Use of DNA tetrahedron in preparing medicine for treating and preventing periodontitis

Abstract

The present invention discloses the use of DNA tetrahedron in preparing drugs for treating and preventing periodontitis, and belongs to the field of nucleic acid drugs. The present invention uses it to treat periodontitis, and its effect is excellent, and its efficacy is significantly better than that of antibiotics commonly used to treat periodontitis. The present invention provides a real therapeutic drug for clinical treatment of periodontitis, provides a new direction for the treatment of periodontitis, and has good application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of nucleic acid drugs. Background Art

[0002] Periodontitis is a common inflammatory destructive disease caused by bacterial plaque. If left untreated, there will be risks such as gingival bleeding, alveolar bone resorption, loose and falling teeth, which will greatly affect people's quality of life. In addition, it can also release a large number of inflammatory factors into the blood circulation locally or cause odontogenic bacteremia, inducing or aggravating a variety of systemic chronic inflammatory diseases, such as diabetes, cardiovascular disease, chronic kidney disease, and stroke. Related studies have reported that the treatment and control of periodontal inflammation can greatly reduce the risk of loose and falling teeth and effectively improve the treatment effect and prognosis of the above-mentioned systemic diseases. Therefore, the prevention and treatment of periodontitis has great application value.

[0003] At present, the most effective way to treat periodontitis is basic treatment, that is, to remove dental plaque through basic treatments such as cleaning and scaling. For acute inflammation, it will be treated with antibiotics such as amoxicillin, clindamycin, doxycycline, metronidazole, spiramycin, minocycline, etc. For more serious cases, when basic treatment cannot effectively treat it, it can be treated with surgical treatments such as flap surgery and bone grafting.

[0004] However, the above basic treatment and surgical treatment can only be performed by dentists, but many people do not have the conditions to see a dentist, resulting in the incurable periodontitis. Medication is a treatment method that is convenient for patients to take without relying on doctors, but there are currently no reports on drugs that can cure periodontitis. The only drugs currently used for periodontitis are antibiotics, but antibiotics can only relieve acute inflammation, cannot protect the alveolar bone and periodontal tissue, and cannot cure periodontitis.

[0005] If a drug can be provided to treat periodontitis without the need for basic treatment or surgery, the aforementioned problems can be overcome, which has a very positive significance.

[0006] DNA tetrahedrons (TDNs), also known as tetrahedral framework nucleic acids (tFNAs), are a tetrahedral nucleic acid structure formed by base pairing of single-stranded DNA (usually 4 strands). Compared with double-stranded DNA, their structure in vivo is more stable and is often used as a carrier for certain nucleic acid drugs and a component of molecular detection probes. There are currently no reports on the use of DNA tetrahedrons in the treatment of periodontitis. Summary of the invention

[0007] The problem to be solved by the present invention is to provide the use of DNA tetrahedron in preparing medicine for treating periodontitis.

[0008] The technical solution of the present invention is as follows:

[0009] Use of DNA tetrahedron in preparing medicine for treating and preventing periodontitis.

[0010] The drugs for treating and preventing periodontitis described in the present application can be used alone for treating or preventing periodontitis.

[0011] Furthermore, the DNA tetrahedron is prepared by base complementary pairing of single-stranded DNAs with sequences such as SEQ ID NOs. 1 to 4.

[0012] Furthermore, the DNA tetrahedron is prepared by denaturing the four DNA single strands at 95° C. for 10 min and maintaining at 4° C. for more than 20 min.

[0013] Furthermore, the drug is a drug for protecting periodontal tissue and / or protecting alveolar bone.

[0014] Furthermore, the medicine is an injectable preparation.

[0015] A medicine for treating and preventing periodontitis is prepared by taking DNA tetrahedron as an active ingredient and adding pharmaceutically acceptable auxiliary ingredients.

[0016] Furthermore, the DNA tetrahedron is prepared by base complementary pairing of single-stranded DNAs with sequences such as SEQ ID NOs. 1 to 4.

[0017] Furthermore, the DNA tetrahedron is prepared by denaturing the four DNA single strands at 95° C. for 10 min and maintaining at 4° C. for more than 20 min.

[0018] Furthermore, the drug is a drug for protecting periodontal tissue and / or protecting alveolar bone.

[0019] Furthermore, the medicine is an injectable preparation.

[0020] Beneficial effects:

[0021] The DNA tetrahedron of the present invention can effectively inhibit the destruction of periodontal tissue when used alone, has a significant protective effect on alveolar bone, and can also reduce inflammatory reactions and treat periodontitis. Therefore, the DNA tetrahedron of the present invention can be used as a drug to treat and prevent periodontitis, overcoming the problem that drugs cannot be used to cure periodontitis in the prior art, and providing a new option for treating periodontitis. Compared with the existing treatment methods, this treatment method is simpler and easier to operate, has good patient compliance, is widely popularized, and has excellent clinical application prospects.

[0022] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0023] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 . Synthesis and characterization of tFNAs. (a) A structural diagram showing the composition of tFNAs. (b) Transmission electron microscopy image showing the morphology and average size of tFNAs. The scale bar is 50 nm. (c) 8% acrylamide gel electrophoresis results indicate the successful preparation of tFNAs. (d) Capillary electrophoresis results indicate the successful preparation of tFNAs. (e) Particle size distribution and Zeta potential test of tFNAs. (f) Immunofluorescence staining to observe the cell uptake of Cy5tfnas. (Cell nucleus: blue, cytoskeleton: green, Cy5: red). The scale bar is 25 μm.

[0025] Figure 2 . tFNAs can significantly reduce the inflammatory response in periodontitis. (a) Schematic diagram of the rat periodontitis experiment. (b) H&E staining images at 5x and 20x magnification. The yellow arrows show inflammatory cells. (c) Immunohistochemistry results of IL-1β at 5x and 20x magnification. IL-1 is shown by the red arrow. (d) Immunohistochemistry images of IL-6 at 5x and 20x magnification. Interleukin-6 is shown by the red arrow. (e) Statistical analysis of the expression of IL-1β and IL-6 in periodontal tissues. **P<0.01, ***P<0.001, compared with the blank group. ###P<0.001 compared with the control group. &P<0.5 compared with the tFNAs (250nM) group. Root / mesial root=distal root. MR / DR=mesial root / distal root; AB=alveolar ridge.

[0026] Figure 3 . tFNAs can significantly inhibit the destruction of periodontal tissues by periodontitis. (a) Schematic diagram of rat periodontitis experiment. (b) Masson staining images at 5x and 20x magnification. (c) H&E staining images at 5x and 20x magnification. The area surrounded by the yellow solid line is cementum, and the aera surrounded by the yellow dotted line is the cementum absorbed by inflammation. (d) TRAP staining photos at 5x and 20x magnification. The red arrow indicates osteoclasts. MR / DR = mesial root / distal root; AB = alveolar ridge; D = dentin; C = cementum; PDL = periodontal ligament.

[0027] Figure 4 . tFNAs have a significant protective effect on alveolar bone. (a) Schematic diagram of rat periodontitis experiment. (b) Micro-CT three-dimensional reconstruction image of left maxillary alveolar bone. The red part shows the root exposure. (c) Statistical analysis of alveolar bone resorption in the mesial, middle and distal parts of the second molar (n=5). *Compared with the blank group, P<0.5, **P<0.01, ***P<0.001. #Compared with the control group, P<0.5, P<0.01, P<0.001. &Compared with the tFNAs (250nM) group, P<0.5. (d) Statistical analysis of micro-CT results of BV / TV, Tb.N, BV / TV, Mycobacterium tuberculosis and Tb.Th (n=5). *Compared with the blank group, P<0.5, **P<0.01. #Compared with the control group, P<0.5, P<0.01, P<0.001. &&Compared with tFNAs (250 nM) group, P < 0.5. The area marked with yellow lines is the area of ​​interest. DETAILED DESCRIPTION

[0028] Example 1 Synthesis and identification of DNA tetrahedron

[0029] 1. Synthesis method

[0030] Dissolve four single-stranded DNAs (ssDNA) S1, S2, S3, and S4 in TM Buffer (10mM Tris-HCl, 50mMMgCl2, pH=8.0) to a final concentration of 1000nM. Mix thoroughly and quickly heat to 95°C for 10 minutes, then quickly cool to 4°C and keep for more than 20 minutes to self-assemble into DNA tetrahedrons. The principle is as follows: Figure 1 As shown in a.

[0031] The sequences of the four single strands (5′→3′) are as follows:

[0032] S1:

[0033] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA(SEQID NO.1)

[0034] S2:

[0035] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG(SEQID NO.2)

[0036] S3:

[0037] ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC(SEQID NO.3)

[0038] S4:

[0039] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG(SEQID NO.4)

[0040] 2. Identification

[0041] Transmission electron microscopy ( Figure 1 b) shows the formation of triangular granular structures; from the PAGE gel results ( Figure 1 c) and capillary electrophoresis ( Figure 1 d) The DNA tetrahedron band is clear and about 180 bp in size, which is larger than the single-stranded DNA that makes it up. The particle size distribution and Zeta potential test of tFNAs show that the particle size distribution is uniform, which is 20.99±5.92nm, and the Zeta potential is -6.79±3.64mV ( Figure 1 e); Cy5-labeled tFNA can be taken up by cells after being treated with cells, emitting red fluorescence ( Figure 1 f). The above results indicate that DNA tetrahedron was successfully synthesized.

[0042] The present invention will be further described below in the form of experimental examples. The tFNAs used in the experimental examples are prepared by the method of Example 1.

[0043] Experimental Example 1 The therapeutic effect of DNA tetrahedron on periodontitis

[0044] 1. Methods

[0045] The periodontitis animal model was established by wrapping the maxillary second molars of SD male rats aged 8-10 weeks with 3-0 silk thread.

[0046] After tying the wires on the day of modeling, the experimental group was injected with 20 microliters of DNA tetrahedron at a concentration of 250nM and 500nM into the palatal mucosa of the maxillary second molar of the rats, and the control group was injected with an equal amount of saline. Both groups were injected once a day, and the corresponding rats were killed 21 days after the injection of the drug, and maxillary tissue samples were collected for testing:

[0047] (1) The collected maxillary bone tissue was fixed and then subjected to micro-CT scanning to analyze the changes in alveolar bone resorption.

[0048] (2) The collected maxillary tissues were fixed, dehydrated, embedded, and sectioned, and then subjected to H&E staining, TRAP staining, and immunohistochemical staining of IL-6 and IL-1β proteins.

[0049] The blank group was not treated with wire binding or injection.

[0050] 2. Results

[0051] 2.1 Inflammatory response

[0052] The detection diagram is as follows Figure 2 As shown in a.

[0053] The results of H&E staining showed that the number of inflammatory cells in the experimental group was significantly reduced compared with that in the control group, even reaching a level close to that of the blank group ( Figure 2 b). The expression levels of interleukin 1 (IL-1) and interleukin 6 (IL-6) in the experimental group were significantly lower than those in the control group, and even lower than those in the blank group ( Figure 2 c, d, e).

[0054] These results suggest that tFNAs can significantly reduce the inflammatory response in periodontitis.

[0055] 2.2 Periodontal tissue observation

[0056] Schematic diagram of periodontal tissue observation Figure 3 As shown in a.

[0057] Masson staining showed that the density of periodontal collagen fibers in the control group was reduced (lighter blue), while the density of collagen fibers in the experimental group was higher than that in the control group and was concentration-dependent ( Figure 3 b) H&E staining results showed that cementum resorption occurred in the control group, while no obvious bone resorption occurred in the experimental group ( Figure 3 c). TRAP staining shows the number of osteoclasts. The number of osteoclasts in the control group was larger, while the number of osteoclasts in the experimental group was significantly smaller ( Figure 3 d).

[0058] These results suggest that tFNAs can protect periodontal tissues from inflammatory destruction.

[0059] 2.3 Micro-CT detection of alveolar bone

[0060] Schematic diagram of micro-CT detection of alveolar bone Figure 4 As shown in a.

[0061] From the micro-CT three-dimensional reconstruction, it can be seen that the control group had many small holes in the alveolar bone, severe bone absorption, and obvious root exposure; while the experimental group had no obvious alveolar bone absorption and was intact. The root exposure of the group injected with tFNAs 500nM was comparable to that of the blank group ( Figure 4 b). The statistical analysis results of the alveolar bone resorption in the mesial, medial and distal parts of the second molar showed that the alveolar bone resorption in the experimental group was significantly lower than that in the control group ( Figure 4 c).

[0062] From the bone quality analysis, it can be seen that the BV / TV (relative bone volume or bone volume fraction) of the experimental group was significantly higher than that of the control group, and the tFNAs 500nM group was even better than the blank group; the Tb.Sp (trabecular separation, which refers to the average width of the medullary cavity between trabeculae, equivalent to the porosity of porous materials) of the experimental group was lower than that of the control group, and even lower than that of the blank group; the Tb.Th (trabecular thickness, equivalent to the pore wall thickness of porous materials) of the experimental group was higher than that of the control group; the Tb.N (trabecular number) of each group was slightly different, but the experimental group was still slightly higher than the control group ( Figure 4 d).

[0063] The above results indicate that tFNAs can significantly inhibit bone resorption caused by periodontitis and improve bone quality and mass.

[0064] In summary, tFNAs have the effects of reducing inflammation, protecting periodontal tissues and improving alveolar bone mass. Using them to prepare drugs for the treatment of periodontitis can overcome the defects of antibiotics that can only fight inflammation but not cure it, and has good application value. SEQUENCE LISTING <110> Sichuan University <120> Use of DNA tetrahedron in preparing medicine for treating and preventing periodontitis <130> GYKH1118-2020P0111850CC <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 63 <212> DNA <213> Artificial sequence <400> 1 atttatcacc cgccatagta gacgtatcac caggcagttg agacgaacat tcctaagtct 60 63 <210> 2 <211> 63 <212> DNA <213> Artificial sequence <400> 2 acatgcgagg gtccaatacc gacgattaca gcttgctaca cgattcagac ttaggaatgt 60 tcg 63 <210> 3 <211> 63 <212> DNA <213> Artificial sequence <400> 3 actactatgg cgggtgataa aacgtgtagc aagctgtaat cgacgggaag agcatgccca 60 tcc 63 <210> 4 <211> 63 <212> DNA <213> Artificial sequence <400> 4 acggtattgg accctcgcat gactcaactg cctggtgata cgaggatggg catgctcttc 60 ccg 63

Claims

1. Use of DNA tetrahedron in preparing a drug for treating and preventing periodontitis; the drug is a drug for inhibiting bone resorption caused by periodontitis; the DNA tetrahedron is prepared by base complementary pairing of single-stranded DNA sequences such as SEQ ID NO.1 to 4; the drug is an injectable preparation.

2. The use according to claim 1, characterized in that: The DNA tetrahedron is prepared by denaturing the four DNA single strands at 95° C. for 10 minutes and maintaining at 4° C. for more than 20 minutes.

Images