Yarrowia lipolytica recombinant bacterium for producing retinol palmitate as well as construction method and application of Yarrowia lipolytica recombinant bacterium

Abstract

The invention discloses yarrowia lipolytica recombinant bacteria for producing retinol palmitate as well as a construction method and application of the yarrowia lipolytica recombinant bacteria. The recombinant bacterium comprises a synthetic route of retinol palmitate, a mevalonic acid route and key genes for simultaneously strengthening a synthetic route of yarrowia lipolytica exogenous carotenoid, and further introduces the mevalonic acid route positioned to peroxisome. The yield of the retinol palmitate reaches 5g / L.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and fermentation engineering, and specifically relates to a recombinant Yarrowia lipolytica bacteria for producing retinol palmitate and a construction method and application thereof. Background Art

[0002] Vitamin A is a diterpenoid compound and a fat-soluble vitamin. It is known as the "beauty vitamin" and "anti-dry eye vitamin" and is widely used in feed, pharmaceutical cosmetics, food and other fields. The biologically active forms of vitamin A are retinol, retinal and retinoic acid, which can be converted into each other in the body. In terms of physiological function, retinol and retinal can maintain normal vision, promote the formation of photosensitive pigments in visual cells, adjust the ability of the eyes to adapt to the intensity of external light, reduce the occurrence of night blindness and vision loss, and help treat a variety of eye diseases (such as dry eyes and conjunctivitis). Retinol also has a similar effect to steroid hormones, promoting the synthesis of glycoproteins, body growth and development, strengthening bones, and maintaining the health of hair, teeth and gums. Retinoic acid can regulate gene expression, weaken the differentiation of epithelial cells into scaly cells, increase the number of epithelial growth factors, and maintain the integrity and soundness of the epithelium. Vitamin A also has a certain antioxidant effect and can remove some harmful free radicals. In the human body, vitamin A is stored in the liver in the form of palmitate, linoleate or oleate.

[0003] Vitamin A can be extracted from animal tissues, but the process is cumbersome, the extraction rate is low, and the cost is high. Currently, commercial vitamin A is synthesized by chemical methods. The synthesis methods are divided into Roche method and BASF method, both of which use citral as an intermediate. Citral is controlled by international vitamin intermediate suppliers such as BASF and Daiichi Pharmaceutical. The chemical synthesis method has high energy consumption and requires complex purification steps and is prone to produce toxic isomers and a series of pollutants. Microorganisms convert renewable biological resources such as sugars into vitamin A. Mild reaction conditions and strong selectivity enable it to achieve green and clean production, and can get rid of dependence on petroleum resources.

[0004] The biggest bottleneck in the production of vitamin A by microbial fermentation is how to increase the yield to reach industrial levels. Although there are many reports on the use of genetically modified microorganisms to synthesize vitamin A, there are few reports on the modification of Yarrowia lipolytica to produce vitamin A. In addition, the only reports on the production of vitamin A by Yarrowia lipolytica only enhance the gene expression of the metabolic pathway from acetyl CoA to mevalonate to retinol, without considering the full utilization of the huge amount of acetyl CoA produced by lipid β-oxidation in peroxisomes and the instability of retinol, resulting in the inability to break through the yield to meet the requirements of industrial production. Summary of the invention

[0005] The first aspect of the present invention is to provide a nucleic acid molecule to address the defects of the prior art in the carotenoid synthesis pathway for producing retinol palmitate, such as low activity of the rate-limiting enzyme and insufficient supply of acetyl CoA.

[0006] The second aspect of the present invention is to provide an expression system containing the above-mentioned nucleic acid sequence.

[0007] The third aspect of the present invention is to provide a recombinant cell containing the above-mentioned expression system.

[0008] The fourth aspect of the present invention aims to provide the use of the above-mentioned nucleic acid molecules, expression systems, and recombinant cells. The fifth aspect of the present invention aims to provide a method for high production of retinol palmitate.

[0009] The technical solution adopted by the present invention is:

[0010] The first aspect of the present invention provides a nucleic acid molecule comprising:

[0011] (I) genes related to the retinol palmitate synthesis pathway; and

[0012] (II) mevalonate pathway-related genes; and

[0013] (III) Strengthening the key genes of the exogenous carotenoid biosynthesis pathway of Yarrowia lipolytica.

[0014] In some embodiments of the present invention, the mevalonate pathway-related genes include the gene AtoB that catalyzes the condensation of acetyl-CoA to acetoacetyl-CoA, the gene HMGS that catalyzes the condensation of acetoacetyl-CoA and acetyl-CoA to HMG-CoA, and the gene HMGR that catalyzes the reduction of HMG-CoA to mevalonate.

[0015] In some embodiments of the invention, the nucleic acid molecule further comprises a mevalonate pathway localized to the peroxisome.

[0016] In some embodiments of the present invention, the mevalonate pathway-related genes localized to the peroxisome include the gene AtoB that catalyzes the condensation of acetyl-CoA to form acetoacetyl-CoA, the gene HMGS that catalyzes the condensation of acetoacetyl-CoA and acetyl-CoA to form HMG-CoA, and the gene HMGR that catalyzes the reduction of HMG-CoA to mevalonate; wherein the AtoB, HMGS and HMGR genes are respectively connected to the gene sequence encoding the peroxisome localization signal peptide ePTS1 (LGRGRRSKL (SEQ ID NO.80)) to form the AtoBePTS1, HMGSePTS1 and HMGRePTS1 genes; on this basis, the carboxyl termini of the proteins encoded by the AtoB, HMGS and HMGR genes are fused with the peroxisome localization signal peptide ePTS1. Mevalonate pathway genes are overexpressed and localized to peroxisomes, and acetyl-CoA generated by fatty acid degradation is used as a precursor to efficiently synthesize mevalonate and downstream compounds; ePTS1 is an enhanced peroxisome localization signal that can effectively localize proteins to peroxisomes.

[0017] In some embodiments of the present invention, the AtoB is derived from Escherichia coli.

[0018] In some embodiments of the present invention, the AtoB is derived from Escherichia coli BL21 (DE3); but it is not limited thereto, as long as the AtoB is derived from an Escherichia coli strain, similar effects can be achieved.

[0019] In some embodiments of the present invention, the HMGS and HMGR are derived from Yarrowia lipolytica; preferably, they are derived from Yarrowia lipolytica W29.

[0020] In some embodiments of the present invention, the AtoBePTS1 optimized sequence is shown as SEQ ID NO:1, the HMGSePTS1 optimized sequence is shown as SEQ ID NO:2, and the HMGRePTS1 optimized sequence is shown as SEQ ID NO:3.

[0021] In some embodiments of the present invention, the key genes for the enhanced Yarrowia lipolytica exogenous β-carotene synthesis pathway include: gene ERG12 that catalyzes the phosphorylation of mevalonate to mevalonate-5-phosphate, gene ERG8 that catalyzes the generation of mevalonate-5-pyrophosphate from mevalonate-5-phosphate, gene ERG19 that catalyzes the decarboxylation of mevalonate-5-pyrophosphate to generate isoprene pyrophosphate, gene IDI that catalyzes the isomerization of isoprene pyrophosphate to dimethylallyl pyrophosphate, and gene IDD that catalyzes the conversion of isopentenyl pyrophosphate to isopentenyl pyrophosphate. The genes include ERG20, which converts farnesyl pyrophosphate into dimethylallyl pyrophosphate; GGS1, which catalyzes the formation of digeranyl pyrophosphate from the combination of farnesyl pyrophosphate and one molecule of isoprene pyrophosphate; GPS, a multifunctional enzyme gene that directly catalyzes dimethylallyl pyrophosphate to form digeranyl pyrophosphate; CarB, a gene that dehydrogenates exogenous lycopene to form lycopene; and CarRP, a bifunctional gene that catalyzes the formation of lycopene from two molecules of digeranyl pyrophosphate and the cyclization of lycopene to form β-carotene.

[0022] In some embodiments of the present invention, the ERG12, ERG8, ERG19, ERG20 and GGS1 are derived from Yarrowia lipolytica.

[0023] In some embodiments of the present invention, the ERG12, ERG8, ERG19, ERG20 and GGS1 are derived from Yarrowia lipolytica W29.

[0024] In some embodiments of the invention, the GPS is derived from an archaeal sulfur bacterium.

[0025] In some embodiments of the present invention, the CarB and CarRP are derived from Mucor circinelloides.

[0026] In some embodiments of the present invention, the optimized sequence of the CarB gene is shown as SEQ ID NO:4, and the optimized sequence of the CarRP gene is shown as SEQ ID NO:5.

[0027] In some embodiments of the present invention, the genes related to the retinol palmitate synthesis pathway include the β-carotene 15,15'-monooxygenase gene Blh, the retinol binding protein gene CRBP, and the gene LRAT that catalyzes retinol to produce retinol palmitate.

[0028] Preferably, the Blh is derived from the marine bacterium 66A03.

[0029] Preferably, the CRBP and LRAT are derived from the human genome.

[0030] The second aspect of the present invention provides an expression system comprising the nucleic acid molecule described in the first aspect of the present invention.

[0031] In some embodiments of the present invention, the gene of the nucleic acid molecule is disassembled into one or more groups, which are respectively inserted into different expression vectors.

[0032] Preferably, the backbone plasmid of the expression vector includes pUC, pBR322, pACYC, pET, and pSC101.

[0033] Preferably, the pUC includes pUC18 and pUC19.

[0034] In some embodiments of the present invention, in order to ensure that each gene can be efficiently expressed in an expression system or a recombinant cell, a promoter sequence is added upstream of each gene and a terminator sequence is added downstream.

[0035] In some embodiments of the present invention, the selected promoter sequences include, but are not limited to, pTEF, pEXP, pFBA and pGPD.

[0036] In some embodiments of the present invention, the terminator sequence includes but is not limited to: tLIP, tIDI, tXPR2, tCYC1, mig1t.

[0037] The third aspect of the present invention provides a recombinant cell, wherein the recombinant cell comprises the nucleic acid molecule described in the first aspect of the present invention or the expression system described in the second aspect of the present invention.

[0038] In some embodiments of the invention, the nucleic acid molecule is inserted into the genome of the cell.

[0039] Furthermore, the nucleic acid molecule is inserted into the genome of the cell by non-homologous recombination.

[0040] Those skilled in the art will appreciate that the purpose of inserting the gene into the genome of the cell by non-homologous recombination is to obtain more strains that are likely to be stably inherited, and that the purpose of the present invention can also be achieved by simply transforming the above expression system.

[0041] In addition, compared with site-directed insertion, non-homologous recombination has the potential to produce more efficient recombinant cells or recombinant bacteria with multiple insertions.

[0042] In some embodiments of the invention, the cell is a yeast cell.

[0043] In some preferred embodiments of the present invention, the yeast cell is Yarrowia lipolytica.

[0044] In some more preferred embodiments of the present invention, the Yarrowia lipolytica is Yarrowia lipolytica ZTQ5320.

[0045] The fourth aspect of the present invention provides the use of the nucleic acid molecule described in the first aspect, the expression vector described in the second aspect and / or the recombinant cell described in the third aspect in the food, chemical or pharmaceutical fields.

[0046] The present invention also provides the use of the nucleic acid molecule described in the first aspect, the expression vector described in the second aspect and / or the recombinant cell described in the third aspect in the production of retinol palmitate and / or the preparation of products produced by producing retinol palmitate.

[0047] The fourth aspect of the present invention provides a method for producing retinol palmitate, wherein retinol palmitate is obtained by culturing the above-mentioned recombinant cells.

[0048] In some embodiments of the present invention, the method comprises culturing the above-mentioned recombinant cells and then disrupting the cells to extract retinol palmitate.

[0049] Specifically, the method for culturing recombinant cells comprises the following steps:

[0050] Cultivation of primary seed solution;

[0051] Cultivation of secondary seed solution;

[0052] Fermentation tank culture.

[0053] More specifically, the method for culturing recombinant cells comprises the following steps:

[0054] Cultivation of primary seed solution: A single colony of the recombinant bacteria was inoculated into a conical flask containing a liquid culture medium, cultured at 28-32°C and a shaking speed of 180-200 rpm for 24-48 hours to obtain a primary seed solution.

[0055] Cultivation of secondary seed solution: transfer the primary seed solution at a 1%-5% (v / v) inoculation rate to a conical flask containing liquid culture medium, culture at 28-32°C and a shaking speed of 180-200 rpm until OD600 reaches 10 to obtain the secondary seed solution.

[0056] Fermentation tank culture: The secondary seed liquid is transferred to a fermentation tank containing a fermentation medium at an inoculation rate of 8-12% (wt) for fermentation, and the fermentation is carried out under the conditions of a fermentation temperature of 28-32°C, a stirring speed of 300-800rpm, a ventilation volume greater than 2L / min, a pH of 6.5-7.0, and dissolved oxygen of more than 22-28%, and the fermentation is continued with 55-65% glucose stock solution.

[0057] Preferably, the components of the seed culture medium (liquid culture medium) include: 8-12 g / L yeast extract, 15-25 g / L peptone and 50-70 g / L glucose.

[0058] Preferably, the components of the fermentation medium include: 25-35 g / L yeast extract, 50-70 g / L peptone and 80-120 g / L glucose.

[0059] The beneficial effects of the present invention are:

[0060] The present invention provides a nucleic acid molecule comprising a synthetic pathway for retinol palmitate, constructs a mevalonate pathway and simultaneously strengthens the expression of key genes in the synthetic pathway for exogenous carotenoids in Yarrowia lipolytica, and introduces a mevalonate pathway localized to peroxisomes; the present invention also provides an expression vector and a recombinant cell comprising the nucleic acid molecule, and by introducing the pathway into Yarrowia lipolytica, the yield of retinol palmitate is significantly increased, and the yield can reach 5 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 Figure 2 is a synthetic pathway diagram for retinol palmitate.

[0062] Figure 2 This is the p-Z1 plasmid map.

[0063] Figure 3 This is the p-Z2 plasmid map.

[0064] Figure 4 Plasmid map of pZ25B.

[0065] Figure 5 Plasmid map of pZ60.

[0066] Figure 6 Plasmid map of pZ61. DETAILED DESCRIPTION

[0067] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0068] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0069] The starting strain of Yarrowia lipolytica is a patented strain with authorization announcement number CN113151340B, which was deposited in CCTCC-China Center for Type Culture Collection on October 19, 2020; address: Wuhan University, Wuhan, China (Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Postal Code: 430072), the deposit number is CCTCC NO: M2020606, and the classification name is Yarrowia lipolytica ZTQ5320 (Yarrowia lipolytica ZTQ5320).

[0070] The kits used for plasmid extraction and gel recovery were purchased from OMEGA, USA. The plasmids pUC19URA3, pUC19TRP1, pUC19LEU2, pCAS1yl, Y-Cre, reagents used for PCR and Gibson ligation, and Escherichia coli (DH5α) for molecular cloning were all purchased from Nanjing Novozymes Biotechnology Co., Ltd. The operation steps were carried out according to the product instructions, and the gene and primer synthesis were commissioned to Beijing Qingke Biotechnology Co., Ltd.

[0071] Retinyl palmitate extractant: Use DMSO to disrupt cells and acetone to extract the product.

[0072] Fermentation broth treatment: Take 1mL of yeast broth fermented for 7 days and centrifuge at 12000r / min for 10min, aspirate the supernatant with dodecane, pass through the membrane and place in a liquid phase bottle for determination of extracellular products; collect the bacteria after centrifugation, resuspend and centrifuge twice with the same volume of sterile ultrapure water as the fermentation broth, and resuspend the precipitate in 0.7mL DMSO. After incubation at 55℃ for 10min, add an equal volume of acetone 0.7mL, incubate at 50℃ for 15min, and centrifuge at 12000rpm for 5min; transfer the supernatant to a new EP tube.

[0073] HPLC detection of vitamin A production: Agilent ZORBAX EclipseXDB-C18 separation column (5 μm, 250x4.6 mm) was used, the detection temperature was 40°C, the mobile phase was methanol:acetonitrile = 95:5, the flow rate was 1 mL / min, the detection wavelength was 325 nm, and the injection volume was 10 μL.

[0074] Detection of strain growth: Use a UV-visible spectrophotometer to regularly measure the absorbance value of the fermentation liquid.

[0075] The present invention provides a genetically engineered bacterium with high production of retinol palmitate and a construction method thereof. The construction method uses Yarrowia lipolytica as a starting strain, transfers the following exogenous genes into Yarrowia lipolytica, integrates them into the yeast genome, and constructs a genetically engineered bacterium with high production of retinol palmitate;

[0076] The exogenous genes include:

[0077] Key genes for enhancing the biosynthesis of exogenous β-carotene in Yarrowia lipolytica: ERG12 (CP028449.1:2082357-2083706), which catalyzes the phosphorylation of mevalonate to mevalonate-5-phosphate; ERG8 (CP028452.1:748052-746796), which catalyzes the production of mevalonate-5-pyrophosphate; ERG19 (CP028453.1:818770-819933), which catalyzes the decarboxylation of mevalonate-5-pyrophosphate to isoprene pyrophosphate; IDI (CP028453.1:585662-584850), which catalyzes the isomerization of isoprene pyrophosphate to dimethylallyl pyrophosphate; The genes ERG20 (CP028452.1: 673068-672034) that convert pyrophosphate and dimethylallyl pyrophosphate to farnesyl pyrophosphate, GGS1 (CP028451.1: 2085775-2084792) that catalyzes the formation of digeranyl pyrophosphate from farnesyl pyrophosphate, GPS (AAB88971.1) that is a multifunctional enzyme that directly catalyzes digeranyl pyrophosphate to digeranyl pyrophosphate, CarB (AJ238028.1) that catalyzes the dehydrogenation of lycopene to produce lycopene, and CarRP (AJ250827.1) that catalyzes the formation of lycopene from two molecules of digeranyl pyrophosphate and the cyclization of lycopene to produce β-carotene;

[0078] Genes related to the retinol palmitate synthesis pathway: β-carotene 15,15'-monooxygenase gene Blh, retinol binding protein gene CRBP, and phosphatidylcholine retinol acyltransferase gene LRAT;

[0079] The genes related to the mevalonate pathway include: AtoB (CP001509.3:2216470-2217654), which catalyzes the condensation of acetyl-CoA to acetoacetyl-CoA; HMGS (CP028459.1:3780129-3781469), which catalyzes the condensation of acetoacetyl-CoA and acetyl-CoA to HMG-CoA; and HMGR (CP028452.1:571078-572577), which catalyzes the reduction of HMG-CoA to mevalonate.

[0080] The mevalonate pathway-related genes localized to peroxisomes include: acetoacetyl-CoA synthetase gene AtoBePTS1, HMG-CoA synthetase gene HMGSePTS1, and HMG-CoA reductase gene tHMGRePTS1.

[0081] Example 1 Vector Construction

[0082] In this example, a genetically engineered strain of Yarrowia lipolytica was constructed to produce retinol palmitate. The synthesis pathway of retinol palmitate is shown in the figure below. Figure 1 ; In this engineered strain, the synthesis pathway of retinol palmitate and the mevalonate pathway were constructed, and the key gene expression of the synthesis pathway of exogenous carotenoids in Yarrowia lipolytica was strengthened. The mevalonate pathway of the peroxisome of Yarrowia lipolytica was also constructed; the genetically engineered bacteria used Yarrowia lipolytica ZTQ5320 as the starting strain;

[0083] The genes related to the mevalonate pathway include the gene AtoB that catalyzes the condensation of acetyl-CoA to acetoacetyl-CoA, the gene HMGS that catalyzes the condensation of acetoacetyl-CoA and acetyl-CoA to HMG-CoA, and the gene HMGR that catalyzes the reduction of HMG-CoA to mevalonate.

[0084] A mevalonate pathway localized to the peroxisome is constructed in Yarrowia lipolytica, comprising: a gene AtoBePTS1 that catalyzes the condensation of acetyl-CoA to acetoacetyl-CoA, a gene HMGSePTS1 that catalyzes the condensation of acetoacetyl-CoA and acetyl-CoA to HMG-CoA, and a gene HMGRePTS1 that catalyzes the reduction of HMG-CoA to mevalonate, wherein the optimized sequence of AtoBePTS1 is shown in SEQ ID NO: 1, the optimized sequence of HMGSePTS1 is shown in SEQ ID NO: 2, and the optimized sequence of HMGRePTS1 is shown in SEQ ID NO: 3;

[0085] The mevalonate pathway with a signal peptide is localized to the peroxisome, while the one without a signal peptide is expressed in the cytoplasm.

[0086] The key genes for enhancing the synthesis of exogenous β-carotene in Yarrowia lipolytica include: ERG12, which catalyzes the phosphorylation of mevalonate to mevalonate-5-phosphate; ERG8, which catalyzes the generation of mevalonate-5-pyrophosphate from mevalonate-5-phosphate; ERG19, which catalyzes the decarboxylation of mevalonate-5-pyrophosphate to isoprene pyrophosphate; IDI, which catalyzes the isomerization of isoprene pyrophosphate to dimethylallyl pyrophosphate; and IDD, which catalyzes the generation of farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The optimized sequence of CarB gene is shown in SEQ ID NO:4, and the optimized sequence of CarRP gene is shown in SEQ ID NO:5;

[0087] The retinol palmitate synthesis pathway is constructed in Yarrowia lipolytica cells by integrating exogenous β-carotene 15,15'-monooxygenase gene Blh, retinol binding protein gene CRBP and gene LRAT that catalyzes retinol to produce retinol palmitate into the yeast genome, wherein the optimized sequence of the Blh gene is such as SEQ ID No.6, the optimized sequence of the CRBP gene is such as SEQ ID No.7, and the optimized sequence of the LRAT gene is such as SEQ ID No.8;

[0088] SEQ ID NO.1

[0089]

[0090] SEQ ID NO.2

[0091]

[0092] SEQ ID NO.3

[0093]

[0094] SEQ ID NO.4

[0095]

[0096] SEQ ID NO.5

[0097]

[0098] SEQ ID NO.6

[0099] atgggcctgatgctgatcgactggtgtgccctggccctggtggtgttcatcggcctgccccacggcgccctggacgccgccatctctttctctatgatctcttctgccaagcgaatcgcccgactggccggcatcctgctgatctacctgctgctggccaccgccttcttcctgatctggtaccagctgcccgccttctctctgctgatcttcctgctgatctctatcatccacttcggcatggccgacttcaacgcctctccctctaagctgaagtggccccacatcatcgcccacggcggcgtggtgaccgtgtggctgcccctgatccagaagaacgaggtgaccaagctgttctctatcctgaccaacggccccacccccatcctgtgggacatcctgctgatcttcttcctgtgttggtctatcggcgtgtgtctgcacacctacgagaccctgcgatctaagcactacaacatcgccttcgagctgatcggcctgatcttcctggcctggtacgccccccccctggtgaccttcgccacctacttctgtttcatccactctcgacgacacttctctttcgtgtggaagcagctgcagcacatgtcttctaagaagatgatgatcggctctgccatcatcctgtcttgtacctcttggctgatcggcggcggcatctacttcttcctgaactctaagatgatcgcctctgaggccgccctgcagaccgtgttcatcggcctggccgccctgaccgtgccccacatgatcctgatcgacttcatcttccgaccccactcttctcgaatcaagatcaagaactag;

[0100] SEQ ID NO.7

[0101] atgcctgtggacttcaccggatactggaagatgctggtcaacgagaacttcgaagagtaccttcgggctctggatgtcaacgttgcactgcgaaagatcgccaaccttctcaagcctgacaaagagatcgtccaggatggtgaccacatgatcatccgaacactgtctaccttccgaaactacatcatggacttccaggtcggt aaagagttcgaggaggatctgaccggaatcgacgaccgaaagtgcatgaccaccgtctcttgggacggtgataagctccagtgtgtccagaagggtgagaaagagggtcgaggttggactcagtggatcgagggtgatgagcttcacctggagatgcgagtggagggtgtcgtctgcaagcaggtctttaagaaggtgcagtaa;

[0102] SEQ ID NO.8

[0103] atgaagaatccaatgctggaggtggtgtctctgcttctggagaaacttctgctcatctccaacttcacactgttctcttctggagccgccggtaaagacaagggacgaaactctttctacgaaacctcttctttccaccgaggtgacgtgctggaggtgcctcgaacacacctgactcactacggcatctacctgggtgacaaccgagtggctcacatgatgcctgacattctgctggcactgaccgacgacatgggtcgaacacagaaggtcgtctccaacaagcgactgattctcggtgtcatcgtgaaggtcgcctccatccgagtggataccgtggaggacttcgcctacggtgccaacattctggtcaaccacctggacgagtctctccagaagaaggcactgctgaacgaagaggttgctcgacgagccgagaagctgctgggtttcacgccttactctctgctgtggaacaactgcgagcacttcgtcacctactgtcgatacggtacgcctatctcgcctcagtccgacaagttctgcgagactgtcaagatcatcatccgggaccagcgatccgtgctggcctctgccgttctgggtctggcttctatcgtctgcactggtctggtgtcttacaccacactgcctgccatcttcattccattctttctgtggatggccggttaa。

[0104] Design primers to clone the above gene, and the primer sequences are shown in Table 1

[0105] Table 1 Primer list

[0106]

[0107]

[0108]

[0109]

[0110] Construct plasmid p-Z1:

[0111] pUC19 URA3 was used as the backbone vector, containing AtoB, HMGS, ERG12 and HMGR genes, with promoters pEXP, pFBA, pGPD and pTEF, and terminators tICL, tLIP, tXPR2 and CYC1, respectively; the plasmid map is shown in the attached Figure 2 shown.

[0112] Use primers pUC19-pEXP-F / pEXP-R, pFBA-F / pFBA-R, pGPD-F / pGPD-R, pTEF-F / pTEF-R, tICL-F / pFBA-tICL-R, tLIP-F / pGPD respectively. -tLIP-R, tXPR2-F / pTEF-tXPR2-R, pFBA-HMGS-F / tLIP-HMGS-R, pGPD-ERG12-F / tXPR2-ERG12-R and pTEF-HMGR-F / CYC1-- HMGR-R used the genomic DNA of Yarrowia lipolytica Polf as a template to amplify the pEXP, pFBA, pGPD, pTEF, tICL, tLIP, tXPR2, ERG12, HMGR and HMGS fragments; the primers CYC1-F / pUC19-CYC1-R used the genomic DNA of Saccharomyces cerevisiae CEN.PK2-1C as a template to amplify the CYC1 fragment; the primers pEXP-AtoB-F / tICL-AtoB-R used the genomic DNA of Escherichia coli BL21 (DE3) as a template to amplify the AtoB fragment.

[0113] The promoter, gene and terminator were spliced ​​into four expression cassettes, pEXP-AtoB-tICL, pFBA-HMGS-tLIP, pGPD-ERG12-tXPR2 and pTEF-HMGR-CYC1, by overlap PCR. The plasmid backbone pUC19URA3 was purified and recovered by double restriction digestion with BamHⅠ and HindⅢ. Then, the restriction-digested plasmid backbone and the four expression cassettes were assembled by Gibson ligation (ClonExpress Ultra OneStep Cloning Kit) to construct plasmid p-Z1.

[0114] Construction of plasmid p-Z2:

[0115] p-Z2 uses pUC19 TRP1 as the backbone vector, contains the nutritional label TRP1, ERG19, ERG8, ERG20 and IDI genes, the promoters are pGPD pTEF, pEXP and pFBA, and the terminators are tXPR2, CYC1, tICL and tLIP; the plasmid map is attached Figure 3 shown.

[0116] Use primers pUC19-pGPD-F / pGPD-R, pTEF-F / pTEF-R, pEXP-F / pEXP-R, pFBA-F / pFBA-R, tXPR2-F / pTEF-tXPR2-R, tI respectively. CL-F / pFBA-tICL-R, tLIP-F / pUC19-tLIP-R, pGPD-ERG19-F / tXPR2-ERG19-R, pTEF-ERG8-F / CYC1-ERG8-R, pEX P-ERG20-F / tICL-ERG20-R, pFBA-IDI-F / tLIP-IDI-R, and pGPD, pTEF, pEXP, pFBA, tXPR2, tICL, tLIP, ERG19, ERG8, ERG20 and IDI fragments were amplified using Yarrowia lipolytica Polf genomic DNA as templates; the CYC1 fragment was amplified using Saccharomyces cerevisiae CEN.PK2-1C genomic DNA as a template using primers CYC1-F / pEXP-CYC1-R.

[0117] The promoter, gene and terminator were spliced ​​into four expression cassettes, pGPD-ERG19-tXPR2, pTEF-ERG8-CYC1, pEXP-ERG20-tICL and pFBA-IDI-tLIP, by overlap PCR. The plasmid backbone pUC19TRP1 was purified and recovered by double restriction digestion with BamHⅠ and HindⅢ. Then, the restriction-digested plasmid backbone and the four expression cassettes were assembled by Gibson ligation (ClonExpress Ultra One Step Cloning Kit) to construct plasmid p-Z2.

[0118] Construction of plasmid pZ25B:

[0119] pZ25B uses pUC19 LEU2 as the backbone vector, contains CarB, CarRP, GGS1, Blh and ERG20 genes, promoters are pEXP, pTEF, pFBA, pTEF and pGPD, and terminators are tICL, CYC1, tLIP, mig1t and tXPR2; the plasmid map is attached. Figure 4 shown.

[0120] Primers pUC19-pTEF-F / pTEF-R, pEXP-F / pEXP-R, pFBA-F / pFBA-R, pGPD-F / pGPD-R, tICL-F / pTEF-tICL-R, mig1t–F / pGPD-mig1t-R, tLIP-F / pEXP-tLIP-R, tXPR2-F / pUC19-tXPR2-R were used to amplify the pTEF, pEXP, pFBA, pGPD, tICL, mig1t, tLIP and tXPR2 fragments respectively using Yarrowia lipolytica Polf genomic DNA as template; primers CYC1-F / pEXP-CYC1-R were used to amplify the CYC1 fragment using Saccharomyces cerevisiae CEN.PK2-1C genomic DNA as template. The CarB gene and CarRP gene from Mucor circinelloides were synthesized by Beijing Qingke Biotechnology Co., Ltd. after codon optimization. The CarB and CarRP fragments were amplified using the synthesized genes as templates using primers pEXP-CarB-F / tICL-CarB-R and pTEF-CarRP-F / CYC1-CarRP-R, respectively. The Blh gene from marine bacteria 66A03 was synthesized by Beijing Qingke Biotechnology Co., Ltd. after codon optimization. The synthesized genes were amplified using primers pTEF-Blh-F / mig1t-Blh-R, respectively. The GGS1 fragment was amplified using the genomic DNA of Yarrowia lipolytica using primers pFBA-GGS1-F / tLIP-GGS1-R. The ERG20 fragment was amplified using the genomic DNA of Yarrowia lipolytica using primers pGPD-ERG20-F / tXPR2-ERG20-R.

[0121] The promoter, gene and terminator were spliced ​​into five expression cassettes, pTEF-CarRP-CYC1, pEXP-CarB-tICL, pFBA-GGS1-tLIP, pTEF-Blh-mig1t and pGPD-ERG20-tXPR2, by overlap PCR. The plasmid backbone pUC19LEU2 was purified and recovered by double restriction digestion with BamHⅠ and HindⅢ, and then the restriction-digested plasmid backbone and five expression cassettes were assembled by Gibson ligation (ClonExpressUltra One Step Cloning Kit) to construct plasmid pZ25B.

[0122] Construction of plasmid pZ60:

[0123] pZ60 uses pUC19URA3 as the backbone vector, contains AtoBePTS1, HMGSePTS1, HMGRePTS1 and GPS genes, promoters are pGPD, pEXP, pTEF and pFBA, and terminators are tXPR2, tICL, CYC1 and tLIP; the plasmid map is attached. Figure 5 shown.

[0124] Use primers pUC19-pTEF-F / pTEF-R, pEXP-F / pEXP-R, pFBA-F / pFBA-R, pGPD-F / pGPD-R, HMGSePTS1-tICL-F / pGPD respectively. -tICL-R, tLIP-F / pEXP-tLIP-R, tXPR2-AtoBePTS1-F / pUC19-tXPR2-R, pTEF-HMGRePTS1-F / CYC1--HMGRePT S1-R and pEXP-HMGSePTS1-F / tICL-HMGSePTS1-R used the genomic DNA of Yarrowia lipolytica Polf as template to amplify the pEXP, pFBA, pGPD, pTEF, tICL, tLIP, tXPR2, HMGRSePTS1 and HMGSePTS1 fragments; the CYC1 fragment was amplified using the genomic DNA of Saccharomyces cerevisiae CEN.PK2-1C as template using primers CYC1-HMGRePTS1-F / CYC1-R. The AtoBePTS1 fragment was amplified using the genomic DNA of Escherichia coli BL21 (DE3) as template using primers pGPD-AtoB-F / tXPRS-AtoBePTS1-R. The GPS gene from the archaeal sulfur bacteria was synthesized by Beijing Qingke Biotechnology Co., Ltd. after codon optimization, and the GPS fragment was amplified using the synthesized gene as template using primers GPS-F / GPS-tLIP-R.

[0125] The promoter, gene and terminator were spliced ​​into four expression cassettes, pTEF-HMGRePTS1-CYC1, pFBA-GPS-tLIP, pEXP-HMGSePTS1-tICL and pGPD-AtoBePTS1-tXPR2, by overlap PCR. The plasmid backbone pUC19URA3 was purified and recovered by double restriction digestion with BamHⅠ and HindⅢ. The restriction-digested plasmid backbone and the four expression cassettes were assembled by Gibson ligation (ClonExpress Ultra OneStep Cloning Kit) to construct plasmid pZ60.

[0126] Construction of plasmid pZ61:

[0127] pZ61 uses pUC19 URA3 as the backbone vector, contains CRBP and LRAT genes, promoters are pGPD and pFB, and terminators are tLIP and mig1t; the plasmid map is shown in the attached Figure 6 shown.

[0128] The pGPD, pFBA, mig1t and tLIP fragments were amplified using primers pUC19-pGPD-F / pGPD-R, pFBA-F / pFBA-R, tLIP-F / pFBA-tLIP-R and mig1t–F / pUC19-mig1t-R, respectively, with the Yarrowia lipolytica Polf genomic DNA as template; the CRBP gene and LRAT gene from the human genome were synthesized by Beijing Qingke Biotechnology Co., Ltd. after codon optimization, and the CRBP and LRAT fragments were amplified using the synthesized genes as templates using primers pGPD-CRBP-F / tLIP-CRBP-R and pFBA-LRAT-F / mig1t-LRAT-R, respectively.

[0129] The promoter, gene and terminator were spliced ​​into two expression cassettes, pGPD-CRBP-tLIP and pFBA-LRAT-mig1t, by overlap PCR. The plasmid backbone pUC19URA3 was purified and recovered by double restriction digestion with BamHⅠ and HindⅢ. Then, the restriction-digested plasmid backbone and the two expression cassettes were assembled by Gibson ligation (ClonExpress Ultra One Step Cloning Kit) to construct plasmid pZ61.

[0130] Example 2 Construction of a recombinant strain that produces high levels of retinol palmitate

[0131] The recombinant engineered bacteria randomly integrate plasmids pZ1, pZ2, pZ25B, PZ60 and PZ61 into the Yarrowia lipolytica genome by non-homologous recombination. Those skilled in the art will appreciate that the purpose of inserting into the genome of the cell by non-homologous recombinant biological means is to obtain more strains that are likely to be stably inherited, and only transforming the above expression system can also achieve the purpose of the present invention. Compared with the method of fixed-site insertion, non-homologous recombination has a chance to obtain more efficient recombinant cells or recombinant bacteria that are inserted multiple times, thereby further improving the production efficiency of the recombinant cells or recombinant bacteria. It includes the following steps:

[0132] First, the recombinant plasmids pZ1, pZ2 and plasmid pZ25B were linearized by cutting the original pUC19 backbone part with NotⅠ, and then introduced into Yarrowia lipolytica ZTQ5320 with triple defects in uracil, tryptophan and leucine synthesis to achieve non-homologous recombination, and the positive strains with successful recombination were detected and screened to complete the first round of strain recombination iteration. The URA3 screening tag gene was removed by introducing the plasmid Y-Cre expressing the Cre enzyme to restore the screening marker of the retinol-producing engineering strain.

[0133] The pZ60 plasmid linearized by NotⅠ was introduced again into the above-mentioned strain that restored the nutritional deficiency, and the positive strains with successful recombination were screened to complete the second round of recombination iteration. Then, the plasmid Y-Cre expressing Cre enzyme was introduced to remove the URA3 screening tag gene to restore the screening marker of the retinol-producing engineering strain.

[0134] Finally, the pZ61 plasmid linearized by NotⅠ was introduced into the above-mentioned strain that restored the nutritional deficiency, and the positive strain with successful recombination was screened and named as the genetically engineered strain C14.

[0135] Example 3 Industrial fermentation test

[0136] The genetically engineered bacteria C14 obtained in Example 3 was subjected to high-density fermentation in a 5 L fermentation tank, and the unit yield of retinol palmitate was detected.

[0137] The fermentation method comprises the following steps:

[0138] A single colony of the recombinant strain C14 on the solid YPD plate was inoculated into a 30 ml conical flask containing 10 ml YPD liquid culture medium, and cultured at 30° C. and a shaking speed of 200 rpm for 48 hours to obtain a primary seed solution.

[0139] The first-level seed solution was transferred to a 300-ml conical flask containing 100 ml YPD liquid culture medium at a 1% (wt) inoculation rate, and cultured at 30°C, with a shaker speed of 200 rpm for 18 h until the cell OD600 reached 10, thereby obtaining the second-level seed solution.

[0140] The secondary seed liquid was transferred to a fermentation tank containing a fermentation medium at an inoculation rate of 10% (wt) for fermentation. The initial medium composition was 30 g / L yeast extract, 60 g / L peptone and 100 g / L glucose. The culture was carried out under the conditions of fermentation temperature of 30°C, stirring speed of 300-800 rpm, ventilation volume of 2 L / min, pH 6.8 and dissolved oxygen of more than 25%. After 12 hours of culture, the fermentation was continued with 60% glucose stock solution for 264 hours. The maximum yield of retinol palmitate in C14 reached 5 g / L.

[0141] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A nucleic acid molecule comprising: (I) genes related to the retinol palmitate synthesis pathway; and (II) mevalonate pathway-related genes; and (III) Strengthening the key genes of the exogenous carotenoid biosynthesis pathway of Yarrowia lipolytica.

2. The nucleic acid molecule according to claim 1, characterized in that The mevalonate pathway-related genes include a gene AtoB that catalyzes the condensation of acetyl-CoA to acetoacetyl-CoA, a gene HMGS that catalyzes the condensation of acetoacetyl-CoA and acetyl-CoA to HMG-CoA, and a gene HMGR that catalyzes the reduction of HMG-CoA to mevalonate; Preferably, the nucleic acid molecule further comprises a mevalonate pathway localized to the peroxisome; the mevalonate pathway-related genes localized to the peroxisome include a gene AtoB that catalyzes the condensation of acetyl-CoA into acetoacetyl-CoA, a gene HMGS that catalyzes the condensation of acetoacetyl-CoA and acetyl-CoA into HMG-CoA, and a gene HMGR that catalyzes the reduction of HMG-CoA to mevalonate, wherein the AtoB, HMGS and HMGR genes are respectively connected with a gene sequence encoding a peroxisome localization signal peptide ePTS1 to form AtoBePTS1, HMGSePTS1 and HMGRePTS1 genes; Preferably, the AtoB is derived from Escherichia coli; Preferably, the HMGS and HMGR are derived from Yarrowia lipolytica; Preferably, the sequence of AtoBePTS1 is shown as SEQ ID NO:1, the sequence of HMGSePTS1 is shown as SEQ ID NO:2, and the sequence of HMGRePTS1 is shown as SEQ ID NO:

3.

3. The nucleic acid molecule according to claim 1, characterized in that The key genes of the enhanced Yarrowia lipolytica exogenous β-carotene synthesis pathway include: gene ERG12 that catalyzes the phosphorylation of mevalonate to mevalonate-5-phosphate, gene ERG8 that catalyzes mevalonate-5-phosphate to generate mevalonate-5-pyrophosphate, gene ERG19 that catalyzes the decarboxylation of mevalonate-5-pyrophosphate to generate isoprene pyrophosphate, gene IDI that catalyzes the isomerization of isoprene pyrophosphate to dimethylallyl pyrophosphate, gene ERG20 that catalyzes isopentenyl pyrophosphate and dimethylallyl pyrophosphate to generate farnesyl pyrophosphate, gene GGS1 that catalyzes the combination of farnesyl pyrophosphate with a molecule of isoprene pyrophosphate to generate digeranyl pyrophosphate, gene GPS that catalyzes dimethylallyl pyrophosphate to generate digeranyl pyrophosphate, gene CarB that catalyzes the dehydrogenation of exogenous lycopene to generate lycopene, and bifunctional gene CarRP that catalyzes two molecules of digeranyl pyrophosphate to generate lycopene and catalyzes the cyclization of lycopene to generate β-carotene; Preferably, the ERG12, ERG8, ERG19, ERG20 and GGS1 are derived from Yarrowia lipolytica; Preferably, the GPS is derived from archaeal sulfur bacteria; Preferably, the CarB and CarRP are derived from Mucor circinelloides; Preferably, the sequence of the CarB gene is shown as SEQ ID NO:4, and the sequence of the CarRP gene is shown as SEQ ID NO:

5.

4. The nucleic acid molecule according to claim 1, characterized in that The genes related to the retinol palmitate synthesis pathway include the β-carotene 15,15'-monooxygenase gene Blh, the retinol binding protein gene CRBP, and the gene LRAT that catalyzes retinol to produce retinol palmitate; Preferably, the Blh is derived from marine bacteria; Preferably, the CRBP and LRAT are of human origin.

5. An expression system, characterized in that The expression system comprises the nucleic acid molecule according to any one of claims 1 to 4.

6. A recombinant cell, comprising the nucleic acid molecule according to any one of claims 1 to 4 or the expression system according to claim 6; Preferably, the cell is a yeast cell; Preferably, the yeast cell is Yarrowia lipolytica; Preferably, the Yarrowia lipolytica is Yarrowia lipolytica ZTQ5320.

7. A method for constructing the recombinant cell according to claim 6, comprising introducing the nucleic acid molecule according to any one of claims 1 to 4 or the expression system according to claim 5 into a cell.

8. A method for producing retinol palmitate, comprising culturing the above recombinant cell to obtain retinol palmitate.

9. Use of the nucleic acid molecule according to any one of claims 1 to 4, the expression vector according to claim 5 and / or the recombinant cell according to claim 6 in the fields of food, chemical industry or pharmaceuticals.

10. Use of the nucleic acid molecule according to any one of claims 1 to 4, the expression vector according to claim 5 and / or the recombinant cell according to claim 6 in producing retinol palmitate or preparing a product producing retinol palmitate.

Images