Wheat grain weight related SNP-546 site and application thereof

Abstract

The invention discloses a wheat grain weight related SNP-546 site and application thereof, the SNP site corresponds to the 546th basic group from the 5'tail end of a sequence as shown in SEQ ID NO.1, and when the site is A / A homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; the grain weight of the genotype A wheat is greater than or candidate to be greater than that of genotype B wheat. The SNP has high effectiveness and potential application value, wheat with large grain weight can be found by detecting the SNP, and the SNP has important value in research or application of cultivation of high-yield wheat varieties.

Description

Technical Field

[0001] The invention relates to the field of molecular biotechnology, in particular to a SNP-546 site related to wheat grain weight and an application thereof. Background Art

[0002] Wheat is one of the three major grain crops in the world, and its high and stable yield is of great significance to ensuring national food security. In breeding and production practice, thousand-grain weight is one of the important indicators to measure the size of wheat grains. Large thousand-grain weight indicates that the wheat grains are fuller, have more dry matter accumulation, higher starch content and better flour quality. The thousand-grain weight of wheat is not only directly related to yield and milling quality, but also affects the vitality and growth of wheat seedlings, and indirectly affects the growth of plants and the final yield of wheat. Therefore, the discovery of the QTL (quantitative trait loci) segment controlling wheat thousand-grain weight and its superior allele variation provides a theoretical basis for the genetic improvement of grain weight using molecular marker-assisted selection and the further application of major effect QTL, and is of great significance to the genetic improvement of wheat yield traits.

[0003] At present, researchers have located a large number of QTLs that regulate thousand-grain weight. Wheat grain weight affects wheat yield by regulating thousand-grain weight. Guan Panfeng et al. (2018) from China Agricultural University used DH populations derived from common winter wheat Nongda 3338 (small grain) and Jingdong 6 (large grain) to locate thousand-grain weight QTLs that are stably expressed under multiple environmental conditions on chromosomes 4A and 4B. The thousand-grain weight QTLs on chromosomes 4A and 4B were further decomposed, finely located, and candidate genes predicted. Among them, the molecular markers of the chromosome segment where the thousand-grain weight QTL locus QTgw-4A on chromosome 4A is located were encrypted, and 16 SSR markers were added to the interval where the thousand-grain weight QTL locus is located; molecular markers were developed for the known grain weight-related genes TaARGOS-4A, TaSnRK2.10, TaCWI-4A, TaTGW6 and TaGS3-4A on chromosome 4A, and their genetic positions were anchored; the QTgw-4A locus was relocated using the encrypted map, and QTgw-4A was located between the SSR markers Xcau4A11 and Xcau4A13, with a genetic distance of 5.73cM. This interval does not contain known grain weight-related genes and may correspond to a new wheat grain weight gene. The QTgw-4A locus allele variation analysis was performed using 688 wheat natural population materials, and it was found that the large-grain allele variation type of Jingdong 6 had a low distribution frequency, accounting for about 13.66%; a double polymorphic SSR molecular marker Xcau4A10 tightly linked to the QTgw-4A locus was developed and can be used to assist in selective breeding; the large-grain allele of Jingdong 6 was introduced into the spring wheat variety Yong 3002 through backcrossing, which significantly increased the thousand-grain weight.

[0004] Su Zhenqi (2010) et al. developed a CAPS marker based on the sequence difference of the large-grain and small-grain TaGW2-6A alleles in the promoter region, targeting SNP-593 difference and using TaqI endonuclease as a tool. The marker was verified by scanning the population to be stable, reliable and co-dominant, which is an ideal marker type for the TaGW2-6A allele. The regulatory function of TaGW2-6A on wheat grain width and grain weight was verified in the wheat micro-core germplasm population by candidate gene association analysis. The results of association analysis showed that TaGW2-6A mainly affects wheat grain width and grain weight, and its biological function is similar to that of OsGW2. The large-grain allele Hap-6A-A is an excellent allele type compared with Hap-6A-G. In modern bred varieties, the former has an average positive effect on 1,000-grain weight that is about 3.1 g higher than the latter, and it has an average early heading of 3.5 days and early maturity of 2.5 days. Therefore, compared with Hap-6A-G, Hap-6A-A is the superior allele variant type of TaGW2-6A, and the CAPS Marker of this gene can be used as a functional marker to detect large grain and early-maturing genes. TaGW2-6A was located near the centromere of the short arm of wheat chromosome 6A using the RIL population (Xiaoyan 54 / Jing 411), between Xcfd80 and Xbarcl46. This is consistent with the QTL loci that control grain width and 1000-grain weight on wheat chromosome 6A detected previously. By comparing the positioning results, it is further proved that TaGW2-6A regulates grain width and 1000-grain weight.

[0005] Although a large number of QTLs related to wheat grain weight have been located, most of them have small phenotypic contribution rates and poor repeatability between different years and environments, so these QTLs are difficult to apply to the genetic improvement of wheat grain weight. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a SNP-546 site related to wheat grain weight and an application thereof.

[0007] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0008] A SNP site associated with wheat grain weight, the SNP site corresponds to the 546th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is A / A homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; the grain weight of wheat of the A genotype is greater than or has a candidate greater than the grain weight of wheat of the B genotype.

[0009] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in identifying the wheat grain weight trait, which is used to detect the SNP site. The gene detection kit contains a PCR amplification specific primer combination and enzyme cutting component corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0010] As a preferred technical solution of the present invention, the target DNA fragment amplified by PCR in the reagent or kit is designed to be 521-622 bp at the 5' end of SEQ ID NO.1.

[0011] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0012] As a preferred technical solution of the present invention, the enzyme cutting component is a restriction endonuclease KpnI.

[0013] On the other hand, the present invention also includes a primer combination for detecting the single nucleotide polymorphism of the following SNP site in the wheat genome, wherein the SNP site corresponds to the 546th base from the 5' end of the sequence shown in SEQ ID NO.1, and when the site is homozygous for A / A, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence list, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ IDNO.5; this primer combination is used to detect the SNP site described in claim 1.

[0014] On the other hand, the present invention also includes a method for identifying or assisting in identifying wheat genotypes, wherein any DNA fragment containing the SNP site of claim 1 in the wheat genomic DNA to be tested is subjected to PCR amplification, and the PCR amplification product is subjected to enzyme digestion for identification; the DNA fragment amplified by PCR is 521-622 bp at the 5' end of SEQ ID NO.1; the specific primer pair for PCR amplification is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 1F and 1R composed of SEQ ID NO.4 and SEQ ID NO.5 composed of primer pairs 2F and 2R; the enzyme cutting includes the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 20 to 50 times, using it as a template, and amplifying to obtain a PCR product with primers 2F and 2R as a primer pair; using restriction endonuclease KpnI to cut the PCR product; if the PCR product can be cut, the nucleotide polymorphic site is A / A and the genotype is A; if the PCR product cannot be cut, the nucleotide polymorphic site is G / G and the genotype is B; the grain weight of the wheat of the A genotype is greater than or is candidate greater than the grain weight of the wheat of the B genotype.

[0015] In the last aspect, the present invention also includes the use of the SNP site in identifying or assisting in identifying the wheat grain weight trait.

[0016] The beneficial effect of adopting the above technical scheme is that: the research group of the present invention has found 4 SNPs in the coding region through genetic variation analysis of genes of natural variation population of wheat, which correspond to the 199th, 546th, 674th and 840th positions from the 5' end of sequence table 1 respectively; among them, the 546th SNP has main effect and stability. By designing dCAPS marker for the 546th SNP site, it is found that there are two genotypes of this SNP: genotype A (A) and genotype B (G). It is proved by association analysis that in the homozygous types of these two genotypes, the thousand-grain weight is: wheat homozygous for genotype A> wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with higher thousand-grain weight can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in agricultural practice and / or related scientific research for cultivating high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is a diagram of the gene structure pattern and SNP site;

[0018] Figure 2It is a schematic diagram of the electrophoresis detection results of the SNP development dCAPS marker digestion product of the present invention; wherein, M is used as a molecular weight standard; lane A is a band that can be cut by KpnI, and lane G is a band that cannot be cut by KpnI;

[0019] Figure 3 It is a schematic diagram of the correlation analysis of thousand-grain weight;

[0020] Figure 4 This is a schematic diagram of gene SNP sites and typing in 385 wheat population materials. DETAILED DESCRIPTION

[0021] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are all conventional commercial products and can be directly obtained through market purchase. The materials, reagents, etc. used in the following examples. Unless otherwise specified, they can all be obtained from commercial sources. The wheat materials used in the following examples are all from the National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm), and the material information is available on the China Crop Germplasm Information Network, website: http: / / icgr.caas.net.cn. It should be understood that when used in the present application specification and the attached claims, the term "including" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in the present application specification and the attached claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0022] As used in the specification of the present application and the appended claims, the term "if" can be interpreted as "when..." or "once" or "in response to determination" or "in response to detection" according to the context. Similarly, the phrase "if it is determined" or "if [the described condition or event] is detected" can be interpreted as meaning "once it is determined" or "in response to determination" or "once [the described condition or event] is detected" or "in response to detection [the described condition or event]" according to the context. In addition, in the description of the specification of the present application and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the description and cannot be understood as indicating or implying relative importance. The reference "one embodiment" or "some embodiments" described in the specification of the present application means that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Thus, the sentences "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in the specification are not necessarily all referring to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "include", "comprising", "having" and variations thereof all mean "including but not limited to", unless specifically emphasized otherwise.

[0023] Example 1. Detection of SNPs associated with wheat grain weight and their PCR-enzyme polymorphism

[0024] 1. Specific primers for amplifying the genome fragment containing the wheat SNP and sequence analysis

[0025] like Figure 1 As shown, a SNP was found in the coding region of the wheat genome, corresponding to the 546th position from the 5' end of SEQ ID NO.1 in the sequence list. By designing a dCAPS marker for the SNP site, it was found that there were two genotypes at this site in the natural variation population of wheat:

[0026] Genotype A: A

[0027] Genotype B: G

[0028] According to the sequence differences of different wheat genomes, specific primers were designed to PCR amplify the DNA fragments containing the SNP sites:

[0029] F1: CCAGGCCTCCCAGATGATG (SEQ ID NO: 2);

[0030] R1: GTAGTAATAGTGCTGCTAAT (SEQ ID NO: 3);

[0031] F2: GCGGCGCCGCACATTGGCAGCTCGT (SEQ ID NO: 4);

[0032] R2: CGCGGCATTGAGCACCGGCATGGAG (SEQ ID NO: 5);

[0033] The target sequence amplified by PCR using F1 and R1 as primers is the 85-1195 bp sequence shown in Sequence 1 of the sequence list; the target sequence amplified by PCR using F2 and R2 as primers is the 521-622 bp sequence shown in Sequence 1 of the sequence list. Enzyme digestion analysis showed that the polymorphisms can be recognized by KpnI respectively.

[0034] 2. Establishment of PCR-enzyme digestion polymorphism detection and genotyping method

[0035] 1) Extracting genomic DNA of wheat to be tested;

[0036] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (20 μL) is: 16.8 μL ddH2O, 0.2 μL KOD, 1 ul dNTP, 0.5 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (50-100 ng / μL).

[0037] The PCR amplification conditions were as follows: 95°C for 3 min; 95°C for 30 s, 58°C for 30 s, 72°C for 30 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0038] 3) The PCR product of step 2) was diluted 20 to 50 times, and used as a template to perform PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) was: 7 μL ddH2O, 10 μL 2×TaqMix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (20 ng / μL).

[0039] The PCR amplification conditions were as follows: 95°C for 3 min; 95°C for 30 s, 58°C for 10 s, 72°C for 10-12 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0040] 4) The PCR product obtained in step 3) is digested with KpnI to obtain the digestion product, and then the digestion product is detected by 4% agarose gel electrophoresis. It is recorded whether the PCR product is cut into two fragments, and the situation of the wheat to be tested at the said site is determined and recorded according to the following method:

[0041] If the enzyme cleavage product is one or larger fragments, the wheat to be tested is G homozygous (expressed as G / G) at the site (e.g. Figure 2 Lane G in the figure);

[0042] If the enzyme cleavage product is one or a smaller fragment, the wheat to be tested is A homozygous (expressed as A / A) at the site (e.g. Figure 2 Lane A in the figure.

[0043] According to the result of step 4), the wheat is divided into two types, I and II, as follows:

[0044] I: A / A (i.e., homozygous for genotype A);

[0045] II: G / G (i.e., homozygous for genotype B);

[0046] The " / " before the " / " refers to the situation on one homologous chromosome, and the " / " after the " / " refers to the situation on the other homologous chromosome.

[0047] 3. Use dCAPS markers to genotype natural populations and conduct association analysis with grain weight traits

[0048] Each wheat in the natural population consisting of 320 hexaploid wheats was used as the wheat to be tested, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.

[0049] Table 1 The situation of the polymorphic sites in natural wheat populations

[0050]

[0051]

[0052]

[0053]

[0054] Example 2

[0055] Our technical team conducted exon capture sequencing on 385 materials and performed specific genotyping on these materials, including genotype A homozygous C / C and genotype B homozygous G / G. Figure 4 Among all 385 materials, 332 materials could be clearly distinguished as homozygous C / C of genotype A or homozygous G / G of genotype B, and the remaining 53 materials could not complete genotyping.

[0056] In addition, 320 of the 385 materials have multi-year and multi-point agronomic trait data, while the remaining 65 materials cannot meet the requirements of subsequent analysis due to insufficient data. Figure 3 As shown in Figure 1, only these 320 data points were used in the association analysis between the status of the natural population gene polymorphism sites and the number of spikes per plant. However, among these 320 data points, 3 materials were not genotyped, so the actual number of samples for association analysis was 317.

[0057] In 2018, the above natural population wheat was planted in the arid-hot land, dry land and hydrothermal land of Luancheng Experimental Station, Agricultural Resources Research Center, Chinese Academy of Sciences (Luancheng, Hebei); in 2019, the arid-hot land, dry land, hydrothermal land and water land of Hengshui Experimental Farm, Agricultural Resources Research Center, Chinese Academy of Sciences (Luancheng and Hengshui, Hebei); in 2020, the arid land and arid-hot land of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences (Zhaoxian Experimental Station) were planted. The thousand-grain weight of each wheat variety was investigated, and the Tassel2.1 software was used to perform association analysis on the thousand-grain weight and the polymorphic loci. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, and P<0.05 was set as the significance level. The results are shown in Table 2 and Table 2. Figure 3 shown.

[0058] Table 2 Results of association analysis between polymorphic loci in natural populations and thousand-grain weight

[0059]

[0060]

[0061] The results of association analysis in Table 2 show that the difference in thousand-grain weight between the two types formed by the natural population composed of 320 hexaploid wheats shown in Table 1 reached a significant level at three environmental points (P<0.05). Among them, the thousand-grain weight of wheat of type I was higher than that of wheat of type II. In several environments, the thousand-grain weight of wheat materials of type I was 0.62, 0.52, 0.24, 1.09, 0.61, 1.05, 0.52, 0.67, 0.35 and 1.32 grams higher than that of wheat of type II, respectively. Studies on natural populations have shown that type I is an excellent genotype for improving the thousand-grain weight of wheat.

[0062] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0063] From the above embodiments, it can be seen that the present invention discloses a SNP-546 site related to wheat grain weight and its application. Through the genetic variation analysis of the gene coding region of the natural variation population of wheat, the present invention found that there is a SNP, corresponding to the 546th position from the 5' end of Sequence Table 1, and the SNP has two genotypes: genotype A (A) and genotype B (G). Association analysis has proved that in the homozygous types of these two genotypes, the thousand-grain weight is: wheat homozygous for genotype A> wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher thousand-grain weight can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yield wheat varieties or research.

[0064] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. A SNP locus associated with wheat grain weight, characterized in that: The SNP site corresponds to the 546th base from the 5' end of the sequence shown in SEQ ID NO.

1. When the site is homozygous for A / A, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the grain weight of wheat of the A genotype is greater than or has the potential to be greater than the grain weight of wheat of the B genotype.

2. A reagent or kit for identifying or assisting in identifying the weight trait of wheat grains, characterized in that: The reagent or kit is used to detect the SNP site described in claim 1, and the reagent or kit comprises a PCR amplification specific primer combination and an enzyme cutting component corresponding to the SNP site, as well as a template DNA, a buffer, dNTPs and other necessary components for gene detection.

3. The reagent or kit according to claim 2, characterized in that: The target DNA fragment amplified by PCR in the reagent or kit is designed to be 521-622 bp at the 5' end of SEQ ID NO.

1.

4. The reagent or kit according to claim 2, characterized in that: The PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.

5.

5. The reagent or kit according to claim 2, characterized in that: The enzyme cutting component is the restriction endonuclease KpnI.

6. A primer combination, characterized in that: Used to detect the single nucleotide polymorphism of the following SNP site in the wheat genome, the SNP site corresponds to the 546th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is A / A homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; the primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence table, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the SNP site described in claim 1.

7. A method for identifying or assisting in identifying wheat genotypes, characterized in that: A DNA fragment containing the SNP site of claim 1 in any section of the wheat genomic DNA to be tested is amplified by PCR, and the PCR amplification product is identified by enzyme digestion; the DNA fragment amplified by PCR is 521-622bp at the 5' end of SEQ ID NO.1; the specific primer pair for PCR amplification is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the enzyme digestion comprises the following steps: The PCR product was obtained by using wheat genomic DNA as template and primers 1F and 1R as primer pair; The PCR product was diluted 20 to 50 times, used as a template, and primers 2F and 2R were used as a primer pair to amplify the PCR product; the PCR product was digested with restriction endonuclease KpnI; If the PCR product can be cut, the nucleotide polymorphic site is A / A and the genotype is A; if the PCR product cannot be cut, the nucleotide polymorphic site is G / G and the genotype is B; the grain weight of the A genotype wheat is greater than or has the potential to be greater than the grain weight of the B genotype wheat.

8. Use of the SNP locus according to claim 1 in identifying or assisting in identifying the wheat grain weight trait.

Images