA-1-chimeric-antigen-receptor-modified T lymphocyte as well as preparation method and application thereof
ActiveCN110885790AGood anti-tumor effectSmall side effectsImmunoglobulins against cell receptors/antigens/surface-determinantsBlood/immune system cellsMultiple myelomaMolecular biology
The invention provides a targeted-MMSA-1-chimeric-antigen-receptor-modified T lymphocyte as well as a preparation method and application thereof. A specific CAR-T cell line targeting MMSA-1 is constructed, the anti-myeloma activity of the specific CAR-T cell line is verified in vitro and vivo, and a new target is found for CAR-T immunotherapy of multiple myeloma. A specific MMSA-1 single-chain antibody (single-chain antibody fragment, scFv) is obtained by modifying a wild type MMSA-1 antibody in a humanized manner, the obtained MMSA-1 antibody gene fragment is modified and plasmid is loaded into the MMSA-1 antibody gene fragment, and an MMSA-1 chimeric receptor T cell is prepared by lentiviral transfection; and the expression of the CAR on the surface of the T cell is detected and a successfully transfected CAR-T cell is augmented in vitro, and then tests are carried out in vitro and vivo to detect an anti-myeloma effect of the CAR-T cell.
Owner:WUHAN UNIV
Who we serve
- R&D Engineer
- R&D Manager
- IP Professional
Why Patsnap Eureka
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com