Application of reagent for detecting GPR174 gene expression level in CD4 + T cell and / or B cell in preparation of product for detecting toxic diffuse goiter

Abstract

The invention discloses application of a reagent for detecting GPR174 gene expression level in CD4 + T cells and / or B cells in preparation of a product for detecting toxic diffuse goiter. The invention provides a detection marker for a toxic diffuse goiter (Graves disease). The detection marker is GPR174 expressed in a CD4 + T cell or a B cell. Experiments prove that compared with healthy people, the expression of GPR174 in CD4 + T cells or B cells in the body of a Graves disease patient is remarkably up-regulated, and the expression level of GPR174 in the CD4 + T cells and the B cells is in positive correlation with the levels of Graves disease thyroid functions FT3 (free triiodothyronine), FT4 (free tetraiodothyronine) and an autoantibody TSAb (thyroid stimulating hormone receptor stimulating antibody). The expression level of the GPR174 in the CD4 + T cell and the B cell is highly related to the occurrence of the Graves disease, and the expression level of the GPR174 in the CD4 + T cell and the B cell can be used as a detection indication of the Graves disease, so that a new thought is provided for detection and treatment of the Graves disease.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to detecting CD4 + Use of a reagent for measuring the expression level of GPR174 in T cells or B cells in the preparation of a product for detecting toxic diffuse goiter (Graves' disease). Background Art

[0002] Graves' disease is one of the organ-specific autoimmune diseases and the most common cause of hyperthyroidism, accounting for about 85% of hyperthyroid patients. It is clinically characterized by hypermetabolic syndrome, diffuse thyroid enlargement, exophthalmos, pretibial myxedema, etc. Its incidence rate is increasing year by year, and there is a trend of younger patients. Graves' disease has a long course and is prone to relapse. Its etiology has not been fully elucidated. It is currently recognized that its occurrence is related to autoimmunity. Some studies believe that T helper cells (Th, mainly CD4+ cells) are unbalanced, and Th cells help B cells to continuously produce a large number of stimulating antibodies (TSAb) in antibodies that directly act on the thyroid stimulating hormone receptor on the thyroid cell membrane (TSH receptor antibody, TRAb). Both TSH and TSAb bind to the TSH receptor to produce the biological effect of TSH, that is, thyroid cell hyperplasia, increased synthesis and secretion of thyroid hormones, leading to Graves' disease.

[0003] However, although TSAb is an important indicator for the diagnosis and efficacy evaluation of Graves' disease, it is not consistent with thyroid hormone levels. There are two types of TRAb: stimulatory antibodies (TSAb) and inhibitory antibodies (TSBAb). Due to the limitations of detection conditions, some test kits can only detect the total amount of TRAb and cannot distinguish between TSAb and TSBAb. Therefore, new Graves' disease detection markers are urgently needed to improve the detection effect of Graves' disease. Summary of the invention

[0004] The purpose of the present invention is to solve the technical problem that the current detection effect of Graves' disease is poor.

[0005] In order to achieve the above object, the present invention provides the use of a reagent for detecting the expression level of GPR174 gene in CD4+ T cells and / or B cells in the preparation of a product for detecting toxic diffuse goiter.

[0006] Optionally, the above product detects the expression level of the GPR174 gene by detecting: the amount of GPR174 mRNA or GPR174 protein in CD4+ T cells and / or B cells.

[0007] Optionally, the product detects the expression level of the GPR174 gene by detecting the amount of GPR174 mRNA, and the amount of GPR174 mRNA is detected by RT-PCR.

[0008] Optionally, the product includes: primers for specifically amplifying the GPR174 gene, and the sequence of the primers for specifically amplifying the GPR174 gene is shown in SEQ ID NO.1-2.

[0009] Optionally, the product includes a detection kit, a detection test strip, and a detection chip.

[0010] Optionally, the test sample of the product is CD4+ T cells and / or B cells in peripheral blood.

[0011] The present invention also provides a product for detecting Graves' disease, which comprises a reagent for detecting the expression level of GPR174 gene in CD4+ T cells and / or B cells, wherein the reagent comprises primers for specifically amplifying GPR174 gene, and the sequence of the primers is shown in SEQ ID NO.1-2.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] The present invention provides a detection marker for Graves' disease, which is CD4 + GPR174 expressed in T cells or B cells. The present invention has proved through experiments that compared with healthy people, CD4 + GPR174 expression in T cells or B cells was significantly upregulated, and CD4 + The expression levels of GPR174 in T cells and B cells were positively correlated with the thyroid function and autoantibody levels of FT3 (free triiodothyronine), FT4 (free tetraiodothyronine), and TSAb (thyroid stimulating hormone receptor antibody) in Graves' disease, indicating that CD4 + The expression level of GPR174 in T cells and B cells is highly correlated with the occurrence of Graves' disease. + The relationship between the expression level of GPR174 in T cells and B cells and Graves' disease was verified. The results showed that CD4 + GPR174 in T cells and B cells has high sensitivity and specificity for the detection of Graves' disease, and can be used as an indication for the detection of Graves' disease, providing a new idea for the detection and treatment of Graves' disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 CD4 +RT-PCR results of T cells and B cells expressing GPR174; wherein:

[0015] A is the CD4 + Figure 2 RT-PCR results of GPR174 expressed in T cells;

[0016] B is the RT-PCR results of GPR174 expressed in B cells in the peripheral blood of Graves' disease patients and normal subjects.

[0017] Figure 2 For CD4 + The result of the correlation analysis between GPR174 expressed by T cells and B cells and thyroid function and autoantibody indicators FT3, FT4, and TSAb in Graves' disease; Among them:

[0018] A is CD4 + The results of the correlation analysis between GPR174 and FT3 expressed by T cells;

[0019] B is CD4 + The results of the correlation analysis between GPR174 and FT4 expressed by T cells;

[0020] C is CD4 + Correlation analysis results of GPR174 expressed by T cells and TSAb;

[0021] D is the correlation analysis result of GPR174 and FT3 expressed in B cells;

[0022] E is the correlation analysis result of GPR174 and FT4 expressed in B cells;

[0023] F is the correlation analysis results of GPR174 expressed by B cells and TSAb.

[0024] Figure 3 CD4 for ROC curve analysis + The effect diagram of GPR174 expression levels of T cells and B cells as an indication for Graves' disease detection; among which:

[0025] A is ROC curve analysis CD4 + The effect diagram of GPR174 expression level in T cells as an indicator for Graves' disease detection;

[0026] B is the ROC curve analysis of the effect of GPR174 expression level in B cells as an indicator for Graves' disease detection. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0028] After in-depth research, the present invention measured and analyzed a large number of immune cells and found for the first time that CD4 + The expression of GPR174 in T cells or B cells was significantly higher than that in normal people, and the experiment further confirmed that CD4 + The relationship between the expression level of GPR174 in T cells and B cells and the three indicators of thyroid function and autoantibodies in patients with Graves' disease. The results showed that CD4 + The expression level of GPR174 in T cells and B cells was positively correlated with the levels of the three indicators of Graves' disease (FT3, FT4, TSAb). + The relationship between GPR174 expression levels in T cells and B cells and Graves' disease was verified. The results showed that CD4 + GPR174 in T cells and B cells has high sensitivity and specificity for the detection of Graves' disease, and can be used as an indication for the detection of Graves' disease, providing a new idea for the detection and treatment of Graves' disease.

[0029] Terminology

[0030] As used herein, "marker" and "biomarker" are used interchangeably and refer to an indicator of normal or abnormal progression in an individual or an indicator of a disease or other condition in an individual or a target molecule that expresses these.

[0031] "Upregulated" refers to a higher value or level of a biomarker detected than in a healthy or normal individual sample.

[0032] "Differentially expressed" refers to expression at a higher or lower level in a subject having a particular disease compared to expression in a normal subject or a control subject.

[0033] The present invention is further described in detail below in conjunction with the examples. The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the examples where specific conditions are not specified are usually carried out under conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under the conditions recommended by the manufacturer.

[0034] Example 1 RT-PCR detection of differential expression of GPR174

[0035] GPR174 is a G protein-coupled receptor expressed in a variety of immune cells. In this example, the peripheral blood of healthy people and patients with Graves' disease was detected and it was found that compared with healthy people, the peripheral blood CD4 + The expression level of GPR174 in T cells or B cells was significantly upregulated.

[0036] 1. Experimental Methods

[0037] (1) Peripheral blood was collected from 20 healthy subjects and 20 patients with Graves' disease, including:

[0038] Graves' disease patients: From January 2020 to June 2022, 20 patients with primary Graves' disease (untreated) from Shanghai First People's Hospital were diagnosed according to the "Guidelines for the Diagnosis and Treatment of Thyroid Diseases in China" and physical and laboratory thyroid function tests (including FT3, FT4 and TSAb, etc.).

[0039] Healthy subjects: 20 healthy subjects without Graves' disease who received physical examination in the same hospital and at the same time, whose age and gender matched those of Graves' disease patients.

[0040] Exclusion criteria included pregnancy or lactation, alcohol addiction, smoking, diabetes, hypertension, lipid disorders, a history of other autoimmune diseases or chronic inflammatory diseases, and use of medications that may affect the immune system within 3 months.

[0041] (2) CD4 magnetic beads (Miltenyi CD4 MicroBeads, human 130-045-101) and human B-CLL cell enrichment kit (Miltenyi B-CLL Cell Isolation Kit, human 130-103-466) were used to isolate CD4 + After RNA was extracted from T cells and B cells, it was reverse transcribed and RT-PCR was used to detect CD4 + Expression of GPR174 in T and B cells.

[0042] The reverse transcription reaction was performed according to the instructions of PrimeScript RT reagent Kit (TaKaRa, RR036A), as follows:

[0043] Reverse transcription reaction system (taking 500ng RNA in 10μL reaction system as an example):

[0044]

[0045] Reverse transcription reaction conditions:

[0046]

[0047] RT-PCR reaction:

[0048] ① Primers: RT-PCR amplification primers were designed based on the cDNA nucleotide sequence of GPR174 in Genebank. The specific primer sequences are shown in SEQ ID NO.1-2.

[0049] SEQ ID NO.1: CCATATTTTCCAACATGAAACGG

[0050] SEQ ID NO.2: GTCCACAAGTCAGTGGCTCA

[0051] The GAPDH primer sequences are shown in SEQ ID NO.3-4.

[0052] SEQ ID NO.3: TGGCCTTCCGTGTTCCCTAC

[0053] SEQ ID NO.4:GAGTTGCTGTTGAAGTCGCA

[0054] ②RT-PCR reaction was performed according to the instructions of FastStart Universal SYBR Green Master Reagent (Roche), as follows:

[0055] a. Dilute the cDNA obtained in the reverse transcription reaction to an appropriate concentration with DEPC water and set aside;

[0056] b.RT-PCR reaction system:

[0057]

[0058] RT-PCR reaction conditions: 50°C for 2 min; 95°C for 10 min; (95°C, 15 sec and 60°C, 60 sec) × 40 cycles.

[0059] SYBR Green was used as a fluorescent marker and PCR reaction was performed on a Light Cycler fluorescent quantitative PCR instrument. -ΔΔCT Relative quantification was performed by the method, and each sample was tested three times.

[0060] 2. Experimental Results

[0061] Using GAPDH as the internal reference, the CD4 +RT-PCR results of GPR174 in T cells and B cells. Figure 1 Compared with healthy people, CD4 + GPR174 expression in T cells and B cells was upregulated, and the difference was statistically significant (P<0.01). + The expression levels of GPR174 in T cells and B cells were significantly different between Graves' disease patients and healthy subjects. + Changes in the expression levels of GPR174 in T cells and B cells can serve as an indicator for the detection of Graves' disease.

[0062] Example 2 Correlation between GPR174 expression changes and thyroid function and autoantibody indicators in Graves' disease

[0063] Since Graves' disease is mainly caused by the patient's thyroid gland being attacked by autoimmunity, which causes the thyroid gland to secrete excessive thyroid hormones, the free thyroid hormones (FT3 and FT4) in Graves' disease patients will increase. In addition, Graves' disease patients will also specifically express TSAb antibodies, which will bind to the TSH receptors on the surface of thyroid cells and stimulate the secretion of thyroid hormones, which is also the main cause of Graves' disease. Therefore, in actual clinical practice, FT3, FT4, and TSAb are usually used as functional indicators of Graves' disease to assess the severity of Graves' disease.

[0064] This example further performed a correlation analysis between the expression level of GPR174 and the thyroid function and autoantibody indicators of Graves' disease. Figure 2 As shown, in CD4 + In T cells, the expression level of GPR174 was significantly higher than that of FT3 (P = 0.0005, R 2 =0.2768), FT4 (P=0.0100, R 2 =0.1620), TSAb antibody (P = 0.0019, R 2 =0.2260); in B cells, the expression level of GPR174 was positively correlated with FT3 (P<0.0001, R 2 =0.5252), FT4 (P<0.0001, R 2 =0.4941), TSAb antibody (P = 0.0024, R 2 =0.2186) was also positively correlated. This indicates that CD4 + The expression levels of GPR174 in T cells and B cells are closely related to thyroid function and autoantibody indicators in Graves' disease. +Changes in the expression levels of GPR174 in T cells and B cells can be used as an indicator for the detection of Graves' disease.

[0065] Example 3 Verification of CD4 + GPR174 expression levels in T cells and B cells as a marker for Graves' disease

[0066] In this example, 20 additional Graves' disease patient samples and 20 healthy human samples were collected, which were different from those in Example 1, to draw a receiver operating characteristic curve to verify the CD4 + The expression level of GPR174 in T cells and B cells can be used as an indicator for the detection of Graves' disease. Figure 3 , the CD4 + The expression levels of GPR174 in T cells and B cells were input into the ROC package of R language and plotted as follows Figure 3 The receiver operating characteristic curve is shown in Figure 2. Figure 3 As shown, analysis showed that CD4 + The receiver operating characteristic curve AUC of T cells was 0.7713, with a sensitivity of 100% and a specificity of 55%; the receiver operating characteristic curve AUC of B cells was 0.7400, with a sensitivity of 60% and a specificity of 95%. The experimental results showed that CD4 + The detection of GPR174 in T cells and B cells for Graves' disease has high sensitivity and specificity and can be used as an indication for the detection of Graves' disease.

[0067] In summary, the present invention provides a detection marker for Graves' disease, which is CD4 + GPR174 in T cells or B cells. The present invention proves through experiments that GPR174 is in CD4 + The expression in T cells or B cells was significantly upregulated, and CD4 + The expression levels of GPR174 in T cells and B cells are positively correlated with the thyroid function and autoantibody indicators FT3, FT4, and TSAb of Graves' disease. + The relationship between the expression level of GPR174 in T cells and B cells and the occurrence of Graves' disease was verified. The results showed that CD4 + The detection of GPR174 in T cells and B cells for Graves' disease has high sensitivity and specificity, and can be used as an indication for the detection of Graves' disease, providing a new idea for the detection and treatment of Graves' disease.

[0068] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. Detection of CD4 + Use of a reagent for detecting the expression level of GPR174 gene in T cells and / or B cells in the preparation of a product for detecting toxic diffuse goiter.

2. The use according to claim 1, characterized in that: The product has passed the test: CD4 + The expression level of the GPR174 gene is detected by measuring the amount of GPR174 mRNA or GPR174 protein in T cells and / or B cells.

3. The use according to claim 2, characterized in that: The product detects the expression level of the GPR174 gene by detecting the amount of GPR174 mRNA, and the amount of the GPR174 mRNA is detected by RT-PCR method.

4. The use according to claim 3, characterized in that: The product includes: primers for specifically amplifying the GPR174 gene, and the sequence of the primers for specifically amplifying the GPR174 gene is shown as SEQ ID NO.1-2.

5. The use according to claim 1, characterized in that: The products include detection kits, detection test strips, and detection chips.

6. The use according to any one of claims 1 to 5, characterized in that: The test sample of the product is CD4 + T cells and / or B cells.

7. A product for detecting Graves' disease, characterized in that: The product includes detection of CD4 + A reagent for detecting the expression level of GPR174 gene in T cells and / or B cells.

8. The product for detecting Graves' disease according to claim 7, characterized in that: The reagents include primers for specifically amplifying the GPR174 gene, and the sequences of the primers are shown in SEQ ID NO.1-2.

Images