Specific DNA sequence for non-destructive identification of genetic sex of escargots in China and identification method

Abstract

The invention discloses a specific DNA (deoxyribonucleic acid) sequence for non-destructive identification of genetic sex of escargots in China and an identification method, female and male individuals of escargots in China are sequenced, assembled and compared by adopting a PacBio platform CCS (Circle Consensus Sequencing) technology, male and female specific fragments are screened, a specific fragment SEQ ID NO: 1 is obtained according to the difference of the male and female specific fragments, and a primer is designed based on the specific fragment. The genome DNA of the field snail is extracted, the primer pair is used for amplifying in a field snail individual, and the amplification result is subjected to electrophoresis detection, so that the genetic sex can be identified. According to the invention, the problem of deficiency of the sex specific marker of the field snail is solved, and efficient and accurate non-destructive identification of the genetic sex is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of aquatic organisms, and particularly relates to a specific DNA sequence and an identification method for non-destructive identification of the genetic sex of Chinese round pond snails. Background Art

[0002] Chinese round field snail (Cipangopaludina chinensis) belongs to the phylum Mollusca, class Gastropoda, order Mesogastropoda, family Viviparidae, genus Cipangopahudina. Chinese round field snails are mainly distributed in my country, South Korea, Japan, Southeast Asia and other regions. In nature, they are widely distributed in rice fields, lakes, swamps, rivers, streams, etc., showing strong environmental adaptability. As a benthic invertebrate, it plays an important role in the ecosystem and is often used as an environmental indicator species. In terms of edible value, Chinese round field snails have delicious meat, rich in high-quality protein, a variety of trace elements and amino acids required by the human body. They are nutritious and easy to digest and absorb, and are widely loved by market consumers. Especially in the southern region, it and the genus Cipango are used as the main ingredients of snail noodles. For example, the entire industry chain of snail noodles in Liuzhou, Guangxi has exceeded 50 billion yuan in 2022. In addition, Chinese round field snails are also high-quality protein feed for the breeding of economic aquatic species such as shrimps, crabs, leeches, turtles and tortoises.

[0003] With the invasion of foreign freshwater snails, they occupy the ecological niche of river snails and pose a serious threat to native snails such as Chinese round river snails. In addition, due to the dual influence of large-scale fishing in the wild and environmental deterioration in some areas, the germplasm resources of Chinese round river snails are constantly decreasing. In recent years, Hubei, Jiangxi, Jiangsu, Guangxi, Shandong and other places have begun to try to implement artificial breeding and have achieved good economic benefits, but the industry faces many problems. The seedlings required for river snail breeding mainly rely on self-breeding or directly catching wild groups from the natural environment. This traditional acquisition method is not only inefficient and difficult to meet the needs of large-scale breeding, but also easily leads to the degradation and mixing of germplasm resources. At present, most of the germplasm resources of Chinese round river snails are still in a wild or semi-wild state. The lack of systematic selection and protection makes it difficult to effectively preserve and utilize its genetic diversity and excellent traits, hindering the healthy development of the river snail breeding industry.

[0004] Chinese round field snails are dioecious and ovoviviparous. Males are larger than females and grow faster than females, showing sexual dimorphism. Their reproductive characteristics are quite unique. The antennae of female snails are symmetrical, while those of male snails gradually become thicker and curled during development, eventually forming a unique copulatory structure. The end of the copulatory structure is the genital pore, which is the outlet for sperm release, ensuring the smooth progress of the reproduction process. At present, the identification of the sex of Chinese round field snails is mainly based on the antennae during the development or maturity of the gonads or the development of the testes in the middle and tail of the field snails by illuminating them with a strong light. However, in the undifferentiated or early differentiated stage of sex, the male and female characteristics of Chinese round field snails are often not obvious. The field snails at this stage may be in a critical period of sex determination, but have not yet formed stable sex characteristics. At present, sex identification at this stage is particularly difficult and prone to misjudgment.

[0005] Therefore, in order to promote the sustainable development of China's round field snail farming industry, it is urgent to strengthen the research on the biological characteristics and sex differentiation mechanism of field snails. The primary issue of genetic breeding is to accurately identify the sex of Chinese round field snails at different developmental stages. With the development of molecular biology, molecular-assisted marker technology can identify sex based on specific differences in DNA sequences. Compared with traditional morphological observation methods, it has higher accuracy and reliability and has been widely used in the field of sex identification. The development of molecular-assisted markers is of great significance to the study of sex differentiation of Chinese round field snails, which helps to improve the accuracy and efficiency of sex identification, promote the development of sex control technology, and thus promote the sustainable development of China's round field snail farming industry. Summary of the invention

[0006] In view of the problems existing in the prior art, the present invention provides a specific DNA sequence and an identification method for non-destructive identification of the genetic sex of Chinese round field snails.

[0007] In order to achieve the above object, the present invention adopts the following technical solution: A specific DNA sequence for genetic sex identification of Chinese round pond snails, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0008] A method for identifying the genetic sex of Chinese round pond snails is achieved by identifying the above-mentioned specific DNA sequence.

[0009] The above method for identifying the genetic sex of Chinese round field snails comprises the following steps: (1) Collect antennae tissue of Chinese round pond snails and extract genomic DNA of Chinese round pond snails; (2) performing PCR amplification using genomic DNA as a template; the upstream primer of the PCR amplification is shown in SEQ ID NO:2, and the downstream primer is shown in SEQ ID NO:3; (3) The amplified products were tested by 1% agarose gel electrophoresis. The strains with specific amplified bands were males, while the strains without specific amplified bands were females.

[0010] Furthermore, the PCR amplification program is: 94°C pre-denaturation for 3 minutes, 94°C denaturation for 30 seconds, 56°C annealing for 30 seconds, 72°C extension for 1 minute, 34 cycles, 72°C extension for 10 minutes, and 4°C storage.

[0011] Furthermore, the reaction system of the PCR amplification is: 10 μL of 2× Tap Master Mix, 1 μL of each 10 μM upstream and downstream primers, 1 μL of 50 ng / μL DNA template, and 7 μL of ultrapure water.

[0012] A primer pair for genetic sex identification of Chinese round pond snails, wherein the upstream primer of the primer pair is shown as SEQ ID NO:2, and the downstream primer is shown as SEQ ID NO:3.

[0013] A kit for genetic sex identification of Chinese round pond snails, comprising the primer pair according to claim 6.

[0014] The beneficial effects of the present invention are: (1) The present invention only requires a small amount of DNA from the antennae of the Chinese round pond snail, and conventional PCR amplification is required for sex identification. The accuracy of sex identification of the Chinese round pond snail using specific molecular markers is 100%.

[0015] (2) The identification method provided by the present invention can also accurately identify Chinese round field snails with smaller sizes and less obvious external features. Early sex identification of Chinese round field snail seedlings can help breeders understand the sex ratio of the snail population earlier, so that they can take corresponding management measures to increase breeding yields, thereby improving the market value and competitiveness of the products. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 : The present invention is used for the method flow chart of sex identification of Chinese round pond snails.

[0017] Figure 2 : The electrophoresis result diagram of sex identification of Chinese round field snails provided in Example 2; wherein the first and last columns are DL2000 markers, 205X-219X are female individual numbers, and 201Y-222Y are male individual numbers.

[0018] Figure 3 : The electrophoresis result diagram of sex identification of round field snails in China provided in Example 3; wherein the first column is DL2000 marker, M1-M9 is the male individual number, and F1-F14 is the female individual number. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0020] The materials involved in the following embodiments are as follows: FastPure Cell / Tissue DNA Isolation Mini Kit was purchased from Vazyme, catalog number DC102-01; DL2000 marker was purchased from Biosharp, catalog number BL102A; The PacBio platform CCS (Circular Consensus Sequencing) technology was used to sequence the male and female individuals of Chinese round field snails and screen the male and female specific fragments; the male genome was sequenced based on the male and female specific fragments to obtain a 948bp specific fragment SEQ ID NO: 1". The specific steps and analysis process are as follows: The HiFi data of male and female Chinese round field snails were obtained using the CCS sequencing mode, and the HiFi data were assembled using the default parameters of Hifiasm. By constructing a Hi-C library and performing on-machine sequencing, the raw data were quality controlled using HTQC (v1.92.310) software to obtain clean data. The clean data obtained by quality control Data was aligned using BWA (v0.7.17), and 3D-DNA (180419) software was used to remove single-end aligned reads and sequences outside 500bp from the restriction site. The obtained data were used to construct chromosomes; contigs or scaffolds were clustered, sorted, and oriented to obtain chromosome-level genomes. Juicer was used to construct interaction maps, and JucieBox (1.4.3.2) was used to visualize and correct them, thereby obtaining the correct specific sequence.

[0021] The nucleotide sequence of the specific DNA fragment is as follows: GGGGAGGGGAGATCTAGCAATACTAAAAACTTGTTACTTTATGACCAACATTTCATGAGCCTCAGAATAATTAAAGCTGTCAAAACATTGAGACTCCCCTTGACATTACCAGGCAAGGTGAGAATATTTTTAATCTGATGACAATTATTTGGATCTAACTTTCATTTTGACCCAAATGTAAATTATTATTAAGATCAAATGCTAATTTTTATTAAGTATGAATCATTGAGATAAAATTAATAACACAGTAATAAAATTCACAGACTTTTTTTTATACTTAATCATTATATAATTTTTGTGTGCAGAGAGACATAGACCAATAAGTGAATGCAAAGTACATTCTTGCCTTGATTGCAGACGCTCTGTAGAATTAAGGGTTTCACACCCAAGTTCTGTAATGCCACGCTAGATTTAGTTATGGAAATATTCATACGAGAAAAATACAATAGTTTATATAAAAAATTTTAAATGGAACGACTAACCAACCATTTGAAAGCAATCACTCATACAGAAACTAGAATACATGCTAAGACAGCTGTCCAGTCACTAAGACACTTAGCTGTCCAGTCCTGTGCATGCTAAGGCACTTAGCTGTCCAGCCACTAAGACACTTAGCTGTCCAGTCCTGTGCAAGCTAAGACACTAAGCTGTCCAGTCCTGTGCATGCTAAGACACTAAGCTGTCCAGTCCTGTGCATGCTAAGACACTTAGCTGTCCAGTTCTCTGCATGCTAAGACACTTAGCTGTCCAGTCACTAAGACACTTAGCTGTCCAGTCCTGTGCATGCTAAGACACTTAGCTGTCCAGTCACTAAGACACTTAACTGTCCAGTCCTGTGCATGCTAAGACAGCTGTCCAGTCACTAAGACACTTAGTTGTCCAGTCCTGTATATGCTAAAACACTTAGCTGTCCAGTCACTAAGACACTTAGCTGTCCAGTCATGTGCA (SEQ ID NO: 1), a total of 948 bp. The flow chart of the method for identifying the sex of Cipangopaludina chinensis in the present invention is as shown in Figure 1shown.

[0022] Example 1 DNA extraction (1) Sample collection: According to physiological characteristics, 7 female individuals and 7 male individuals were selected from a population of mature, sex-differentiated Chinese round field snails (200 individuals). The population came from Jiangsu, Zhejiang, Jiangxi, Shandong, Hubei, Guangxi, Shanxi, Shaanxi and other places. The antennae of female snails were symmetrical, and the right antennae of male snails were bent inward to the right. The antennae of Chinese round field snails were sampled as follows: the snails were washed and each snail was placed separately in a wide-mouthed plastic box containing sterile water. After the Chinese round field snails extended their antennae, the left or right antennae of the snail were quickly cut off with scissors (damage to the antennae had no effect on the growth and development of the snail). Tissue samples of male and female individuals were collected and stored in anhydrous ethanol. Females were recorded as Female and males as Male.

[0023] (2) Genomic DNA extraction S1: Take 100 mg of antennae tissue of Chinese round field snails, rinse the anhydrous ethanol on the surface of the tissue with ultrapure water, and after fully chopping, take 20 mg of antennae tissue and put it into a 1.5 mL centrifuge tube. Use the FastPure Cell / Tissue DNA Isolation Mini Kit to extract DNA. First, add 20 μL of proteinase K and 230 μL of Buffer GA to the centrifuge tube, vortex to mix, and digest in a 55°C water bath for 1 h to obtain the digestion solution; S2: Add 10 μL RNase Solution to the digestion solution, mix thoroughly, place at room temperature for 30 min, centrifuge at 12000 rpm for 3 min, collect the supernatant, transfer to another new centrifuge tube, add 250 μL Buffer GB, vortex mix at 2000 rpm for 20 sec, and place in a 70°C water bath for 10 min; S3: Add 180 μL of anhydrous ethanol, vortex mix at 2000 rpm for 15 seconds, transfer to the adsorption column, and centrifuge at 12000 rpm for 1 minute; S4: discard the filtrate, add 500 μL Washing Buffer A to the adsorption column, and centrifuge at 12000 rpm for 1 min; S5: discard the filtrate, add 500 μL Washing Buffer B to the adsorption column, and centrifuge at 12000 rpm for 1 min; S6: discard the filtrate, place the adsorption column in a collection tube, and centrifuge the empty tube at 12000 rpm for 1 min; S7: Discard the filtrate, place the adsorption column in a new 1.5 mL centrifuge tube, add 30 μL of Elution Buffer preheated to 70°C to the center of the membrane of the adsorption column, place at room temperature for 3 minutes, and centrifuge the empty tube at 12000 rpm for 1 minute; S8: Discard the adsorption column, perform electrophoresis on the collected DNA using 1% agarose gel, and store it at -20°C for future use.

[0024] Example 2 Identification of the genetic sex of Chinese round pond snails Specific primer pairs designed according to SEQ ID NO: 1 sequence: Upstream primer (Male-F): GGGGAGGGGAGATCTAGCAATA (SEQ ID NO: 2); Downstream primer (Male-R): TGCACATGACTGGACAGCTAAG (SEQ ID NO: 3); 20 μL PCR reaction system: 2× Tap Master Mix 10 μL, 1 μL of 10 μM upstream and downstream primers, 1 μL of 50 ng / μL DNA template, 7 μL ultrapure water; PCR reaction program: 94℃ pre-denaturation for 3min, 94℃ denaturation for 30sec, 56℃ annealing for 30sec, 72℃ extension for 1min; 34 cycles, 72℃ extension for 10min, and storage at 4℃. Take 5 μL of PCR amplification product, load it on 1% agarose gel, load DL2000 marker on the left and right sides, 120V voltage, electrophoresis for 30min, turn off the power, and then analyze the electrophoresis results using a gel imaging system.

[0025] Identification of genetic sex: The individuals with the detected specific bands are male Chinese round pond snails, and the individuals without the amplified specific bands are female Chinese round pond snails. Figure 2 As shown in the figure (among which 205X-219X are female individuals and 201Y-222Y are male individuals), the male-specific band of 750 bp was amplified from individuals 201Y-222Y and they were determined to be males; no specific band was amplified from individuals 205X-219X and they were all female individuals.

[0026] Example 3 Identification of the genetic sex of Chinese round pond snail seedlings (1) Sample collection: 23 seedlings of Chinese round field snails that had just developed gonads were randomly selected from a population of 200 Chinese round field snails from Jiangsu, Zhejiang, Jiangxi, Shandong, Hubei, Guangxi, Shanxi, Shaanxi and other places. The antennae of Chinese round field snails were sampled as follows: the snails were cleaned and each snail was placed individually in a wide-mouthed plastic box containing sterile water. After the Chinese round field snails extended their antennae, the left or right antennae of the snail were quickly cut off with scissors (damage to the antennae had no effect on the growth and development of the snails). Tissue samples of male and female individuals were collected and stored in anhydrous ethanol and numbered 1-23.

[0027] (2) Genomic DNA extraction: The DNA extraction process is the same as in Example 1.

[0028] (3) Gender identification: 20 μL PCR reaction system: 2× Tap Master Mix 10 μL, 1 μL each of 10 μM upstream and downstream primers (SEQ ID NO: 2~3), 1 μL of 50 ng / μL DNA template, 7 μL ultrapure water; PCR reaction program: 94℃ pre-denaturation for 3min, 34 cycles, 94℃ denaturation for 30sec, 56℃ annealing for 30sec, 72℃ extension for 1min; 72℃ extension for 10min, storage at 4℃. Take 5 μL of PCR amplification product, load it on 1% agarose gel, load DL2000 marker on the far left, 120V voltage, electrophoresis for 30 min, turn off the power, and then analyze the electrophoresis results with a gel imaging system.

[0029] Identification of genetic sex: The individuals with the detected specific bands are male Chinese round pond snails, and the individuals without the amplified specific bands are female Chinese round pond snails. Figure 3 As shown (F1-F14 are female individuals and M1-M9 are male individuals), a male-specific band of 750 bp in length was amplified from M1-M9 individuals, and they were determined to be males; no specific band was amplified from F1-F14 individuals, and they were all female individuals.

[0030] After observation of the gonadal tissue of the above samples, the above identification results are completely correct.

[0031] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A specific DNA sequence for genetic sex identification of Chinese round field snails, characterized in that: The nucleotide sequence of the DNA sequence is shown in SEQ ID NO:

1.

2. A method for identifying the genetic sex of Chinese round field snails, characterized in that: This is achieved by identifying the specific DNA sequence as described in claim 1.

3. The identification method according to claim 2, characterized in that: The following steps are involved: (1) Collect antennae tissue of Chinese round pond snails and extract genomic DNA of Chinese round pond snails; (2) performing PCR amplification using genomic DNA as a template; the upstream primer of the PCR amplification is shown in SEQ ID NO:2, and the downstream primer is shown in SEQ ID NO:3; (3) The amplified products were tested by 1% agarose gel electrophoresis. The strains with specific amplified bands were males, while the strains without specific amplified bands were females.

4. The identification method according to claim 3, characterized in that: The PCR amplification procedure was as follows: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 sec, 56°C annealing for 30 sec, 72°C extension for 1 min, 34 cycles; 72°C extension for 10 min, and 4°C storage.

5. The identification method according to claim 3, characterized in that: The reaction system of the PCR amplification is: 2× Tap Master Mix 10μL, 1μL each of 10 μM upstream and downstream primers, 1 μL of 50 ng / μL DNA template, 7μL ultrapure water.

6. A primer pair for genetic sex identification of Chinese round field snails, characterized in that: The upstream primer of the primer pair is shown as SEQ ID NO:2, and the downstream primer is shown as SEQ ID NO:

3.

7. A kit for genetic sex identification of Chinese round field snails, characterized in that: The kit comprises the primer pair according to claim 6.

Images