Method for synthesizing rare ginsenoside Rh1 by heat-resistant UDP-glycosyl transferase

Abstract

The invention discloses a UDP-glycosyl transferase mutant, and belongs to the technical field of enzyme engineering and microbial engineering. Isoleucine at the 83th site and / or phenylalanine at the 285th site of UDP-glycosyltransferase with the amino acid sequence shown as SEQ ID NO: 1 is mutated, parallel mutant screening is performed, a mutant I83A / F285M with the highest yield of generated ginsenoside Rh1 is obtained, the yield is 92% and is increased by 5.1 times compared with WT, and the mutant has a great application prospect in industrial production of ginsenoside Rh1.

Description

Technical Field

[0001] The invention relates to a method for synthesizing rare ginsenoside Rh1 by using a heat-resistant UDP-glycosyltransferase, and belongs to the technical fields of enzyme engineering and bioengineering. Background Art

[0002] Ginseng is a perennial herb with a long lifespan. As a traditional Chinese medicine, ginseng has high medicinal value. Its main active ingredient is ginsenosides. Ginsenoside Rh1 (G-Rh1) is a rare ginsenoside that has neuroprotective effects, potential anti-inflammatory properties, and the ability to serve as an adjunct to dexamethasone in chronic inflammatory diseases.

[0003] Currently, the synthesis of ginsenoside Rh1 is primarily derived from plants. However, the content of rare ginsenosides in ginseng is very low, and the yield obtained through plant extraction is low and the cost is high. Previous reports have found that monosaccharide-based ginsenosides are more easily absorbed than polysaccharide-based ginsenosides (reference: Pan W, Xue B, Yang C, et al. Biopharmaceutical characteristics and bioavailability improving strategies of ginsenosides. Fitoterapia. 2018; 129:272-282. doi:10.1016 / j.fitote.2018.06.001). Glycosyltransferases can obtain monosaccharide products by adding glycosides to protoginsenosides, and the bioenzymatic method provides a new idea for solving the problem of low yield of rare ginsenosides. In 2015, Wei et al. found that UGTpg100 catalyzed PPT to produce Rh1 at 92.8 mg / L in ginseng (reference: Wei W, Wang P, Wei Y, et al. Characterization of Panax ginseng UDP-Glycosyltransferases Catalyzing Protopanaxatriol and Biosyntheses of Bioactive Ginsenosides F1 and Rh1 in Metabolically Engineered Yeasts. Mol Plant. 2015; 8(9): 1412-1424. doi: 10.1016 / j.molp.2015.05.010). In 2024, Chu et al. used structure-guided enzyme design to modify the enzyme and obtained a Rh1 conversion rate of 95.57% (reference: Chu J, Zhao L, Xu X, et al. Evolving the 3-O / 6-O regiospecificity of a microbialglycosyltransferase for efficient production of ginsenoside Rh1 and unnatural ginsenoside. Int J Biol Macromol. 2024; 261(Pt 1): 129678. doi: 10.1016 / j.ijbiomac.2024.129678).However, ginsenosides have the problem of low solubility, but the solubility of ginsenosides will increase at high temperatures (reference: Zhang S, Luo J, Xie J, Wang Z, Xiao W, Zhao L. Cooperated biotransformation of ginsenoside extracts into ginsenoside 20(S)-Rg3 by threethermostable glycosidases. J Appl Microbiol. 2020; 128(3): 721-734. doi: 10.1111 / jam.14513), and the ancestral enzyme has the characteristics of high temperature resistance and good thermal stability. Therefore, by mining the ancestral enzyme, a glycosyltransferase that can react at high temperature was obtained to catalyze the synthesis of ginsenoside Rh1. However, the activity of the ancestral enzyme in catalyzing the synthesis of ginsenoside Rh1 is very low. In order to improve the catalytic ability of the enzyme by modifying the glycosyltransferase, the yield of ginsenoside Rh1 can be further increased. Summary of the Invention

[0004] In response to the above-mentioned deficiencies in the prior art, the present invention provides a method for synthesizing the rare ginsenoside Rh1 using a heat-resistant UDP-glycosyltransferase. The purpose is to solve the technical problem that the catalytic ability of the heat-resistant glycosyltransferase in the existing bio-enzymatic method for synthesizing ginsenoside Rh1 needs to be further improved, which imposes certain limitations on increasing the yield of ginsenoside Rh1.

[0005] The first technical solution provided by the present invention is a UDP-glycosyltransferase mutant, wherein the mutant is a UDP-glycosyltransferase parent with a mutation of isoleucine at position 83 and / or phenylalanine at position 285, and the amino acid sequence of the parent is shown in SEQ ID NO: 1.

[0006] In certain embodiments, the mutant undergoes any of the following mutations on the parent:

[0007] (1) Isoleucine I at position 83 is mutated to alanine A, aspartic acid D, or histidine H;

[0008] (2) phenylalanine F at position 285 is mutated to glutamine Q, leucine L, methionine M, isoleucine I, or valine V;

[0009] (3) The phenylalanine F at position 285 is mutated to methionine M and the isoleucine I at position 83 is mutated to alanine A, glutamine Q, aspartic acid D or histidine H.

[0010] The above mutants were obtained by combining semi-rational design, and the 83rd isoleucine and the 285th phenylalanine in the amino acid sequence of glycosyltransferase were mutated to alanine and methionine respectively.

[0011] The second technical solution provided by the present invention is a gene encoding the UDP-glycosyltransferase mutant described in the first technical solution.

[0012] The third technical solution provided by the present invention is a recombinant plasmid carrying the gene described in the second technical solution.

[0013] In certain embodiments, the vector of the recombinant plasmid is pET-28a(+) plasmid.

[0014] The fourth technical solution provided by the present invention is a microbial cell expressing the mutant described in the first technical solution, or carrying the gene described in the second technical solution, or transformed with the recombinant plasmid described in the third technical solution.

[0015] In certain embodiments, among the microbial cells, the host cell is Escherichia coli.

[0016] The fifth technical solution provided by the present invention is a method for improving the yield of ginsenoside Rh1 synthesized by UDP-glycosyltransferase, wherein the method comprises performing any of the following mutations on the UDP glycosyltransferase parent as shown in SEQ ID NO: 1:

[0017] (1) Isoleucine I at position 83 is mutated to alanine A, aspartic acid D, or histidine H;

[0018] (2) phenylalanine F at position 285 is mutated to glutamine Q, leucine L, methionine M, isoleucine I, or valine V;

[0019] (3) The phenylalanine F at position 285 is mutated to methionine M and the isoleucine I at position 83 is mutated to alanine A, glutamine Q, aspartic acid D or histidine H.

[0020] The sixth technical solution provided by the present invention is a method for efficiently synthesizing ginsenoside Rh1, which comprises adding the mutant described in the first technical solution to a reaction system containing ginsenoside PPT for reaction.

[0021] In certain embodiments, in the reaction system, the concentration of panaxatriol saponins is 0.5-2 mmol / L; alternatively, the concentration of panaxatriol saponins is 1 mmol / L.

[0022] In certain embodiments, the reaction system further contains UDPG.

[0023] In certain embodiments, in the reaction system, the concentration of UDPG is 2.5-10 mmol / L; optionally, the concentration of UDPG is 5 mmol / L.

[0024] In certain embodiments, the added amount of the UDP-glycosyltransferase mutant is 4 mg / mL.

[0025] The present invention also provides a method for preparing the above-mentioned UDP-glycosyltransferase mutant, which comprises inoculating host cells expressing the mutant described in the first technical solution into a fermentation medium for fermentation to obtain a fermentation broth; centrifuging the fermentation broth to collect bacterial cells; and crushing the bacterial cells and centrifuging to obtain a supernatant after cell crushing, which is a crude enzyme solution containing the UDP-glycosyltransferase mutant.

[0026] In certain embodiments, the reaction temperature is 40-70°C and the pH is 6-8; preferably, the reaction temperature is 60°C and the pH is 7.5.

[0027] The seventh technical solution provided by the present invention is the use of the UDP-glycosyltransferase mutant described in the first technical solution, or the gene described in the second technical solution, or the recombinant plasmid described in the third technical solution, or the microbial cell described in the fourth technical solution, or the method described in the fifth technical solution, or the method described in the sixth technical solution in the production of a product containing ginsenoside Rh1.

[0028] The technical effects of the present invention are as follows:

[0029] The optimal mutant, I83A / F285M, among the UDP-glycosyltransferase mutants described herein increased the substrate yield of UGT227-WT by 5.13-fold, increasing the yield from 15% to 92% per mmol / L. This UDP-glycosyltransferase mutant significantly increased the synthesis yield of ginsenoside Rh1 and holds great promise for its application in the industrial production of Rh1. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 : SDS-PAGE electrophoresis analysis results of the expression products obtained by shake flask fermentation of recombinant Escherichia coli;

[0031] Figure 2 : Chromatogram of ginsenoside Rh1 produced by UDP-glycosyltransferase. DETAILED DESCRIPTION

[0032] The following describes preferred embodiments of the present invention. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0033] Test method:

[0034] HPLC analysis conditions: chromatographic column Diamonsil C 18 (250 mm × 4.6 mm, 5 μm), mobile phases were water (A) and acetonitrile (B), gradient elution (0-20 min, 55% B; 20-30 min, 70% B; 30-31 min, 100% B; 31-40 min, 100% B; 40-41 min, 10% B; 41-50 min, 10% B) at a flow rate of 1 mL / min, detection wavelength of 199 nm, column temperature of 35°C;

[0035] The formula for calculating yield is:

[0036] Wherein: Mp represents the molar concentration of the substance generating the network plug (mmol / L); Ms represents the molar concentration of the remaining substrate cinnamyl alcohol (mmol / L).

[0037] Materials used in the examples:

[0038] The Escherichia coli BL21 (DE3) involved in the following examples was purchased from Sangon Biotech (Shanghai) Co., Ltd., and the pET-28a (+) plasmid was purchased from Sangon Biotech (Shanghai) Co., Ltd.; the 20 (S) ginsenoside involved in the following examples was purchased from Nanjing Chunqiu Biotech Co., Ltd., and UDPG was purchased from Hefei Bomei Biotechnology Co., Ltd.

[0039] LB liquid medium: yeast powder 5.0 g / L, tryptone 10.0 g / L, NaCl 10.0 g / L, kanamycin 0.2 mmol / L.

[0040] LB solid medium: yeast powder 5.0 g / L, tryptone 10.0 g / L, NaCl 10.0 g / L, agar powder 20 g / L, kanamycin 0.2 mmol / L.

[0041] Example 1 Preparation, expression and purification of UDP-glycosyltransferase mutants

[0042] The specific steps are as follows:

[0043] (1) Construction of wild-type UDP-glycosyltransferase plasmid and recombinant bacteria:

[0044] A gene encoding a wild-type UDP-glycosyltransferase having an amino acid sequence as shown in SEQ ID NO: 1 (the nucleic acid sequence is shown in SEQ ID NO: 2) was chemically synthesized; the obtained gene was digested in pET-28a(+) with BamH IHE Xho I enzymes, followed by ligation. The ligation products were transformed into Escherichia coli BL21(DE3). The transformation product was spread on a Kan-resistant LB solid medium and cultured at 37° C. for 10 to 12 hours. Five transformants were picked from the LB solid medium and inoculated into LB liquid medium for culture. After culturing at 37° C. for 12 hours, the plasmids were extracted. The extracted plasmids were verified by enzyme digestion and sequencing. If the verification was correct, a recombinant plasmid pET28a-EcUGT227 containing the gene encoding the wild-type UDP-glycosyltransferase and a recombinant bacterium E. coli BL21 / pET28a-EcUGT227 containing the gene encoding the wild-type UDP-glycosyltransferase were obtained.

[0045] (2) Screening of UDP-glycosyltransferase mutants

[0046] The whole plasmid PCR technique was used to perform site-directed mutagenesis using the obtained recombinant plasmid pET28a-EcUGT227 as a template to obtain the UDP-glycosyltransferase mutants S10A (serine at position 10 mutated to alanine), A12G (alanine at position 12 mutated to glycine), I13A (isoleucine at position 13 mutated to alanine), H15A (histidine at position 15 mutated to alanine), L42A (leucine at position 42 mutated to alanine), F44A (phenylalanine at position 44 mutated to alanine), and 113A (isoleucine at position 13 mutated to alanine). to alanine), A47K (alanine at position 47 mutated to lysine), P80A (proline at position 80 mutated to alanine), I83A (isoleucine at position 83 mutated to alanine), I83F (isoleucine at position 83 mutated to phenylalanine), L84A (phenylalanine at position 84 mutated to alanine), F120A (phenylalanine at position 120 mutated to alanine), P140T (proline at position 140 mutated to threonine), M201A (methionine at position 201 mutated to methionine), and to alanine), R210L (arginine at position 210 mutated to alanine), S284A (serine at position 284 mutated to alanine), F285A (phenylalanine at position 285 mutated to alanine), F285M (phenylalanine at position 285 mutated to methionine), M320A (methionine at position 320 mutated to alanine), H368A (histidine at position 368 mutated to alanine), W371A (tryptophan at position 371 mutated to alanine), N372A (tryptophan at position 372 mutated to alanine), and N373A (phenylalanine at position 374 mutated to alanine). 2 asparagine mutated to alanine), Y390A (tyrosine mutated to alanine at position 390), A391G (alanine mutated to glycine at position 391), E392A (glutamic acid mutated to alanine at position 392), Q393A (glutamine mutated to alanine at position 393), E399M (glutamic acid mutated to methionine at position 399), F418A (phenylalanine mutated to alanine at position 418), and E423F (glutamic acid mutated to phenylalanine at position 423).

[0047] The primers used for mutant S10A are as follows:

[0048] S10A-F:TTGGTATTTATCCCGGCACCGGCG

[0049] S10A-R:GTGTCCAATCGCCGGTGCCGGGAT

[0050] The primers used for mutant A12G are as follows:

[0051] A12G-F:TTTATCCCGTCCCCGGGCATTGGA

[0052] A12G-R:CACCAAGTGTCCAATGCCCGGGGA

[0053] The primers used for mutant I13A are as follows:

[0054] I13A-F:AAGCCCGCCTTCAGCGGCACTGTCA

[0055] I13A-R:AATTAAATCTGACAGTGCCGCTGA

[0056] The primers used for mutant H15A are as follows:

[0057] H15A-F:TCCCCGGCGATTGGAGCATTGGTG

[0058] H15A-R:GACCATTGACACCAATGCTCCAAT

[0059] The primers used for mutant L42A are as follows:

[0060] L42A-F:GTGTTAATCATATTAAAGCACCCTTC

[0061] L42A-R:TGCCGAATCGAAGGGTGCTTTAAT

[0062] The primers used for mutant F44A are as follows:

[0063] F44A-F:ATCATTAAACTGCCCGCAGATTCG

[0064] F44A-R:ATCCACTGCCGAATCTGCGGGCAG

[0065] The primers used for mutant P80A are as follows:

[0066] P80A-F:TCGAGCACCAAGCCGGCATCAGCG P80A-R:TGACAGAATCGCTGATGCCGGCTT The primers used for mutant S81A are as follows:

[0067] S81A-F:AGCACCAAGCCGCCTGCAGCGATT S81A-R:ATCTGACAGAATCGCTGCAGGCGG The primers used for mutant I83A are as follows:

[0068] I83A-F: AAGCCGCCTTCAGCGGCACTGTCA I83A-R: AATTAATCTGACAGTGCCGCTGA The primers used for mutant L84A are as follows:

[0069] The primers used for the mutant F120A are as follows: L84A-F: CCGCCTTCAGCGATTGCATCAGAT L84A-R: CTCAATTAAATCTGATGCAATCGC

[0070] F120A-F:TTTGTTGTCGACATGGCATGTACC F120A-R:AATCATGCTGGTACATGCCATGTC The primers used for mutant M201A are as follows:

[0071] M201A-F:GAAGGGGGGTCTGACGCACTGCTG M201A-R:AGCTGAGGACAGCAGTGCGTCAGA The primers used for mutant S284A are as follows:

[0072] S284A-F:TTCCTGTGCTTCGGGGCATTTGGT S284A-R:ATCAAATGAACCAAATGCCCCGAA The primers used for the mutant F285A are as follows:

[0073] F285A-F:CTGTGCTTCGGGAGTGCAGGTTCA F285A-R:CTCATCAAATGAACCTGCACTCCC The primers used for the mutant M320A are as follows:

[0074] M320A-F:CCTCCAAAAGGAAAAGCAGAGTTC M320A-R:ATCACTGGGGAACTCTGCTTTTCC The primers used for mutant H368A are as follows:

[0075] H368A-F: GGTGGTTTCGTGTCAGCATGTGGC H368A-R: GGAGTTCCAGCCACATGCTGACAC The primers used for mutant W371A are as follows:

[0076] W371A-F:GTGTCACATTGTGGCGCAAACTCC W371A-R:CTCAAGTGTGGAGTTTGCGCCACA The primers used for the mutant N372A are as follows:

[0077] N372A-F:TCACATTGTGGCTGGGCATCCACA N372A-R:CGACTCAAGTGTGGATGCCCAGCC The primers used for mutant Y390A are as follows:

[0078] Y390A-F: GCTACATGGCCCATGGCAGCTGAG Y390A-R: CATTGCTGCTCAGCTGCCATGGG The primers used for the mutant A391G are as follows:

[0079] A391G-F: ACATGGCCCATGTATGGCGAGCAG A391G-R: ATTCATTTGCTGCTCGCCATACAT The primers used for the mutant E392A are as follows:

[0080] E392A-F:TGGCCCATGTATGCTGCACAGCAA E392A-R:AGCATTCATTTGCTGTGCAGCATA The primers used for the mutant Q393A are as follows:

[0081] Q393A-F: CCCATGTATGCTGAGGCACAAATG Q393A-R: GAAAGCATTCATTTGTGCCTCAGC The primers used for the mutant F418A are as follows:

[0082] F418A-F: GACTACCGCAAAGACGCAAATAAT F418A-R: CTCTGAGTCATTATTTGCGTCTTT The primers used for mutant A47K are as follows:

[0083] A47K-F: CTGCCCTTCGATTCGAAAGTGGAT A47K-R: GATGTAGCTATCCACTTTCGAATC The primers used for mutant I83F are as follows:

[0084] I83F-F:AAGCCGCCTTCAGCGTTTCTGTCA I83F-R:AATTAAATCTGACAGAAACGCTGA The primers used for mutant P140T are as follows:

[0085] P140T-F: TCATACGTGTTCTTCACCTCGTCT P140T-R: GAAGGCTGCAGACGAGGTGAAGAA The primers used for the mutant R210L are as follows:

[0086] R210L-F:TCAGCTCGTCGCATTCTGGAAACA R210L-R:GATCCCTTTTGTTTCCAGAATGCG

[0087] The primers used for mutant F285M are as follows:

[0088] F285M-F:CTGTGCTTCGGGAGTATGGGTTCA

[0089] F285M-R:CTCATCAAATGAACCCATACTCCC

[0090] The primers used for mutant E399M are as follows:

[0091] E399M-F:CAAATGAATGCTTTCATGATGGTC

[0092] E399M-R:TAACTCCTTGACCATCATGAAAGC

[0093] The primers used for mutant E423F are as follows:

[0094] E423F-F:TTCAATAATGACTCATTTGTCATT

[0095] E423F-R:CGCTTTTACAATGACAAATGAGTC

[0096] The PCR reaction system (20 μL) was as follows: KOD enzyme (2.5 U / mL) 0.5 μL, template pET28a-EcUGT227 (50 ng / μL) 1.0 μL, dNTP 1.5 μL, MgSO4 1.0 μL, 10× KOD buffer 2.0 μL, upstream and downstream primers 0.5 μL each, and ddH2O was added to 20 μL.

[0097] The amplification conditions of the PCR products were as follows: (1) pre-denaturation at 95°C for 2 min, (2) denaturation at 95°C for 30 sec, (3) annealing at 55°C for 30 sec, (4) extension at 68°C for 270 sec, and repeating steps (2) to (4) for 25 cycles. Finally, the amplified products were extended at 68°C for 10 min and stored at 16°C.

[0098] The PCR amplification products were detected by 1% agarose gel electrophoresis. After the detection, 2 μL of PCR amplification product, 0.5 μL of methylation template digestion enzyme (Dpn I), and 2.5 μL of 10*Qcut buffer were taken, and ddH2O was added to 25 μL. The mixture was mixed by pipetting with a pipette tip, and the reaction was carried out at 37°C for 1 h. 10 μL of the amplification product after Dpn I treatment was taken to transform Escherichia coli E. coli BL21 (DE3).

[0099] The transformation product was spread onto LB solid medium containing kanamycin resistance and incubated at 37°C, 180 rpm for 10-12 h. Two transformants were picked from the LB solid medium and inoculated into 5 mL of LB medium containing kanamycin resistance, respectively. The cultures were incubated at 37°C, 180 rpm, on a shaker for 10-12 h. 500 μL of the bacterial solution was added to 500 μL of 30% glycerol and incubated at -80°C. The remaining bacterial solution was used for sequencing.

[0100] Verify the mutants obtained by sequencing correctly. Take 20 μL of the preserved glycerol bacteria and inoculate them into a 5 mL shaking tube. Incubate them at 37°C and 180 rpm for 10-12 h to obtain seed solution. Inoculate the seed solution into a 40 mL shaking flask at a 1% (v / v) inoculation volume and incubate them at 37°C and 180 rpm to an OD of 0. 600 When the value was 0.8, IPTG with a final concentration of 0.2 mmol / L was added and the mixture was induced at 16°C and 180 rpm for 16-18 hours to obtain a fermentation broth; the fermentation broth was centrifuged at 4°C and 8000 rpm for 5 minutes, the supernatant was discarded, and 7 mL of pH 7.5 PBS buffer was added for 10 minutes of ultrasonic disruption (350w, on 2s, off 3s) to obtain a cell lysis solution, which was centrifuged at 8000 rpm for 30 minutes to obtain a supernatant crude enzyme solution. The above-mentioned crude enzyme detection method was used to verify the mutant. Since the enzyme activity of WT was very low, no product was detected in the crude enzyme reaction. Therefore, during the crude enzyme verification process of the mutant, the mutant in which product generation was detected was used as a beneficial mutant for pure enzyme verification.

[0101] (2) Protein purification

[0102] The recombinant E. coli BL21 / pET28a-EcUGT227 obtained in step (1) and the preferred mutant screened in step (2) were fermented in 100 mL shake flasks using the same procedure as the crude enzyme fermentation. The cell supernatants containing the wild-type UDP-glycosyltransferase and a series of preferred mutants of UDP-glycosyltransferase were collected.

[0103] The obtained cell disruption supernatant was purified using an affinity column His-Trap FF crude (nickel column). The purification process was as follows: first, the nickel column was equilibrated with buffer A (20 mmol / L Tris, 500 mmol / L NaCl, 20 mmol / L imidazole, pH 7.4), and the cell disruption supernatant containing wild-type UDP-glycosyltransferase and a series of preferred mutants of UDP-glycosyltransferase was passed through the nickel column respectively. Buffer A was continued to be used to elute the protein not bound to the nickel column. After the breakthrough peak was exhausted, gradient elution was performed from buffer A to buffer B (20 mmol / L Tris, 500 mmol / L NaCl, 500 mmol / L imidazole, pH 7.4) to elute the recombinant protein bound to the nickel column, thereby obtaining pure enzyme solutions of wild-type UDP-glycosyltransferase and a series of preferred mutants of UDP-glycosyltransferase.

[0104] The obtained cell disruption supernatant and pure enzyme solution were subjected to SDS-PAGE analysis. The analysis results are shown in Figure 1 .

[0105] Depend on Figure 1 It can be seen that the supernatant of cell disruption has a band at 120kDa that is consistent with the theoretical molecular weight, indicating that the UDP-glycosyltransferase is successfully expressed; the pure enzyme solution of UDP-glycosyltransferase shows a single band between 120kDa and less impurities, indicating that the nickel column purification effect is good.

[0106] (3) Determination of the yield of the screened UDP-glycosyltransferase mutants

[0107] The sites obtained after molecular docking were scanned for alanine, and the crude enzyme solution and pure enzyme prepared by the glycerol bacteria successfully mutated in step (2) were reacted in a 1.5 mL centrifuge tube and then subjected to liquid phase detection.

[0108] Crude enzyme reaction system (500 μL): 1mmol / L ginsenosides, 5mmol / L UDPG, add crude enzyme solution to 500 μL

[0109] μL.

[0110] Pure enzyme reaction system (250 μL in total): 80 μL of pure enzyme solution with a protein concentration of 12 mg / mL was added to 1 mmol / L ginsenoside, 5 mmol / L UDPG, and 50 mmol / L pH 7.5 PBS buffer to obtain a reaction system.

[0111] The reaction system was placed in an oscillating reactor at 60°C and 1000r for 24h. After the reaction, 500μL of pure methanol was added to terminate the reaction. The mixture was centrifuged at 12000r for 10min and filtered through a 0.22μm water filter membrane. Samples were taken for HPLC analysis and the concentration of the generated Rh1 was calculated, as well as the yield. At the same time, the ginsenoside Rh1 standard was used as a control to determine the peak time, such as Figure 2 shown.

[0112] In the liquid phase assay, due to the low activity of the WT enzyme, no product was detected in the crude enzyme assay, while the yield in the pure enzyme reaction was 15%. Of the 22 mutation sites detected by alanine scanning, only the I83A site was detected to produce product, with a yield of 24%.

[0113] Using consensus finder and fireprot online websites, we predicted eight sites: I83F, F285M, A47K, R210L, P140T, E423F, E399M, and D171A. The crude enzyme reaction yields are shown in the following table:

[0114] Table 1 Yields of 8 mutants predicted by the website

[0115]

[0116] Example 2 Saturation mutagenesis of two beneficial mutants I83 and F285

[0117] Based on the results of Example 1, 19 primers were designed for site-directed mutagenesis at the two sites. After obtaining successful mutants according to step (2) in Example 1, the reaction system of step (3) in Example 1 was used for crude enzyme detection. The yields obtained are shown in the following table:

[0118] Table 2 Yields of saturation mutations at I83 and F285 sites

[0119]

[0120]

[0121] As shown in Table 2, the crude enzyme yields of mutants I83D, I83H, I83A, F285Q, F285L, F285M, F285V, and F285I were all higher than the yield of pure wild-type UDP-glycosyltransferase in producing ginsenoside Rh1, with the highest yield reaching 51%.

[0122] The UDP-glycosyltransferase parent was subjected to combined mutation of the F285M site and the I83 beneficial mutant. After obtaining a successful mutant according to step (2) in Example 1, the reaction system of step (3) in Example 1 was tested with crude enzyme. The combined mutation yields are shown in the following table:

[0123] Table 3 Combination mutation yields

[0124]

[0125] As shown in Table 3, the yield of the crude enzyme of the double mutants can reach 85%, and the yield of the mutant F285M / I83A crude enzyme in producing ginsenoside Rh1 can reach 92%.

[0126] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A UDP-glycosyltransferase mutant, characterized in that The mutant is obtained by mutating the isoleucine at position 83 and / or the phenylalanine at position 285 of the UDP-glycosyltransferase parent, and the amino acid sequence of the parent is shown in SEQ ID NO:

1.

2. The mutant according to claim 1, characterized in that The mutant undergoes any of the following mutations on the parent: (1) Isoleucine I at position 83 is mutated to alanine A, aspartic acid D, or histidine H; (2) mutation of phenylalanine F at position 285 to glutamine Q, leucine L, methionine M, isoleucine I, or valine V; (3) The phenylalanine F at position 285 is mutated to methionine M and the isoleucine I at position 83 is mutated to alanine A, glutamine Q, aspartic acid D or histidine H.

3. A gene encoding the UDP-glycosyltransferase mutant according to claim 1 or 2.

4. A recombinant plasmid carrying the gene according to claim 3.

5. A microbial cell expressing the mutant according to claim 1 or 2, or carrying the gene according to claim 3, or transformed with the recombinant plasmid according to claim 4.

6. A method for increasing the yield of ginsenoside Rh1 synthesized by UDP-glycosyltransferase, characterized in that: The method comprises performing any of the following mutations on the UDP glycosyltransferase parent with an amino acid sequence as shown in SEQ ID NO: 1: (1) Isoleucine I at position 83 is mutated to alanine A, aspartic acid D, or histidine H; (2) mutation of phenylalanine F at position 285 to glutamine Q, leucine L, methionine M, isoleucine I, or valine V; (3) The phenylalanine F at position 285 is mutated to methionine M and the isoleucine I at position 83 is mutated to alanine A, glutamine Q, aspartic acid D or histidine H.

7. A method for efficiently synthesizing ginsenoside Rh1, characterized in that: The method comprises adding the mutant according to claim 1 or 2 to a reaction system containing ginsenoside PPT for reaction.

8. The method according to claim 7, characterized in that In the reaction system, the concentration of ginsenoside is 0.5-2 mmol / L, and the amount of the UDP-glycosyltransferase mutant added is 2-8 mg / mL; It also contains UDPG at a concentration of 2.5-10mmol / L.

9. The method according to claim 7, characterized in that: The reaction temperature is 40-70°C and the pH is 6-8.

10. Use of the UDP-glycosyltransferase mutant according to claim 1 or 2, or the gene according to claim 3, or the recombinant plasmid according to claim 4, or the microbial cell according to claim 5, or the method according to claim 6, or the method according to any one of claims 7 to 9 in producing a product containing ginsenoside Rh1.

Images