Kit for rapidly detecting respiratory pathogens by combining multiple PCR (Polymerase Chain Reaction) with CRISPR-Cas

Abstract

The invention discloses a kit for rapidly detecting respiratory pathogens by combining multiple PCR (Polymerase Chain Reaction) with CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (Clustered Regularly Interspaced Short Palindromic Repeats). The kit comprises a multiple amplification primer combination, an sgRNA detection plate, DNA (Deoxyribose Nucleic Acid) polymerase, RNA reverse transcriptase, CRISPR / Cas The sequence of the multiple amplification primer combination is as shown in SEQ NO: 1-374; the sgRNA detection plate is an array type microporous plate, and each detection hole is filled with one sgRNA as shown in SEQ NO 383-569. The kit disclosed by the invention can be used for nucleic acid detection of respiratory pathogens and can be used for detecting viruses and bacteria at the same time, and the detection flux reaches up to 178 pathogens; the CRISPR-Cas is used for carrying out specific recognition on nucleic acid fragment targets in an amplification product, fluorescence detection is carried out, and the method has the advantages of being ultra-multiple, low in equipment requirement, low in cost, short in time, high in specificity, high in sensitivity and the like, and can provide molecular level judgment basis and help for clinical diagnosis of pathogen infection.

Description

Technical Field

[0001] The present invention belongs to the technical field of respiratory pathogen detection, and specifically relates to a kit for rapid detection of respiratory pathogen nucleic acid by combining multiple PCR and CRISPR-Cas, and a method for using the kit. Background Art

[0002] Respiratory pathogens, including bacteria, viruses, fungi and parasites, are the main causes of respiratory infections. These pathogens enter the human body through airborne, contact transmission or other means, causing respiratory diseases ranging from mild to severe. In recent years, with the emergence of new infectious diseases and the resurgence of traditional diseases, the detection technology of respiratory pathogens has become increasingly important in public health and clinical medicine.

[0003] Diseases caused by respiratory pathogens not only affect the health of patients, but also impose a huge burden on the socioeconomic and public health systems. Common respiratory pathogens include:

[0004] Bacteria: such as Streptococcus pneumoniae, Staphylococcus aureus, Klebsiella pneumoniae and Haemophilus influenzae.

[0005] Viruses: such as influenza virus, respiratory syncytial virus, adenovirus, coronavirus (including SARS-CoV, MERS-CoV and SARS-CoV-2) and parainfluenza virus.

[0006] Fungi: such as Aspergillus, Cryptococcus neoformans, and Candida albicans.

[0007] These pathogens can cause a range of respiratory diseases, from the common cold and acute bronchitis to severe pneumonia, acute respiratory distress syndrome (ARDS) and tuberculosis. Children, the elderly and people with weakened immune systems are at high risk of these diseases.

[0008] Early and accurate pathogen detection is crucial to controlling the spread of diseases and developing treatment plans. Accurate pathogen detection can help clinicians develop precise treatment plans: avoid the abuse of antibiotics and reduce the emergence of drug-resistant strains; monitor the prevalence of diseases: timely detect and control outbreaks of infectious diseases and prevent large-scale epidemics; improve public health response capabilities: especially in the face of emerging infectious diseases, rapid and accurate detection can greatly improve the efficiency and effectiveness of public health response.

[0009] Traditional methods for detecting respiratory pathogens include bacterial culture, microscopy, and immunological methods.

[0010] Bacterial culture is one of the traditional methods for pathogen detection. By growing bacteria on a specific culture medium, specific pathogens can be identified and drug sensitivity tests can be performed. Although this method is highly accurate, it takes a long time (usually 24-48 hours) and has limited effectiveness in detecting some bacteria or viruses that are difficult to culture.

[0011] Microscopic examination can directly observe the morphology of pathogens and is often used to detect bacteria and parasites. Although it is easy to operate, its sensitivity and specificity are low and it depends on the experience of the technician.

[0012] Enzyme-linked immunosorbent assay (ELISA) and fluorescent immunoassay techniques identify pathogens by detecting antibodies or antigens in serum. These methods have high sensitivity and specificity and are suitable for large-scale screening, but they take a long time to produce results.

[0013] Molecular biology detection technology has made significant progress in recent years, especially in the fields of gene editing, disease and pathogen detection, and biomedical research. Molecular biology detection technology includes polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), next generation sequencing (NGS), etc.

[0014] PCR technology, especially real-time fluorescence quantitative PCR (qPCR), can efficiently amplify and detect nucleic acids of pathogens in a short time. Its high sensitivity and specificity make it one of the most widely used detection technologies. However, PCR detection has high requirements for laboratory equipment and technicians, and is costly.

[0015] RT-PCR is used to detect RNA viruses (such as influenza virus and coronavirus) by converting RNA into DNA through reverse transcription and then amplifying it through PCR. Although the operation steps are complicated, it has extremely high sensitivity and specificity in RNA virus detection.

[0016] NGS technology is a high-throughput DNA sequencing technology that can sequence a large number of DNA fragments in parallel in a short time. Compared with traditional Sanger sequencing, NGS technology has higher sensitivity and throughput, can comprehensively analyze complex genomes, and discover known and unknown pathogens. It is particularly suitable for complex infections and multiple pathogen detection. However, the cost is high. The cost of sequencing equipment and reagents is high, which limits its widespread application in resource-limited areas; data analysis is complex: strong bioinformatics analysis capabilities are required to process and interpret massive data; sample processing requirements are high: high-quality sample extraction and library construction are required to ensure the accuracy of sequencing results.

[0017] Rapid detection technology has important application value in the detection of respiratory pathogens. It can provide accurate test results in a short time, which is helpful for timely diagnosis and control of disease transmission. Several common rapid detection technologies include immunochromatographic test (ICT), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), nucleic acid sequence-based amplification (NASBA), CRISPR / Cas system, etc.

[0018] Immunochromatographic test is a rapid detection technology based on antigen-antibody reaction, which is usually used for rapid on-site diagnosis. ICT includes test strips and card devices, which move samples and labeled antibodies to the detection area through capillary action. It has the characteristics of simple operation, rapidity and diversity. However, the sensitivity and specificity are relatively low, and false negative or false positive results are prone to occur.

[0019] Loop-mediated isothermal amplification (LAMP) is an efficient and rapid DNA amplification technology that can perform amplification reactions at a constant temperature (60-65°C). LAMP technology uses four specific primers to recognize six different regions of the target DNA, combined with strand displacement DNA polymerase, to amplify a large amount of target DNA in a short time (usually less than 1 hour). It has the advantages of simple operation, fast speed, and low equipment requirements. However, it may be necessary to design specific primers for different pathogens, and the scope of application is limited.

[0020] Recombinase polymerase amplification (RPA) is a nucleic acid amplification technique performed at a constant low temperature (about 37-42°C). RPA uses recombinase, DNA polymerase and single-stranded binding protein to amplify at a constant temperature. It has the advantages of rapid response, high sensitivity, can be performed at room temperature, and is suitable for on-site detection. Similarly, similar to LAMP, specific primers need to be designed, and optimization is still required in practical applications.

[0021] NASBA is a technology that specifically amplifies RNA molecules and is commonly used for the detection of viral RNA. NASBA is performed at a constant temperature (41°C) and uses reverse transcriptase, RNase H, and T7 RNA polymerase to reverse transcribe RNA into cDNA and amplify it through RNA polymerase. It is suitable for the detection of RNA viruses. However, it also has disadvantages such as complex sample processing, risk of RNA degradation, difficulty in primer design, limited quantitative ability, complex result interpretation, high dependence on equipment and reagents, high cost, and risk of cross-contamination.

[0022] In pathogen diagnosis, the CRISPR / Cas system usually uses the nuclease activity of Cas proteins (such as Cas9, Cas12, and Cas13) in combination with specific guide RNA (gRNA or crRNA) to recognize and cut the nucleic acid sequence (DNA or RNA) of the target pathogen. Two commonly used CRISPR diagnostic platforms: SHERLOCK (Specific High-sensitivity Enzymatic Reporter unLOCKing) and DETECTR (DNA Endonuclease-Targeted CRISPR Trans Reporter)

[0023] SHERLOCK diagnostic platform is used for RNA target detection. After Cas13a recognizes a specific RNA sequence, it triggers its RNase activity, resulting in the cleavage of surrounding RNA molecules (including reporter RNA). The cleavage of the reporter RNA generates a fluorescent signal, which enables signal amplification and visual detection.

[0024] DETECTR diagnostic platform for DNA target detection. After recognizing a specific DNA sequence, Cas12a triggers its non-specific single-stranded DNA enzyme activity to cut the surrounding reporter single-stranded DNA (ssDNA). By reporting the cutting of ssDNA, a fluorescent or colorimetric signal is generated to achieve signal amplification and visual detection.

[0025] Although significant progress has been made in the detection technology of respiratory pathogens, some challenges still exist, including the need to further shorten the detection time and improve the accuracy and sensitivity of detection; develop technologies that can simultaneously detect multiple pathogens with high throughput to deal with complex infection situations; further reduce the cost of detection and improve accessibility in resource-limited areas; and quickly identify and detect emerging pathogens, such as the new coronavirus. Summary of the invention

[0026] The purpose of the present invention is to provide a kit for rapid detection of respiratory pathogen nucleic acid based on multiplex PCR and CRISPR-Cas, which can simultaneously detect 178 respiratory pathogens with high throughput, and improve the detection sensitivity and specificity of respiratory pathogens. Compared with the current fluorescent quantitative PCR and NGS detection technology, this kit can simultaneously detect multiple targets in large quantities, does not require precision sequencing instruments, and the amplified detection products are cut by CRISPR-Cas protein, which is not easy to cause contamination. It has the characteristics of low cost, multiple targets, and easy deployment. It can be used to promote the molecular detection of pathogens and provide more effective tools for clinical diagnosis and / or scientific research.

[0027] The technical solution adopted by the present invention is:

[0028] A kit for rapid detection of respiratory pathogens by multiplex PCR combined with CRISPR-Cas, the kit comprising a multiplex amplification primer combination, an sgRNA detection plate loaded with sgRNA, a DNA polymerase, an RNA reverse transcriptase, a CRISPR / Cas protein, and a fluorescent reporter probe;

[0029] The multiple amplification primer combination is the sequence shown in SEQ NO 1 to 374;

[0030] The sgRNA detection plate is an array microwell plate, and each detection well is filled with one of the sgRNAs shown in SEQ NOs 383 to 569.

[0031] The microplate can be a 24-well plate, a 48-well plate, a 96-well plate, a 384-well plate, etc.

[0032] The CRISPR / Cas protein is preferably Cas12a protein.

[0033] The respiratory pathogens detected by the present invention are one or more of the following 178 respiratory pathogens:

[0034] Escherichia coli, Acinetobacter baumannii, Haemophilus influenzae, Corynebacterium striata, Proteus mirabilis, Enterobacter cloacae, Staphylococcus aureus, Enterococcus faecium, Enterococcus faecalis, Streptococcus pneumoniae, Serratia marcescens, Klebsiella pneumoniae, Klebsiella aerogenes, Pseudomonas aeruginosa, Stenotrophomonas maltophilia, Burkholderia cepacia, Moraxella catarrhalis, Trophicola whipplei, Legionella pneumophila, Nocardia anguillarum, Bordetella pertussis, Streptococcus parasanguinis, Nocardia braziliensis, Nocardia caviae, Nocardia asteroides, Streptococcus pyogenes, Mycobacterium tuberculosis, Mycobacterium abscessus, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium chelonae, Mycobacterium avium complex, Mycoplasma pneumoniae, Chlamydia pneumoniae, Chlamydia psittaci, Rickettsia japonicum, Mycoplasma hominis, Legionella Jordan, Legionella Cincinnati, Legionella Oak Ridge, Legionella worcesteria, Pneumocystis jiroveci, Cryptococcus neoformans, Aspergillus terreus, Aspergillus fumigatus, Aspergillus flavus, Candida tropicalis, Candida albicans, Candida glabrata, Candida parapsilosis, Rhizomucor microsporus, Rhizopus oryzae, Talaromyces marneffei, Scedosporium apiospermum, Aspergillus niger, Rhizopus microsporus, Cunninghamella griseus, Legionella warcesteriae, Herpesvirus 1, Herpesvirus 3, Herpesvirus 4, Herpesvirus 5, Herpesvirus 6, Herpesvirus 7, Human Bocavirus 1, Adenovirus B, Adenovirus C, Adenovirus E, Influenza A, Influenza B, Parainfluenza 1, Parainfluenza 3, Parainfluenza 4, Coronavirus OC43, Coronavirus 229E, Coronavirus Virus NL63, coronavirus HKU1, 2019 novel coronavirus, human metapneumovirus, rhinovirus A, rhinovirus B, rhinovirus C, enterovirus group A, enterovirus group B, enterovirus group C, enterovirus group D, respiratory syncytial virus A, respiratory syncytial virus B, Klebsiella oxytoca, hospital acinetobacter, Streptococcus agalactiae, Streptococcus gastricis, human bocavirus type 2, human bocavirus type 3, human bocavirus type 4, primate erythroparvovirus 1, human polyomavirus type 1, human polyomavirus type 2, human polyomavirus type 3, human polyomavirus type 4, human polyomavirus type 5, Legionella tucsonensis, Bordetella parapertussis, Bartonella henselae, Treponema pallidum, Bacteroides fragilis, Corynebacterium pseudotuberculosis, Corynebacterium diphtheriae, Dalirius pulmonary Sterling, Veillonella parvum, Citrobacter kremeri, Bacillus cereus group, Streptococcus gordonii, Rhodococcus equi, Streptococcus pseudopneumoniae, Staphylococcus hemolyticus, Anopheles elizabethii, Burkholderia cinerea, Fusobacterium necroticum, Leptospira interrogans, Streptococcus sanguinis, Bordetella bronchiseptica, Candida duro, Candida auris, Candida pseudoglabrata, Candida pseudoglabrata, Fusarium fujikura, Fusarium graminearum, Absidia scrofa, Candida intermedia, Aspergillus tubingensis, Aspergillus versicolor, Mucor circinelloides, Chlamydia abortus, Candida krusei, Chlamydia trachomatis, Ureaplasma urealyticum, Coxiella burnetii, Legionella St. Helens, Legionella Marseilles, Legionella anise, Legionella fischeri, Legionella beriardi, Nocardia new Scots, Nocardia takeda,Nocardia microwhite, Nocardia amberjack, Nocardia southafrica, Klebsiella millei, Steinerella forsythe, Lazy cunning bacteria, Elizabeth millei, Morganella morganii, Klebsiella pneumoniae, Defective bacteria, Leuconostoc lactis, Nocardia oysteris, Histoplasma capsulatum, Mycobacterium smegmatis, Mycobacterium gordonii, Mycobacterium marinum, Nocardia mexicanum, Mycobacterium fortuitum, Legionella paris, Legionella harvey, Legionella marie, Legionella longbeach, Nocardia gelsenkirchen, Nocardia waldenii, Nocardia asiatica, Nocardia abscessus, Terpene Nocardia, Oligophagous Nocardia, Nocardia africa, Nocardia brucei, Nocardia beijingensis, Nocardia concave colony, New golden mycobacterium.

[0035] Respiratory pathogens and the corresponding sgRNAs for detecting the target sequences of the pathogens are shown in the following table:

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042] Furthermore, the fluorescent reporter probe is a single-stranded DNA, the 5' end of which is labeled with a fluorescent group and the 3' end of which is labeled with a quenching group;

[0043] The groups include but are not limited to FAM, HEX, VIC, CY5, CY3, ROX, and TAMRA; the fluorescence quenching groups include but are not limited to BHQ1 and BHQ2.

[0044] The single-stranded DNA can be recognized and cut by CRISPR / Cas protein. The single-stranded DNA can be a linear structure or a stem-loop structure. The linear structure can be CCCCCC, TTTTT, etc. Preferably, the sequence of the single-stranded DNA is CCCCCC.

[0045] Furthermore, the kit includes a multiplex amplification system and a detection system, wherein the multiplex amplification system includes a multiplex amplification primer combination, an amplification enzyme, and an amplification buffer; the amplification enzyme includes a DNA polymerase and an RNA reverse transcriptase;

[0046] The detection system includes an sgRNA detection plate filled with sgRNA, CRISPR / Cas protein, and a detection solution, wherein the detection solution includes a detection buffer and a fluorescent reporter probe.

[0047] Preferably, the amplification buffer comprises PCR buffer, dNTP and MgCl2, preferably the amplification buffer comprises 0.1-50 mM dNTP and 1-100 mM MgCl2. PCR buffer can be a commercially available PCR amplification buffer.

[0048] The concentration of the amplification enzyme is generally 10 to 3000 U / μL for polymerase and 10 to 3000 U / μL for reverse transcriptase.

[0049] The multiplex amplification system is used to perform multiplex PCR amplification on the sample to be tested, and simultaneously amplify multiple target regions.

[0050] The detection buffer comprises Tris-HCl, MgCl2, NaCl and DTT (dithiothreitol); preferably, the detection buffer comprises Tris-HCl 5-100mM (pH 8-9), MgCl2 5-150mM, NaCl 5-100mM, and DTT 1-50mM.

[0051] The detection system is used to perform CRISPR-Cas detection on the amplification products of multiplex PCR amplification. The specific process is: sgRNA guides the CRISPR / Cas protein to the target, and after recognizing the target, it activates the trans-cleavage property of the CRISPR / Cas protein, cuts the single-stranded DNA of the fluorescent reporter probe, and releases the fluorescent group to emit light.

[0052] The concentration of CRISPR / Cas protein was 0.1 to 10 pmol / μL;

[0053] The concentration of the fluorescent reporter probe is 0.1 to 50 μM.

[0054] The concentration of sgRNA is 0.1-10 μM.

[0055] The kit may also include an internal standard and a negative control.

[0056] The negative control was 10 2 ~10 6 CFU / mL human cells;

[0057] The internal standards include a first internal standard, a second internal standard, and a third internal standard;

[0058] The first internal standard is a 1-10 pg / μL artificial synthetic DNA fragment, which serves as a blank DNA internal standard;

[0059] The second internal standard is a 10 2 ~10 6 copies / mL blank RNA pseudovirus, used as blank RNA internal standard;

[0060] The third internal standard is 0.1-100 ng / μL human EGFR fragment, which serves as an internal standard for CRISPR-Cas detection.

[0061] Preferably, the multiple amplification primers for the first internal standard and the second internal standard are sequences shown in SEQ NOs 375-382; specifically, the first internal standard can amplify three targets, and the primer sequences are SEQ 375-578, 381, and 382; the amplification primers for the second internal standard are sequences shown in SEQ NOs 379-380.

[0062] Preferably, the sequences of the sgRNAs of the first internal standard, the second internal standard, and the third internal standard are SEQ NOs 570-575.

[0063] Specifically, the sgRNA sequence of the first internal standard target 1 is SEQ NO 570, the sgRNA sequence of the first internal standard target 2 is SEQ NO 571, and the sgRNA sequence of the first internal standard target 3 is SEQ NO 574;

[0064] The sgRNA sequence of the second internal standard is SEQ NO 572, the sgRNA sequence of the third internal standard target 1 is SEQ NO 573, and the sgRNA sequence of the third internal standard target 2 is SEQ NO 575.

[0065] The kit may also include a nucleic acid extraction reagent for extracting nucleic acid from the sample to be tested as a template.

[0066] Alternatively, a commercially available nucleic acid extraction kit is used to extract the nucleic acid of the sample to be tested.

[0067] The present invention also provides the use of the multiplex PCR combined with CRISPR-Cas rapid detection kit for respiratory pathogens in rapid detection of respiratory pathogens.

[0068] Furthermore, the present invention also provides a kit for rapid detection of respiratory pathogens using multiplex PCR combined with CRISPR-Cas, and a method for detecting respiratory pathogens, the method comprising the following steps:

[0069] (1) extracting nucleic acid from the sample to be tested as a template;

[0070] The samples to be tested are usually respiratory samples, such as sputum, alveolar lavage fluid, throat swabs, pleural effusion, etc.

[0071] Preferably, after adding the first internal standard and the second internal standard to the sample to be tested, nucleic acid is extracted and used as a template.

[0072] (2) using the extracted nucleic acid as a template, adding a multiple amplification primer combination, an amplification enzyme, and an amplification buffer to prepare a multiple PCR reaction system, performing multiple PCR amplification, and obtaining an amplification product;

[0073] (3) The amplified product, CRISPR / Cas protein, and detection solution are added to the sgRNA detection plate. Each detection well is filled with sgRNA corresponding to a different pathogen. Each detection well is prepared with the same CRISPR-Cas fluorescence detection reaction system. The reaction is protected from light. The fluorescence signal is detected using a fluorescence detector and judged: if the fluorescence signal value is above 14,000, the detection well is judged to be positive for the pathogen.

[0074] In step (2), the multiplex PCR reaction system is preferably 50 μL, including 25 μL of amplification buffer, 2 μL of amplification enzyme, 13 μL of multiplex amplification primer combination, 5 μL of nucleic acid template, and the balance is water.

[0075] In step (2), the reaction procedure of multiplex PCR amplification is preferably:

[0076] ①50℃, 15min;

[0077] ②95℃, 3min;

[0078] ③95℃, 15sec; 60℃, 75sec; 72℃, 30sec; 45 cycles.

[0079] In the step (3), the CRISPR-Cas fluorescence detection reaction system is preferably 50 μL, including 5 μL of detection solution, 2.5 μL of CRISPR / Cas protein, 10 μL of sgRNA, 1 μL of amplification product, and the balance is water.

[0080] In a preferred embodiment, when a 96-well detection plate is used for high-throughput detection, the CRISPR-Cas fluorescence detection reaction system is preferably 50 μL, and the reaction is carried out at 37 to 42° C. (preferably 42° C.) for 20 to 30 minutes under light-containing conditions.

[0081] In the step (3), the fluorescence signal is detected using a fluorescence detector, and multiple detection holes on the detection plate are detected simultaneously at the same time point.

[0082] Each detection well of the detection plate is filled with the sequences shown in SEQ NOs 383 to 569, respectively, wherein the Mycobacterium avium complex amplifies two target sequences, and two sgRNAs complementary thereto, whose sequences are shown in SEQ ID NO.415 and SEQ ID NO.416, are loaded in the same well.

[0083] Aspergillus flavus amplified two target sequences, and two sgRNAs complementary thereto, whose sequences were shown in SEQ ID NO.431 and SEQ ID NO.432, were loaded into the same well.

[0084] Two target sequences were amplified in Candida albicans, and two sgRNAs complementary thereto, with sequences shown in SEQ ID NO.434 and SEQ ID NO.435, were loaded into the same well.

[0085] It is worth noting that for Mycobacterium tuberculosis and Cryptococcus neoformans, two target sequences were amplified respectively, and two sgRNAs complementary to them were loaded into two wells respectively, that is, there were two targets.

[0086] The sgRNAs of Mycobacterium tuberculosis are SEQ ID NO.409 and SEQ ID NO.410 respectively. It is required that both detection wells filled with sgRNAs of the sequences shown in SEQ ID NO.409 and SEQ ID NO.410 are positive to determine that Mycobacterium tuberculosis is positive. If any well is negative, it cannot be determined that Mycobacterium tuberculosis is positive.

[0087] The sgRNAs of Cryptococcus neoformans are SEQ ID NO.427 and SEQ ID NO.428 respectively. It is required that both detection wells filled with sgRNAs of the sequences shown in SEQ ID NO.427 and SEQ ID NO.428 are positive to determine that Cryptococcus neoformans is positive. If any well is negative, it cannot be determined that Cryptococcus neoformans is positive.

[0088] In a preferred embodiment, each detection plate is provided with a blank control detection well, a first internal standard detection well, a second internal standard detection well and a third internal standard detection well.

[0089] The blank control detection wells were not filled with sgRNA, and only water was added as a blank control.

[0090] When all the pathogens corresponding to the sgRNA on a certain test plate are DNA pathogens, the second internal standard detection well may not be set, and only the blank control detection well, the first internal standard detection well, and the third internal standard detection well may be set.

[0091] In the step (3), the determination conditions can be further refined.

[0092] In a preferred embodiment, the judgment standard performs a statistical average on the base value and sets a normalization parameter to normalize the data, specifically:

[0093] ① Sort the fluorescence values ​​of the pathogen sgRNA detection wells (excluding internal standards and control wells) in the 96-well detection plate from small to large, take the first 60 values, calculate the average value to get NC-av, set the normalization coefficient = 7000 / NC-av1 (7000 is the blank control background value), multiply the data of all wells by the normalization coefficient to get the normalized data (take the integer);

[0094] ② If the fluorescence value of the detection well is greater than 14000, it is judged as positive, 13000<fluorescence value≤14000 is judged as gray area, and the fluorescence value is less than 13000 is judged as negative.

[0095] The beneficial effects of the present invention are:

[0096] 1. The target nucleic acid in the respiratory specimen is specifically amplified through super-multiplex PCR enrichment technology. Multiple pathogen target nucleic acids can be amplified at one time, with a detection throughput of up to 178 pathogens.

[0097] 2. Super-multiplex PCR realizes single-tube amplification of DNA and RNA targets, and can detect viruses and bacteria at the same time.

[0098] 3. For multiple PCR products, CRISPR-Cas is used to specifically identify the nucleic acid fragment target, activate the fluorescent group, and form a fluorescent signal of a specific wavelength under the action of excitation light. The fluorescent signal can be captured and read to obtain information on the existence of the pathogen amplified fragment, thereby achieving qualitative detection of the nucleic acid of the pathogenic microorganism.

[0099] 4. The detection method is simple and does not require expensive and sophisticated fluorescent quantitative PCR instruments and sequencers. The equipment is cheap, low cost and has a wider range of applications.

[0100] 5. The amplified product is cleaved by CRISPR-Cas protein and is not easily contaminated by pathogens.

[0101] 6. The method of the present invention has the characteristics of high sensitivity, high specificity, low cost, short time, high specificity, high sensitivity, etc., and can provide molecular-level judgment basis and assistance for clinical diagnosis of pathogen infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0102] Figure 1 It is a schematic diagram of the process of the present invention.

[0103] Figure 2 This is a bar graph of the fluorescent reporter probe screening results of Example 1.

[0104] Figure 3 This is a bar graph showing the screening results of the optimal reaction temperature of the fluorescent reporter probe in Example 2.

[0105] Figure 4 This is the gel electrophoresis diagram of the screening experiment of terpene Nocardia amplification primers in Example 3.

[0106] Figure 5 This is a bar graph showing the screening results for terpene Nocardia sgRNA.

[0107] Figure 6 This is a bar chart of the screening results of novel coronavirus primers and sgRNA.

[0108] Figure 7 This is a graph showing the results of important target specificity tests.

[0109] Figure 8 Figure 2 shows the sensitivity test results for Mycobacterium tuberculosis positive samples.

[0110] Fig. 9 This is a graph showing the sensitivity test results for samples positive for the new coronavirus. DETAILED DESCRIPTION

[0111] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only some embodiments of the present invention, not all.

[0112] All other embodiments obtained without creative work are within the scope of protection of the present invention.

[0113] Example 1 Screening of fluorescent reporter probes

[0114] Experimental method: The required components, internal standard 3 and its corresponding sgRNA were detected by the CRISPR-Cas kit to screen the fluorescent reporter probes.

[0115] (1) Fluorescent probe design

[0116] The designed fluorescent probes include linear structures and stem-loop structures, which were synthesized by Huzhou Hippo Biotechnology Co., Ltd. The specific sequences are shown in the following table:

[0117] Sequences of fluorescent probes A to F

[0118] Fluorescent probe A CTCTCATTTTTAGAGAG 5`6-FAM 3`BHQ1 Fluorescent probe B CTCTCATTTTTTTTTTAGAGAG 5`6-FAM 3`BHQ1 Fluorescent probe C CTCTCccccccccccccGAGAG 5`6-FAM 3`BHQ1 Fluorescent probe D CTCTCccccccGAGAG 5`6-FAM 3`BHQ1 Fluorescent probe E CCCCCC 5`6-FAM 3`BHQ1 Fluorescent probe F TTTTT 5`6-FAM 3`BHQ1

[0119] (2) Fluorescent probe preparation

[0120] The fluorescent probe is dissolved in nuclease-free water, where A, B, C, and D are stem-loop structures and need to undergo: denaturation at 90°C for 2 minutes, then slowly cooled to room temperature for use.

[0121] (3) Fluorescent probe screening

[0122] The template used in this experiment is the third internal standard, which does not require PCR amplification and can be directly used in CRISPR-Cas detection. The sgRNA used is a synthetic sgRNA that is complementary to the specific region of internal standard 3 and has the sequence

[0123] UAAUUUCUACUAAGUGUAGAUCCAAGGCACGAGUAACAAGCUCA. And the system without the third internal standard template was used as the NC detection control.

[0124] The test system is prepared as follows:

[0125] Fluorescence detection system:

[0126] <![CDATA[Detection solution (including 150 mM MgCl2, 100 mM NaCl, 100 mM Tris-HCl pH 9.0, 10 mM DTT)]]> 5μL Detection enzyme Cas12a protein (1pmol / μL) 2.5μL Fluorescent probes 250nM sgRNA - 0.1 μM 10μL Template 1.0μL <![CDATA[H2O]]> upto50μL

[0127] Fluorescence detection reaction procedure:

[0128] 37℃ 30min

[0129] Experimental Results

[0130] The results of fluorescent reporter probe screening are as follows Figure 2 As shown, fluorescent probe E has the fastest reaction speed and the largest endpoint value. Therefore, fluorescent probe E is preferred, and its sequence is CCCCCC.

[0131] Example 2 Screening of the optimal temperature for fluorescent reporter probes

[0132] Experimental method: The screened fluorescent probe CCCCCC was used to test the reaction conditions at 37°C and 42°C respectively.

[0133] The detection system is as follows:

[0134] Fluorescence detection reaction system:

[0135] <![CDATA[Detection solution (including 150 mM MgCl2, 100 mM NaCl, 100 mM Tris-HCl pH 9.0, 10 mM DTT)]]> 5μL Detection enzyme Cas12a protein (1pmol / μL) 2.5μL Fluorescent probes 250nM sgRNA - 0.1 μM 10μL Template 1.0μL <![CDATA[H2O]]> upto50μL

[0136] Fluorescence detection reaction procedure 1:

[0137] 37℃ 30min

[0138] Fluorescence detection reaction procedure 2:

[0139] 42℃ 30min

[0140] The experimental results are as follows Figure 3 As shown in the figure, the reaction speed is fastest and the endpoint value is the largest at 42°C. Therefore, the optimal reaction temperature for CRISPR-Cas detection is 42°C.

[0141] Example 3 Screening of Terpene Nocardia Amplification Primers

[0142] (1) Primer design

[0143] The gluQRS gene of Nocardia terpenoides was downloaded from NCBI, and the primers designed are as follows:

[0144] Amplification primer sequences of terpene Nocardia

[0145] F1 TTACGGATCGGTGCCGAGTT F2 AGTTGCACCACGTCGGCG F3 AGATACGCCTGCCGCGGCGT F4 TGATCGATGCCCTGGTCGGAAT R1 GCAGACAAAGGAATTCGAGATC R2 AAAGGAATTCGAGATCATCGAC R3 ACCTGCACCTGGGCAATC R4 AGATCCTCGATGCGGATCAG

[0146] (2) Primer screening

[0147] The fluorescent quantitative PCR was performed using the QuantFast SYBR Green qPCR SuperMix kit from Hangzhou Maibo Biotechnology. The terpene Nocardia nucleic acid provided by Hangzhou Jieyi Biotechnology was used as the positive template, and the nucleic acid of Nocardia falciparum was used as the negative template. The primer combinations are shown in the following table:

[0148] Primer combinations for amplification of terpene Nocardia

[0149]

[0150]

[0151] (3) Preparation of Fluorescence Quantitative PCR System

[0152] QuantFastSYBRGreenqPCRSuperMix 12.5μL 50×ROXDye 0.5μL Primer pair to be tested: F+R (10μM+10μM) 1.5μL Target 2μL <![CDATA[ddH2O]]> up to 25 μL

[0153] Amplification Procedure:

[0154]

[0155] (4) Agarose gel electrophoresis detection

[0156] The fluorescence quantitative products were detected by 1% agarose gel electrophoresis.

[0157] (5) Fluorescence quantitative analysis

[0158] The summary of the Ct values ​​and Tm values ​​of fluorescence quantification is shown in the following table. It can be seen that the PC and NC of primer combination 5, primer combination 7, and primer combination 9 are quite different. Primer combination 5, primer combination 7, and primer combination 9 are temporarily listed as pending primer combinations.

[0159] Fluorescence quantitative detection results of different primer combinations:

[0160]

[0161]

[0162] (6) Analysis of agarose gel electrophoresis results

[0163] As the fluorescence quantitative results show, primer combination 5, primer combination 7, and primer combination 9 are primer combinations to be determined. According to the gel electrophoresis diagram ( Figure 4 ) It can be concluded that the PC of primer combination 5 has a target band of about 500 bp, and NC has no target band. Therefore, the preferred primer combination is F2 and R1. The sequences are shown in SEQ ID NO.361 and SEQ ID NO.362.

[0164] Example 4 Screening of Terpene Nocardia sgRNA

[0165] (1) Terpene Nocardia sgRNA design

[0166] According to the amplification primer combination 5 (F2+R1) of Example 3, the sgRNA sequence that can be designed is as follows, which was synthesized by Nanjing GenScript Biotechnology Co., Ltd.:

[0167] sgRNA sequence

[0168] sgRNA-1 UAAUUUCUACUAAGUGUAGAUCGGCAGGCGUAUCUGGCCGA sgRNA-2 UAAUUUCUACUAAGUGUAGUAUCUCGCGGUCGUGGUCGACG sgRNA-3 UAAUUUCUACUAAGUGUAGAUUACCGGGGUGUGGUGGACGA

[0169] (2) PCR amplification

[0170] Prepare the PCR system according to the following table:

[0171] Multiplex PCR reaction system

[0172] <![CDATA[Amplification buffer (PCR buffer, dNTP 40 mM, MgCl2 5 mM)]]> 25μL Amplification enzyme (polymerase 20U / μL, reverse transcriptase 200U / μL) 2μL Primer pair to be tested (F2+R1, 10μM+10μM) 4μL Template 5μL <![CDATA[H2O]]> upto50μL

[0173] PCR reaction procedure:

[0174]

[0175] (3) Fluorescence detection

[0176] Prepare the fluorescence detection system according to the following table:

[0177]

[0178] The above detection system was distributed onto an empty detection plate, and fluorescence was detected in real time at 42°C for a total of 30 min.

[0179] (4) Results analysis

[0180] The results are as follows Figure 5 As shown, all three sgRNAs have signals, among which sgRNA-3 has the fastest signal and the strongest fluorescence value at 30 min. Therefore, sgRNA-3 is the preferred sgRNA. The sequence is shown in SEQ ID NO.563.

[0181] Example 5: Screening of novel coronavirus primers and sgRNA

[0182] (1) Download the N gene sequence of the new coronavirus from NCBI, and design primers and sgRNA as follows:

[0183] serial number Sequence information F1 ACTACCGAAGAGCTACCAGACG SEQ ID NO.593 F2 AACTGAGGGAGCCTTGAATACA SEQ ID NO.594 R1 CAGACATTTTGCTCTCAAGC SEQ ID NO.595 R2 TCTTGAACTGTTGCGACTACGT SEQ ID NO.596 sgRNA-1 UAAUUUCUACUAAGUGUAGAUUUGUAGCACGAUUGCAGCAUU SEQ ID NO.597 sgRNA-2 UAAUUUCUACUAAGUGUAGAUCCUUGAGGAAGUUGUAGCACG SEQ ID NO.598 sgRNA-3 UAAUUUCUACUAAGUGUAGAUGCAAUGUUGUUCCUUGAGGAA SEQ ID NO.599

[0184] (2) Multiplex amplification system and reaction procedure: PCR amplification was performed under different primer combinations F1+R1, F1+R2, F2+R1, and F2+R2. For specific steps, refer to step (2) of Example 4.

[0185] (3) The PCR products amplified by four sets of different primers were respectively subjected to fluorescence detection using sgRNA-1, sgRNA-2, and sgRNA-3. The fluorescence detection system and reaction procedure were similar to step (3) of Example 4.

[0186] (4) Results analysis

[0187] like Figure 6 As shown in the figure, the negative control results were all negative. In PC, the primer combination F2+R2 and sgRNA-3 can be judged as positive in 30 minutes, so the preferred primers are F2 and R2, and the sgRNA is preferably sgRNA-3. The sequences are shown in SEQ ID NO.165, SEQ ID NO.166, and SEQ ID NO.465, respectively.

[0188] Example 6 Important target specificity test

[0189] Experimental method: The pathogen nucleic acid provided by Hangzhou Jieyi Biotechnology Co., Ltd. was mixed and then tested for specificity.

[0190] (1) Mixed pathogen group

[0191] Mix pathogen nucleic acids according to the table below, with each pathogen ≥ 1 ng.

[0192] A total of 76 pathogens including bacteria, fungi, DNA viruses, and RNA viruses were prepared into different template mixes. 1 μL of the first internal standard (50 fg / μL), 1 μL of the second internal standard (10 6 copies / mL)

[0193] List of pathogen types for template mix1 to 8

[0194]

[0195] (2) Multiplex PCR amplification

[0196] The sequences of the multiplex amplification primer combination are shown in SEQ NOs 1 to 382, ​​wherein SEQ NOs 375 to 578, 381, and 382 are amplification primers for different targets of the first internal standard, and SEQ NOs 379 to 380 are amplification primers for the second internal standard.

[0197] Sequence Listing of Multiplex Amplification Primer Combinations

[0198]

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206]

[0207]

[0208]

[0209] To prepare a multiplex amplification system:

[0210] <![CDATA[Amplification buffer (dNTP 40 mM, MgCl2 5 mM)]]> 25μL Amplification enzyme (polymerase 20U / μL, reverse transcriptase 200U / μL) 2μL Primer combination (400nmol / each) 13μL Template 5μL <![CDATA[H2O]]> upto50μL

[0211] PCR reaction procedure:

[0212]

[0213] (3) Fluorescence detection

[0214] Prepare 50 μL of the amplified product into the fluorescence detection reaction solution as shown in the following table:

[0215] Fluorescence detection reaction solution

[0216]

[0217] The fluorescence detection reaction solution was added to two 96-well detection plates, with 20 μL of fluorescence detection reaction solution added to each well.

[0218] The sgRNA loaded in plate A is the sequence shown in SEQ NO 383-476, and each well is loaded with 30 μL of sgRNA with a concentration of 0.034 μM.

[0219] The Mycobacterium avium complex group corresponds to two sgRNAs, the sequences of which are shown in SEQ ID NO.415 and SEQ ID NO.416, and are loaded into the same well. The Aspergillus flavus corresponds to two sgRNAs, the sequences of which are shown in SEQ ID NO.431 and SEQ ID NO.432, and are loaded into the same well.

[0220] There are two sgRNAs corresponding to Candida albicans, with sequences shown in SEQ ID NO.434 and SEQ ID NO.435, which are loaded into the same well.

[0221] Plate A also has 5 wells, which are filled with blank control, sgRNA of the first internal standard target 1 (SEQ NO 570), sg7RNA of the first internal standard target 2 (SEQ NO 571), sgRNA of the second internal standard (SEQ NO 572), and sgRNA of the third internal standard (SEQ NO 573).

[0222] Plate B is filled with sgRNAs of sequences shown in SEQ NOs 477 to 569, with 30 μL of sgRNA in each well at a concentration of 0.034 μM.

[0223] The pathogens corresponding to the sgRNA in plate B do not include RNA pathogens, so there is no need to set a second target.

[0224] Plate B also has 3 wells, which are filled with blank control, sgRNA of the first internal standard target 3 (SEQ NO 574), and sgRNA of the third internal standard (SEQ NO 575).

[0225] The blank control wells were filled with 30 μL of water without sgRNA.

[0226] The sgRNAs for the first internal standard, the second internal standard, and the third internal standard are as follows

[0227]

[0228] The above detection system was distributed onto two pre-filled detection plates provided in the reagent U kit, incubated at 42°C for 30 min, and the fluorescence value was detected.

[0229] (4) Result analysis and data processing

[0230] ① Sort the values ​​of pathogen targets in plate A from small to large, take the first 60 values, and calculate the average value to get NC-av1. 7000 / NC-av1 = normalization factor 1. Multiply the data of all wells by the normalization factor 1 to get the normalized data (take the integer).

[0231] ② Sort the values ​​of pathogen targets in plate B from small to large, take the first 60 values, and calculate the average value to get NC-av1. 7000 / NC-av2 = normalization factor 2. Multiply the data of all wells by the normalization factor 2 to get the normalized data (rounded to an integer).

[0232] ③ If the fluorescence value is greater than 14000, it is judged as positive, 13000<fluorescence value≤14000 is judged as gray area, and the fluorescence value is less than 13000 is judged as negative.

[0233] ④ Verify the reliability of the test: The fluorescence values ​​of the first internal standard 1, the first internal standard 2, the second internal standard, and the third internal standard of plate A after standardization are >14000, and the blank control is negative. The fluorescence values ​​of the first internal standard 3 and the third internal standard of plate B after standardization are >14000, and the blank control is negative.

[0234] Specific test results such as Figure 7 As shown in the figure, almost all probes can specifically recognize their corresponding target DNA, which indicates that the kit has good specificity overall. At the same time, it was observed that intracellular mycobacterium DNA can be detected by the probe of the Mycobacterium avium complex, and chelonae DNA can be detected by the probe of Mycobacterium abscessus. Since intracellular mycobacterium and the Mycobacterium avium complex usually appear in the form of avian-intracellular mycobacterium complex, and Mycobacterium chelonae and Mycobacterium abscessus usually appear in the form of the Mycobacterium chelonae complex, the specificity is not affected.

[0235] Example 7 Sensitivity test of Mycobacterium tuberculosis positive samples

[0236] Experimental method: After gradient dilution of the Mycobacterium tuberculosis positive sample provided by Hangzhou Jieyi Biotechnology Co., Ltd., a sensitivity test was performed. The reagents used included the kit of the present invention and fluorescence quantitative detection.

[0237] (1) Sample selection and concentration setting

[0238] Tuberculosis positive samples were treated with 10 6 The CFU / mL human cells were diluted in a 10-fold gradient to obtain samples to be tested with dilutions of S1, S2, S3, S4, S5, and S6, respectively.

[0239] (2) Pretreatment and nucleic acid extraction

[0240] 200 μL of the sample to be tested was taken and added with 1000 μL of PBS into a 2 mL shaking tube for homogenization. After homogenization, 20 μL of the first internal standard diluted 100 times (the original solution of the first internal standard was 5 pg / μL, and the diluted solution was 50 fg / μL), 20 μL of the original solution of the second internal standard (10 6 copies / mL) were co-extracted using an extraction kit (MD049P) provided by Hangzhou Jieyi Biotechnology Co., Ltd. The obtained nucleic acid was set aside.

[0241] (3) Multiplex nucleic acid amplification

[0242] Multiplex PCR amplification was performed according to step (2) of Example 6.

[0243] (4) Fluorescence detection

[0244] The sgRNAs are SEQ ID NO.409 and SEQ ID NO.410, respectively, which are loaded into two wells for detection. For specific steps, refer to step (3) of Example 4.

[0245] (5) Fluorescence quantitative detection

[0246] Simultaneously perform fluorescence quantitative detection. The kit used was provided by Hangzhou Jieyi Biotechnology Co., Ltd. (MD044T), and the operation was performed strictly in accordance with the instructions.

[0247] (6) Results Analysis

[0248] Mycobacterium tuberculosis has two targets, and both targets must be higher than 14,000 to be positive. Figure 8 As shown, the negative control result is negative; higher than 14000 is positive, therefore, the detection sensitivity of Mycobacterium tuberculosis is about Ct=35.

[0249] Example 8 Sensitivity test of novel coronavirus positive samples

[0250] Experimental method: The novel coronavirus positive samples provided by Hangzhou Jieyi Biotechnology Co., Ltd. were gradiently diluted and subjected to sensitivity testing. The reagents used included the kit of the present invention and fluorescence quantitative detection.

[0251] (1) Sample selection and concentration setting

[0252] Use 10 6 CFU / mL human cells diluted the novel coronavirus positive samples and obtained dilutions of d1, d10, and d10 respectively. 2 , d10 3 , d10 4 , d10 5 samples to be tested.

[0253] (2) Pretreatment and nucleic acid extraction

[0254] 200 μL of sample was taken and 1000 μL of PBS was added to a 2 mL shaking tube for homogenization. After homogenization, 20 μL of the first internal standard diluted 100 times (the original solution of the first internal standard was 5 pg / μL, and the diluted solution was 50 fg / μL), 20 μL of the original solution of the second internal standard (10 6 copies / mL) were co-extracted using an extraction kit (MD049P) provided by Hangzhou Jieyi Biotechnology Co., Ltd. The obtained nucleic acid was set aside.

[0255] (3) Multiplex nucleic acid amplification

[0256] Refer to step (2) of Reference Example 6 for details.

[0257] (4) Fluorescence detection

[0258] The sgRNA sequence is SEQ ID NO.465, refer to step (3) of Example 4.

[0259] (5) Fluorescence quantitative detection

[0260] Simultaneously perform fluorescence quantitative detection. The kit used was provided by Hangzhou Jieyi Biotechnology Co., Ltd. (MD028) and the operation was performed strictly according to the instructions.

[0261] (6) Results Analysis

[0262] like Fig. 9 As shown, the negative control result is negative; higher than 14000 is positive, so the detection sensitivity of the new coronavirus is about Ct=35. Example 9 Detection of clinical samples by the kit of the present invention

[0263] (1) Preparation of sample nucleic acid:

[0264] Clinical samples, including sputum, bronchoalveolar lavage fluid, throat swabs, and pleural effusion, samples from 20 positive patients, numbered RFP1, RFP2, RFP3, RFP4, RFP5, RFP6, RFP7, RFP8, RFP9, RFP10, RFP11, RFP12, RFP13, RFP14, RFP15, RFP16, RFP17, RFP18, RFP19, and RFP20; and 8 negative samples, numbered RFN1, RFN2, RFN3, RFN4, RFN5, RFN6, RFN7, and RFN8, were used as nucleic acid samples for detection.

[0265] 200 μL of the sample to be tested was taken and 1000 μL of PBS was added to a 2 mL shaking tube for homogenization. After homogenization, 20 μL of the first internal standard diluted 100 times (the original solution of the first internal standard was 5 pg / μL, and the diluted solution was 50 fg / μL), 20 μL of the original solution of the second internal standard (10 6 copies / mL) were co-extracted using an extraction kit (MD049P) provided by Hangzhou Jieyi Biotechnology Co., Ltd. The obtained nucleic acid was set aside.

[0266] (2) The implementation steps of amplification in this example are the same as step (2) of Example 6.

[0267] (3) The implementation steps of fluorescence detection in this embodiment are the same as step (3) of Example 6.

[0268] (4) Data processing

[0269] ① Sort the values ​​of pathogen targets in plate A from small to large, take the first 60 values, and calculate the average value to get NC-av1. 7000 / NC-av1 = normalization coefficient 1. Multiply the data of all wells by the normalization coefficient to get the normalized data (take the integer).

[0270] ② Sort the values ​​of the pathogen targets in plate B from small to large, take the first 60 values, and calculate the average value to get NC-av1. 7000 / NC-av2 = normalization coefficient 2. Multiply the data of all wells by the normalization coefficient to get the normalized data (take the integer).

[0271] ③ If the fluorescence value is greater than 14000, it is judged as positive, 13000<fluorescence value≤14000 is judged as gray area, and the fluorescence value is less than 13000 is judged as negative.

[0272] (5) Results analysis

[0273] The test results are shown in the table below, which illustrate that the test samples of the kit of the present invention are consistent with the diagnostic results confirmed by the clinic.

[0274] Clinical sample test results

[0275]

[0276]

[0277]

Claims

1. A kit for rapid detection of respiratory pathogens by multiplex PCR combined with CRISPR-Cas, characterized in that The kit includes a multiplex amplification primer combination, an sgRNA detection plate loaded with sgRNA, a DNA polymerase, an RNA reverse transcriptase, a CRISPR / Cas protein, and a fluorescent reporter probe; The multiple amplification primer combination is the sequence shown in SEQ NO 1 to 374; The sgRNA detection plate is an array microwell plate, and each detection well is filled with one of the sgRNAs shown in SEQ NOs 383 to 569.

2. The kit according to claim 1, characterized in that Respiratory pathogens are one or more of the following 178 respiratory pathogens: Escherichia coli, Acinetobacter baumannii, Haemophilus influenzae, Corynebacterium striata, Proteus mirabilis, Enterobacter cloacae, Staphylococcus aureus, Enterococcus faecium, Enterococcus faecalis, Streptococcus pneumoniae, Serratia marcescens, Klebsiella pneumoniae, Klebsiella aerogenes, Pseudomonas aeruginosa, Stenotrophomonas maltophilia, Burkholderia cepacia, Moraxella catarrhalis, Trophicola whipplei, Legionella pneumophila, Nocardia anguillarum, Bordetella pertussis, Streptococcus parasanguinis, Nocardia braziliensis, Nocardia caviae, Nocardia asteroides, Streptococcus pyogenes, Mycobacterium tuberculosis, Mycobacterium abscessus, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium chelonae, Mycobacterium avium complex, Mycoplasma pneumoniae, Chlamydia pneumoniae, Chlamydia psittaci, Rickettsia japonicum, Mycoplasma hominis, Legionella Jordan, Legionella Cincinnati, Legionella Oak Ridge, Legionella worcesteria, Pneumocystis jiroveci, Cryptococcus neoformans, Aspergillus terreus, Aspergillus fumigatus, Aspergillus flavus, Candida tropicalis, Candida albicans, Candida glabrata, Candida parapsilosis, Rhizomucor microsporus, Rhizopus oryzae, Talaromyces marneffei, Scedosporium apiospermum, Aspergillus niger, Rhizopus microsporus, Cunninghamella griseus, Legionella warcesteriae, Herpesvirus 1, Herpesvirus 3, Herpesvirus 4, Herpesvirus 5, Herpesvirus 6, Herpesvirus 7, Human Bocavirus 1, Adenovirus B, Adenovirus C, Adenovirus E, Influenza A, Influenza B, Parainfluenza 1, Parainfluenza 3, Parainfluenza 4, Coronavirus OC43, Coronavirus 229E, Coronavirus Virus NL63, coronavirus HKU1, 2019 novel coronavirus, human metapneumovirus, rhinovirus A, rhinovirus B, rhinovirus C, enterovirus group A, enterovirus group B, enterovirus group C, enterovirus group D, respiratory syncytial virus A, respiratory syncytial virus B, Klebsiella oxytoca, hospital acinetobacter, Streptococcus agalactiae, Streptococcus gastricis, human bocavirus type 2, human bocavirus type 3, human bocavirus type 4, primate erythroparvovirus 1, human polyomavirus type 1, human polyomavirus type 2, human polyomavirus type 3, human polyomavirus type 4, human polyomavirus type 5, Legionella tucsonensis, Bordetella parapertussis, Bartonella henselae, Treponema pallidum, Bacteroides fragilis, Corynebacterium pseudotuberculosis, Corynebacterium diphtheriae, Dalirius pulmonary Sterling, Veillonella parvum, Citrobacter kremeri, Bacillus cereus group, Streptococcus gordonii, Rhodococcus equi, Streptococcus pseudopneumoniae, Staphylococcus hemolyticus, Anopheles elizabethii, Burkholderia cinerea, Fusobacterium necroticum, Leptospira interrogans, Streptococcus sanguinis, Bordetella bronchiseptica, Candida duro, Candida auris, Candida pseudoglabrata, Candida pseudoglabrata, Fusarium fujikura, Fusarium graminearum, Absidia scrofa, Candida intermedia, Aspergillus tubingensis, Aspergillus versicolor, Mucor circinelloides, Chlamydia abortus, Candida krusei, Chlamydia trachomatis, Ureaplasma urealyticum, Coxiella burnetii, Legionella St. Helens, Legionella Marseilles, Legionella anise, Legionella fischeri, Legionella beriardi, Nocardia new Scots, Nocardia takeda,Nocardia microwhite, Nocardia amberjack, Nocardia southafrica, Klebsiella millei, Steinerella forsythe, Lazy cunning bacteria, Elizabeth millei, Morganella morganii, Klebsiella pneumoniae, Defective bacteria, Leuconostoc lactis, Nocardia oysteris, Histoplasma capsulatum, Mycobacterium smegmatis, Mycobacterium gordonii, Mycobacterium marinum, Nocardia mexicanum, Mycobacterium fortuitum, Legionella paris, Legionella harvey, Legionella marie, Legionella longbeach, Nocardia gelsenkirchen, Nocardia waldenii, Nocardia asiatica, Nocardia abscessus, Terpene Nocardia, Oligophagous Nocardia, Nocardia africa, Nocardia brucei, Nocardia beijingensis, Nocardia concave colony, New golden mycobacterium.

3. The kit according to claim 1, characterized in that The CRISPR / Cas protein is Cas12a protein.

4. The kit as claimed in claim 2, characterized in that The respiratory pathogens and the corresponding sgRNAs for detecting the target sequences of the pathogens are shown in the following table:

5. The kit according to claim 1, characterized in that The fluorescent reporter probe is a single-stranded DNA, the 5' end of which is labeled with a fluorescent group and the 3' end of which is labeled with a quenching group; The single-stranded DNA can be recognized and cut by CRISPR / Cas protein.

6. The kit according to claim 1, characterized in that The kit includes a multiplex amplification system and a detection system. The multiplex amplification system includes a multiplex amplification primer combination, an amplification enzyme, and an amplification buffer; the amplification enzyme includes a DNA polymerase and an RNA reverse transcriptase; The detection system includes an sgRNA detection plate filled with sgRNA, CRISPR / Cas protein, and a detection solution, wherein the detection solution includes a detection buffer and a fluorescent reporter probe.

7. The kit according to claim 1, characterized in that The kit includes an internal standard and a negative control; The negative control was 10 2 ~10 6 CFU / mL human cells; The internal standards include a first internal standard, a second internal standard, and a third internal standard; The first internal standard is a 1-10 pg / μL artificial synthetic DNA fragment, which serves as a blank DNA internal standard; The second internal standard is a 10 2 ~10 6 copies / mL blank RNA pseudovirus, used as blank RNA internal standard; The third internal standard is 0.1-100 ng / μL human EGFR fragment, which serves as an internal standard for CRISPR-Cas detection.

8. A method for high-throughput detection of respiratory pathogens using a kit for rapid detection of respiratory pathogens using multiplex PCR combined with CRISPR-Cas according to any one of claims 1 to 7, characterized in that The method comprises the following steps: (1) extracting nucleic acid from the sample to be tested as a template; (2) using the extracted nucleic acid as a template, adding a multiple amplification primer combination, an amplification enzyme, and an amplification buffer to prepare a multiple PCR reaction system, performing multiple PCR amplification, and obtaining an amplification product; (3) The amplified product, CRISPR / Cas protein, and detection solution are added to the sgRNA detection plate. Each detection well is filled with sgRNA corresponding to a different pathogen. Each detection well is prepared with the same CRISPR-Cas fluorescence detection reaction system. The reaction is protected from light. The fluorescence signal is detected using a fluorescence detector. If the fluorescence signal value is above 14,000, the detection well is determined to be positive for the pathogen.

9. The method according to claim 8, characterized in that The reaction conditions of step (3) are: reaction at 37-42° C. for 20-30 min in a light-proof condition.

10. The method according to claim 8, characterized in that In the step (2), each detection well of the detection plate is respectively filled with the sequences shown in SEQ ID NOs 383 to 569, wherein the Mycobacterium avium complex amplifies two target sequences, and two sgRNAs complementary thereto, whose sequences are shown in SEQ ID NO.415 and SEQ ID NO.416, are loaded in the same detection well; Aspergillus flavus amplified two target sequences, and two sgRNAs complementary thereto, the sequences of which were shown in SEQ ID NO.431 and SEQ ID NO.432, were loaded into the same detection well; Two target sequences of Candida albicans were amplified, and two sgRNAs complementary thereto, with sequences shown in SEQ ID NO.434 and SEQ ID NO.435, were loaded into the same detection well; The sgRNAs of the two targets of Mycobacterium tuberculosis are SEQ ID NO.409 and SEQ ID NO.410, respectively, and are loaded into two detection wells; it is required that both detection wells loaded with sgRNAs of the sequences shown in SEQ ID NO.409 and SEQ ID NO.410 are positive, and Mycobacterium tuberculosis is determined to be positive; if any well is negative, it cannot be determined to be Mycobacterium tuberculosis positive; The sgRNAs of the two targets of Cryptococcus neoformans are SEQ ID NO.427 and SEQ ID NO.428, respectively, which are loaded in two detection wells; it is required that both detection wells loaded with sgRNAs of the sequences shown in SEQ ID NO.427 and SEQ ID NO.428 are positive, and Cryptococcus neoformans is judged to be positive; any well is negative, and it cannot be judged to be positive for Cryptococcus neoformans; Each detection plate is provided with a blank control detection hole, a first internal standard detection hole, a second internal standard detection hole and a third internal standard detection hole.

Images