Sigma C protein monoclonal antibody of avian reovirus S1133 strain as well as preparation and application of sigma C protein monoclonal antibody

Abstract

The invention discloses a sigmaC protein monoclonal antibody of an avian reovirus S1133 strain as well as preparation and application of the sigmaC protein monoclonal antibody, and provides a hybridoma cell strain ARV-sigmaC-A12 of which the preservation number is CCTCC (China Center For Type Culture Collection) NO: C202459. The monoclonal antibody is secreted by the hybridoma cell strain CCTCC (China Center For Type Culture Collection) NO: C202459. The monoclonal antibody has the beneficial effects that the monoclonal antibody with good specificity is prepared by taking the ARV S1133 strain as a research object through prokaryotic expression of the sigma C protein and immunization of mice, and a foundation is laid for research of an ARV detection and diagnosis technology.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the preparation of monoclonal antibodies against σC protein of avian reovirus S1133 strain and its preparation and application. Background Art

[0002] Avian reovirus is a pathogen widely spread in poultry, which can cause viral arthritis, tenosynovitis and dwarf syndrome, etc. It can also induce severe immunosuppression, cause concurrent or secondary infection of other diseases, and lead to reduced production performance and increased mortality in chickens. ARV is widely prevalent in various parts of my country and is showing a trend of expansion, especially in white-feathered broiler flocks, where the infection rate and morbidity have shown a gradual upward trend, causing huge economic losses to my country's poultry farming industry. Therefore, it is urgent to establish effective diagnosis, prevention and control, and purification measures.

[0003] Monoclonal antibodies have a single antigenic determinant and are widely used in virological diagnosis because of their strong specificity, high titer, uniform physical and chemical properties, strong repeatability, and low production cost. At present, there have been reports on the preparation and application of ARV monoclonal antibodies in the study of ARV, but there have been no reports on the preparation of monoclonal antibodies against the σC protein of the ARV S1133 strain. Some scholars have found that the ARV strains prevalent in China are highly homologous to v-S1133 and S1133 and belong to the same branch. The ARV S1133 strain is often used as a reference strain for studying ARV pathogenicity experiments. In the molecular virology research of ARV, the research on the σC protein is relatively in-depth. The protein carries a specific neutralizing antigen epitope and can be used as an antigen to stimulate the body to produce specific neutralizing antibodies. It has unique advantages in the analysis of the relationship between ARV genotype differences, strain pathogenicity, and immunogenicity. Therefore, the preparation of monoclonal antibodies against the σC protein of the ARV S1133 strain is of great significance to the development of ARV detection kits. Summary of the invention

[0004] The present invention provides a hybridoma cell that can secrete a monoclonal antibody against the σC protein of the avian reovirus S1133 strain, named as the hybridoma cell line ARV-σC-A12, which was deposited in the China Center for Type Culture Collection (CCTCC) at Wuhan University, Wuhan, China on March 13, 2024, with a deposit number of CCTCC NO: C202459.

[0005] The invention provides a hybridoma cell strain ARV-σC-A12, whose deposit number is CCTCC NO: C202459.

[0006] The invention provides the monoclonal antibody secreted by the hybridoma cell line CCTCC NO: C202459.

[0007] The use of the hybridoma cell line CCTCC NO: C202459 in the preparation of products should also be within the scope of protection of the present invention; the functions of the product are as follows (a), (b) or (c):

[0008] (a) Detection of avian reovirus S1133 strain σC protein;

[0009] (b) Detection of avian reovirus S1133 strain;

[0010] (c) Detecting whether the sample to be tested contains the avian reovirus S1133 strain.

[0011] The use of the monoclonal antibody in the preparation of a product should also be within the scope of protection of the present invention; the function of the product is as follows (a), (b) or (c):

[0012] (a) Detection of avian reovirus S1133 strain σC protein;

[0013] (b) Detection of avian reovirus S1133 strain;

[0014] (c) Detecting whether the sample to be tested contains the avian reovirus S1133 strain.

[0015] The present invention provides a kit, comprising the hybridoma cell line ARV-σC-A12; the functions of the kit are as follows (a), (b), or (c):

[0016] (a) Detection of avian reovirus S1133 strain σC protein;

[0017] (b) Detection of avian reovirus S1133 strain;

[0018] (c) Detecting whether the sample to be tested contains the avian reovirus S1133 strain.

[0019] A kit comprising the monoclonal antibody; the functions of the kit are as follows (a), (b) or (c):

[0020] (a) Detection of avian reovirus S1133 strain σC protein;

[0021] (b) Detection of avian reovirus S1133 strain;

[0022] (c) Detecting whether the sample to be tested contains the avian reovirus S1133 strain.

[0023] The invention provides a test strip, wherein the T line of the detection pad of the test strip is coated with ARV-σC-A12 antibody, and the C line of the detection pad is coated with anti-mouse IgG antibody; the ARV-σC-A12 antibody is the above-mentioned monoclonal antibody.

[0024] Furthermore, the test strip can be a colloidal gold test strip, the colloidal gold pad is coated with colloidal gold labeled ARV-σC-A12 antibody, the T line of the detection pad is coated with ARV-σC-A12 antibody, and the C line of the detection pad is coated with anti-mouse IgG antibody; the ARV-σC-A12 antibody is the above-mentioned monoclonal antibody.

[0025] Furthermore, the test strip can be a fluorescent test strip, the fluorescent pad is coated with ARV-σC-A12 antibody labeled with fluorescent microspheres, the T line of the detection pad is coated with ARV-σC-A12 antibody, and the C line of the detection pad is coated with anti-mouse IgG antibody; the ARV-σC-A12 antibody is the monoclonal antibody.

[0026] The use of the above-mentioned test strips in the preparation of products should also be within the scope of protection of the present invention; the functions of the products are as follows (a), (b) or (c):

[0027] (a) Detection of avian reovirus S1133 strain σC protein;

[0028] (b) Detection of avian reovirus S1133 strain;

[0029] (c) Detecting whether the sample to be tested contains the avian reovirus S1133 strain.

[0030] The present invention also provides a method for preparing a monoclonal antibody specifically binding to the σC protein of the avian reovirus S1133 strain, the method comprising culturing the hybridoma cell line ARV-σC-A12.

[0031] The beneficial effects of the present invention are as follows: the present invention uses the ARV S1133 strain as the research object, expresses the σC protein in prokaryotes and immunizes mice to prepare a monoclonal antibody with good specificity, and lays a foundation for the research of ARV detection and diagnosis technology.

[0032] Collection Instructions

[0033] Biomaterials

[0034] Name of biological material: Hybridoma cell line ARV-σC-A12 A12)。

[0035] Name of the depository of biological materials: China Center for Type Culture Collection.

[0036] The abbreviation of the depository of biological materials is: CCTCC.

[0037] The address of the depository of biological materials is: Wuhan University, Wuhan, Hubei, China, 430072, Beijing.

[0038] Deposit date of biological material: March 13, 2024.

[0039] The registration number of the Collection Center for Biological Materials is CCTCC: C202459. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Construction of pGEX-6P-1-σC recombinant plasmid; wherein, in Figure A, M represents DL2000 DNA Marker, and 1 represents the PCR amplification product of ARVσC gene; in Figure B, M represents DL5000 DNA Marker; 1 represents pGEX-6P-1-σC recombinant plasmid; 2 represents the double enzyme digestion product of pGEX-6P-1-σC recombinant plasmid.

[0041] Figure 2 Expression of recombinant σC protein (A) and solubility analysis results (B); in Figure A, M represents the protein molecular mass standard, 1 represents induced pGEX-6P-1-σC positive bacteria, 2: uninduced pGEX-6P-1-σC positive bacteria; in Figure B, M represents the protein molecular mass standard, 1 represents empty vector, 2 represents pGEX-6P-1-σC whole bacterial solution, 3 represents pGEX-6P-1-σC bacterial lysis supernatant, and 4 represents pGEX-6P-1-σC bacterial lysis precipitate.

[0042] Figure 3 Purification results of recombinant σC protein; M represents the protein molecular weight standard; 1 represents unpurified recombinant σC protein; 2 represents purified recombinant σC protein.

[0043] Figure 4 Western blotting identification results; M represents the protein molecular weight standard; 1 represents the recombinant σC protein; 2 represents the pGEX-6P-1 empty vector.

[0044] Figure 5 IFA results of ARVσC monoclonal antibody; A is LMH cells infected with ARV S1133; B is the negative control group. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0046] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0047] In the following examples, the ARV S1133 strain is disclosed in Wan Lijun et al. Eukaryotic expression and preliminary analysis of subcellular localization of avian reovirus σC protein. Chinese Journal of Veterinary Science, 2021, 51(04): 0492-0499. The public can obtain this material from the Guangxi Zhuang Autonomous Region Veterinary Research Institute to repeat this experiment; the pGEX-6P-1 expression vector is disclosed in Zhang Minxiu et al. Expression of H9N2 subtype avian influenza virus M2e protein in prokaryotic system. Advances in Veterinary Medicine, 2017, 38(04): 7-12. The public can obtain this material from the Guangxi Zhuang Autonomous Region Veterinary Research Institute to repeat this experiment; ARV positive serum is disclosed in Xie Zhiqin et al. Preparation and characterization of monoclonal antibodies against avian reovirus S1733 strain. Chinese Journal of Animal Husbandry and Veterinary Medicine, 2012, 39(11): 47-51. The public can obtain this material from the Guangxi Zhuang Autonomous Region Veterinary Research Institute to repeat this experiment. The material was obtained from the Veterinary Research Institute of the Guangxi Zhuang Autonomous Region to repeat this experiment; Sp2 / 0 cells and LMH cells were disclosed in the literature of Wei You et al. Expression of truncated fiber-2 protein of avian adenovirus serotype 4 and preparation of monoclonal antibodies. Journal of Southern Agriculture, 2022, 53(08): 2341-2349. The public can obtain this material from the Veterinary Research Institute of the Guangxi Zhuang Autonomous Region to repeat this experiment; pMD18-T vector was from Bao Ri Yi Biotechnology (Beijing) Co., Ltd.; GST tag protein purification kit was from Biyuntian Biotechnology Co., Ltd.; alkaline phosphatase-labeled goat anti-mouse IgG (H+L) was from Biyuntian Biotechnology Co., Ltd.; FITC-labeled goat anti-mouse IgG was from Biyuntian Biotechnology Co., Ltd.; complete Freund's adjuvant was from Sigma; incomplete Freund's adjuvant was from Sigma; HAT was from Sigma.

[0048] Example 1 Amplification of ARVσC gene and construction of recombinant plasmid

[0049] Primers were designed based on the ARV S1 gene sequence in GenBank (accession number: AF330703.1). The primer sequences are shown in Table 1. Total RNA of the ARV S1133 strain was extracted and reverse transcribed into cDNA, which was used as a template to amplify the σC gene (the nucleotide sequence of the σC gene is shown in Sequence 1, and its corresponding protein sequence is shown in Sequence 2). The amplification results are shown in Table 1. Figure 1As shown in (A), a single band of about 981 bp was obtained, which was consistent with expectations. The σC gene was connected to the pMD18-T vector and then double-digested. The σC gene was then connected to the pGEX-6P-1 expression vector to construct the pGEX-6P-1-σC recombinant plasmid. The recombinant plasmid was double-digested with restriction endonucleases BamHI and SmaI. The results are shown in Figure 1 As shown in (B), two bands were obtained by gel electrophoresis detection of the enzyme digestion product, namely the pGEX-6P-1 vector band of about 4900 bp and the σC gene fragment of 981 bp, indicating that the pGEX-6P-1-σC recombinant plasmid was successfully constructed.

[0050] Table 1 Primer sequences

[0051] name Primer sequences ARV-F CGGGATCCATGGCGGGTCTCAATCCATC (sequence 3) ARV-R TCCCCCGGGTTAGGTGTCGATGCCGGT (sequence 4)

[0052] Example 2 Expression and identification of recombinant σC protein

[0053] Expression of recombinant σC protein: The pGEX-6P-1-σC recombinant plasmid was transformed into BL21, and a single positive bacterium was picked up for culture at 37°C shaking incubator. When OD600 reached about 0.8, IPTG with a final concentration of 1 mmol / L was added, and the expression was induced at 16°C for 8 hours. The induced bacterial precipitate was resuspended in cell lysis buffer containing protease inhibitors, and ultrasonically lysed on ice. A small amount of protein sample was added to 4× protein loading buffer and incubated in a 100°C boiling water bath for 10 minutes, and then SDS-PAGE electrophoresis was performed to verify the expression of the recombinant protein. The results showed that a large amount of recombinant σC protein could be detected in the protein sample of the induced pGEX-6P-1-σC recombinant plasmid positive bacteria, while a large amount of recombinant σC protein was not detected in the protein sample of the uninduced pGEX-6P-1-σC recombinant plasmid positive bacteria ( Figure 2 A).

[0054] Solubility identification: The bacterial precipitate after induced expression was resuspended in PBS, lysozyme and protease inhibitors were added and mixed, and ultrasonic lysis was performed on ice until the solution was clear. The whole bacterial solution, supernatant and precipitate were taken for SDS-PAGE electrophoresis respectively. At the same time, the induced pGEX-6P-1 empty vector bacterial solution was used as a control to analyze the soluble expression of the recombinant protein. The results showed that the recombinant σC protein was mainly present in the supernatant after ultrasonic lysis of the bacterial cells ( Figure 2 B).

[0055] Purification of recombinant σC protein: The recombinant protein was purified using a GST tag protein purification kit. The positive bacteria of the pGEX-6P-1-σC recombinant plasmid were expanded and induced to express. Then the bacterial precipitate was collected and fully resuspended in a lysis buffer containing protease inhibitors and lysozyme. The cells were ultrasonically lysed on ice. The lysate was centrifuged at 12000r / min for 15min at 4°C. The supernatant of the lysate was collected and mixed with the pre-treated BeyoGold TM The GST-tag Purification Resin was slowly shaken and bound at 4°C for 60 minutes, then transferred to the empty column tube of the affinity chromatography column, the column was washed with lysis buffer, and the target protein was eluted with elution buffer. Finally, the eluted target protein was detected by SDS-PAGE electrophoresis and photographed to observe the purification results. The results showed that most of the impurities were removed after purification, and a high-purity σC recombinant protein ( Figure 3 ).

[0056] Western blotting identification: The protein products expressed by the pGEX-6P-1 empty vector and the pGEX-6P-1-σC recombinant plasmid were placed in a boiling water bath at 100°C for 10 minutes, and the protein samples were obtained by centrifugation. The protein samples were separated by SDS-PAGE, and then the proteins were transferred to a polyvinylidene fluoride (PVDF) membrane. The PVDF membrane was blocked with 5% skim milk powder at 4°C overnight; ARV positive serum was used as the primary antibody, and alkaline phosphatase-labeled goat anti-mouse IgG (H+L) was used as the secondary antibody for incubation. The BCIP / NBT alkaline phosphatase colorimetric kit was used for colorimetric observation. The results showed that the protein expressed by the pGEX-6P-1-σC recombinant plasmid could detect a specific band at about 62kD, while this specific band could not be detected in the empty vector control group, indicating that the recombinant σC protein was correctly expressed ( Figure 4 ).

[0057] Example 3 Preparation of monoclonal antibodies

[0058] 1. Immunization of BALB / c mice with recombinant protein

[0059] The purified protein was mixed with an equal volume of complete Freund's adjuvant and emulsified. 8-week-old BALB / c mice were selected for intraperitoneal injection and subcutaneous multi-point injection immunization (100 μg each). The second and third immunizations were performed with protein emulsified with incomplete Freund's adjuvant every 3 weeks. Two weeks after the third immunization, tail venous blood was collected to detect antibody titer, and mice with ideal titer were selected for intraperitoneal injection of 300 μg of adjuvant-free protein per mouse for booster immunization.

[0060] 2. Cell Fusion

[0061] Three days after booster immunization, the spleen of mice was crushed and filtered under sterile conditions to obtain spleen cells, which were mixed with Sp2 / 0 cells at a ratio of 5:1, and then fused under the action of 50% PEG preheated to 40°C, and the fused cells were cultured in HAT medium. On the 5th to 6th day after fusion, the cells were observed and the culture wells of the single cell colony were marked. When the hybridoma cell colony grew to one-tenth of the culture well, the culture supernatant was collected, and 100 μL / well of ARVσC protein (8 μg / mL) was used as the coating antigen. The ELISA detection method was established with non-immunized mouse serum as the negative control and immune mouse serum as the positive control, and the fusion cell culture supernatant was detected. The single cell colony positive wells with high titer were subcloned 4 times by limiting dilution method to obtain a stable ARVσC monoclonal antibody hybridoma cell line, named ARV-σC-A12 cell line.

[0062] 3. Preparation of Monoclonal Antibody Ascites and Titer Determination

[0063] BALB / c mice were intraperitoneally injected with 0.5 mL of sterilized white oil. Seven days later, 1 mL of hybridoma cells (1.0 × 10 5 The antibody titer of the ascites was 1×10 5 In the above, ARV-σC-A12 cell line can induce mice to produce high-titer antibodies.

[0064] Example 3 Monoclonal Antibody Subtype Identification and Specificity Identification

[0065] The antibody subtype was identified using a mouse monoclonal antibody subtype identification kit, and the results showed that the antibody heavy chain secreted by the ARV-σC-A12 cell line was of IgG1 subtype, and the light chain was a Kappa chain.

[0066] LMH cells were cultured in a 24-well cell plate, and infected with ARV S1133 virus when the cells were in good growth state and the confluence reached 80% to 90%. After adsorption at 37°C for 1 hour, the virus solution was discarded, and cell maintenance solution containing 2.5% FBS was added to continue culture. At the same time, an uninfected group was set up as a negative control. After 24 hours of culture, the culture medium was discarded when the cells showed lesions, and the cells were fixed with pre-cooled methanol (containing 3% H2O2) at room temperature for 5 minutes. The ARV-σC-A12 hybridoma cell culture supernatant was used as the primary antibody, and FITC-labeled goat anti-mouse IgG was used as the secondary antibody for incubation. After washing with PBS three times, the cells were observed under a fluorescence microscope. The results showed that bright green fluorescence could be observed in the LMH cells in the virus-infected group under a fluorescence microscope, while no green fluorescence was observed in the cells that were not infected with the virus ( Figure 5), indicating that the monoclonal antibody secreted by the ARV-σC-A12 cell line can specifically bind to LMH cells infected with the ARV S1133 virus.

[0067] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Hybridoma cell line ARV-σC-A12, whose deposit number is CCTCC NO: C202459.

2. The monoclonal antibody secreted by the hybridoma cell line CCTCC NO: C202459 according to claim 1.

3. Use of the hybridoma cell line CCTCC NO: C202459 of claim 1 in preparing a product; the function of the product is as follows (a), (b) or (c): (a) Detection of avian reovirus S1133 strain σC protein; (b) Detection of avian reovirus S1133 strain; (c) Detecting whether the sample to be tested contains the avian reovirus S1133 strain.

4. Use of the monoclonal antibody according to claim 2 in the preparation of a product; the function of the product is as follows (a), (b) or (c): (a) Detection of avian reovirus S1133 strain σC protein; (b) Detection of avian reovirus S1133 strain; (c) Detecting whether the sample to be tested contains the avian reovirus S1133 strain.

5. A kit comprising the hybridoma cell line ARV-σC-A12 according to claim 1; the functions of the kit are as follows (a), (b), or (c): (a) Detection of avian reovirus S1133 strain σC protein; (b) Detection of avian reovirus S1133 strain; (c) Detecting whether the sample to be tested contains the avian reovirus S1133 strain.

6. A kit comprising the monoclonal antibody according to claim 2; the functions of the kit are as follows (a), (b) or (c): (a) Detection of avian reovirus S1133 strain σC protein; (b) Detection of avian reovirus S1133 strain; (c) Detecting whether the sample to be tested contains the avian reovirus S1133 strain.

7. A test strip, characterized in that: The T line of the detection pad is coated with ARV-σC-A12 antibody, and the C line of the detection pad is coated with anti-mouse IgG antibody; the ARV-σC-A12 antibody is the monoclonal antibody according to claim 2.

8. Use of the test strip according to claim 7 in preparing a product; the function of the product is as follows (a), (b) or (c): (a) Detection of avian reovirus S1133 strain σC protein; (b) Detection of avian reovirus S1133 strain; (c) Detecting whether the sample to be tested contains the avian reovirus S1133 strain.

9. A method for preparing a monoclonal antibody that specifically binds to the σC protein of avian reovirus S1133 strain, characterized in that: The method comprises culturing the hybridoma cell line of claim 1.

Images