Optimized and improved escherichia coli phytase APPA-M with enhanced catalytic activity in acidic range, and gene and application of optimized and improved escherichia coli phytase APPA-M

A technology of Escherichia coli and phytase, applied in the field of genetic engineering, can solve the problems of waste of phosphorus source, environment, increase of feed cost, etc., and achieve the effect of huge application potential and activity improvement.

Active Publication Date: 2013-06-26
WUHAN SUNHY BIOLOGICAL
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This not only greatly increases the cost of feed, but also a large amount of phytate phosphorus cannot be utilized and is directly excreted, resulting in waste of phosphorus sources and serious environmental problems.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optimized and improved escherichia coli phytase APPA-M with enhanced catalytic activity in acidic range, and gene and application of optimized and improved escherichia coli phytase APPA-M
  • Optimized and improved escherichia coli phytase APPA-M with enhanced catalytic activity in acidic range, and gene and application of optimized and improved escherichia coli phytase APPA-M
  • Optimized and improved escherichia coli phytase APPA-M with enhanced catalytic activity in acidic range, and gene and application of optimized and improved escherichia coli phytase APPA-M

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, the synthesis of Escherichia coli phytase gene appa

[0050] The N-terminal signal peptide sequence was removed from the phytase gene appa (Dassa, 1990) of the Escherichia coli strain, and the amino acid sequence was not changed according to the codon preference of Pichia pastoris (Zhao Xiang, 2000). sequence modification. Avoid sites in the form of GT...AG during transformation, and try to avoid the appearance of AT-rich (e.g. ATTTA, AATAA, AATTAA, etc.) sequences, which are related to the stability of mRNA. Send the modified and designed gene sequence to Nanjing Jinruisi Company for whole gene synthesis.

Embodiment 2

[0051] Embodiment 2, construction of recombinant expression vector pET-22b(+)-appa-m

[0052] According to the sequence design of the synthetic gene, the 5' end of the PCR primer contains the Nco I endonuclease site, and the 3' end contains the EcoR I endonuclease site. The primer sequences are as follows:

[0053] 5' end primer pET-appa-F: GCAC CCATGG GACAGAGTGAGCCTGAGTTGAAACTG

[0054] 3' end primer pET-appa-R: GCAC GAATTC TTACAAGGAACAAGCTGGGATTCTAG

[0055] Using the synthetic gene as a template, PCR amplification was carried out with the above primers, and the amplified fragment was cloned into the vector pET-22b(+) to obtain the recombinant vector pET-22b(+)-appa-m.

Embodiment 3

[0056] Embodiment 3, gene site-directed saturation mutation

[0057] (1) Determination of the key amino acids in the active site

[0058] From the protein three-dimensional structure database (http: / / www.rcsb.org / pdb / home / home.do), download the three-dimensional structure file of Escherichia coli phytase APPA, and its number in the PDB database is 1DKQ. The PDB structure is an enzyme-substrate complex and contains the substrate IP6 in its structure. Using PDBViewer to analyze the structure, APPA has a total of 410 amino acid residues, and its 15-23 amino acid residues are the conserved sequence shared by acid phytase: RAGVRAPT. The protein has two structural domains: the 134 amino acid residues at the N-terminal and the 152 amino acid residues at the C-terminal form the alpha domain, and the remaining 124 amino acid residues in the middle form the alpha-beta domain. The conserved sequence and the active center are located in two between domains. Through analysis, 22 key ami...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering, in particular to an optimized and improved escherichia coli phytase APPA-M with enhanced catalytic activity in acidic range, and gene and application of the optimized and improved escherichia coli phytase APPA-M. For improving the catalytic capability and the specific activity of the escherichia coli phytase APPA in acidic range, 22 key amino acids in active center of the escherichia coli phytase APPA are subjected to saturation mutagenesis by utilizing gene engineering means. When mutational sites are M216C and N306D, the catalytic activity of the optimized and improved escherichia coli phytase APPA-M in acidic range of pH2-5 is greatly improved, and a huge application potential can be showed in application.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to an optimized and improved Escherichia coli phytase APPA-M with improved catalytic activity in the acidic range, its gene and application. Background technique [0002] Phytic acid (Phytate, Phytic acid, IP6), also known as phytic acid, contains 6 phosphate groups and is rich in phosphorus. It is an important storage form of phosphorus in feed. Phosphorus is an essential mineral element for animals. Monogastric animals lack phytase (Phytase, an enzyme that catalyzes the hydrolysis of phytic acid and phytate) in monogastric animals, resulting in only 1 / 3 or less of the utilization rate of phosphorus in feed. , In order to supplement the deficiency of available phosphorus, inorganic phosphate must be added to the feed, commonly used as calcium hydrogen phosphate and bone meal. This not only greatly increases the cost of feed, but also a large amount of phytate phosphorus cannot b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/16C12N15/55C12N15/63C12N15/81C12N1/21C12N1/19C12R1/19C12R1/84
Inventor詹志春张菁付大伟
OwnerWUHAN SUNHY BIOLOGICAL