Chicken Marek's disease virus miR-M6-5p gene deleted strain and application thereof

Abstract

The invention belongs to the technical field of biological vaccines, and particularly relates to a chicken Marek's disease virus miR-M6-5p gene deleted strain and application thereof. The invention provides a chicken Marek's disease virus miR-M6-5p gene deleted strain with the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.46202. The invention further provides a vaccine containing the chicken Marek's disease virus miR-M6-5p gene deletion strain and a preparation method of the vaccine. The replication level of the gene deletion strain on cells is remarkably increased, and the incidence of tumors caused by infection of chickens is reduced, so that the gene deletion strain can be used for research and development of chicken Marek's disease vaccines and has a good application prospect in prevention of chicken Marek's disease.

Description

Technical Field

[0001] The invention belongs to the technical field of biological vaccines, and specifically relates to a chicken Marek's disease virus miR-M6-5p gene deletion strain and an application thereof. Background Art

[0002] Marek's disease (MD) is a highly contagious tumor disease of poultry caused by Marek's disease virus (MDV). MDV is widely prevalent in poultry-raising countries and regions around the world, causing serious economic losses to the poultry industry. MDV infection can cause immunosuppression, increase the susceptibility of poultry to other pathogens, and produce mixed infections, which not only cause a decline in poultry production performance, but may also directly lead to poultry death. It has become one of the important diseases affecting my country's poultry industry.

[0003] The main prevention and control measure for MD at present is to vaccinate with the CVI988 attenuated vaccine. However, in recent years, highly pathogenic MDV variants have continued to appear in China, resulting in higher mortality and tumor incidence in poultry. After being vaccinated with the CVI988 attenuated vaccine, poultry infected with certain highly pathogenic MDV epidemic strains will still have an incidence rate of about 70% and a mortality rate of more than 50%, which brings new challenges to the current disease prevention and control. In addition, as a strictly cell-bound virus, the MDV vaccine requires the preparation of primary chicken embryo fibroblasts (CEF) to culture the virus during the production process, and the replication titer of the virus on CEF directly affects the production cost. Despite years of optimization of the production process, the virus titer of the MDV vaccine virus during the culture process is still significantly lower than that of other avian disease viruses.

[0004] MicroRNAs (miRNAs) are a class of single-stranded non-coding RNAs with a length of 20-25 nucleotides. The miRNA-mediated silencing complex (RISC) formed by miRNAs and proteins such as AGO2 recognizes and binds to the mRNA of miRNA target genes through base complementary pairing, and then achieves post-transcriptional regulation by degrading the target gene mRNA or inhibiting translation. Like other herpes viruses, MDV can encode miRNAs itself. The miRNAs encoded by MDV can be divided into three clusters according to their location in the genome, namely the meq gene cluster (miR-M2, M3, M4, M5, M9 and M12), the intermediate gene cluster (miR-M1, M11 and M31) and the LAT gene cluster (miR-M6, M7, M8, M10 and M13). After transcription and processing, 26 mature miRNAs are finally formed. RB1B is a very strong strain of MDV. Studying the role of miRNA in RB1B is of great significance for the development of new MD vaccines. Summary of the invention

[0005] The purpose of the invention is to reduce the production cost of chicken Marek's disease vaccine and the incidence of tumors caused by chicken Marek's disease virus.

[0006] To achieve the above object, the present invention provides a chicken Marek's disease virus miR-M6-5p gene deletion strain, whose deposit number is CGMCC No.46202.

[0007] The nucleotide sequence of the miR-M6-5p gene deleted in the chicken Marek's disease virus miR-M6-5p gene deleted strain is TCTGTTGTTCCGTAGTGTTCTC.

[0008] The use of the miR-M6-5p gene-deficient strain of Marek's disease virus in the preparation of Marek's disease vaccine also falls within the protection scope of the present invention.

[0009] The present invention also provides a virus solution comprising the chicken Marek's disease virus miR-M6-5p gene deletion strain.

[0010] The present invention also provides a vaccine comprising the chicken Marek's disease virus miR-M6-5p gene deletion strain.

[0011] Preferably, the vaccine is a live vaccine.

[0012] Preferably, the vaccination dose of the vaccine is 2000-2500 PFU per chicken.

[0013] The present invention also provides a method for preparing a chicken Marek's disease vaccine, which comprises: infecting chicken embryo fibroblasts with the chicken Marek's disease virus miR-M6-5p gene deletion strain, culturing the cells and harvesting the virus.

[0014] In the above method, chicken embryo fibroblasts infected with the chicken Marek's disease virus miR-M6-5p gene deletion strain can be placed at 37°C and 5% CO 2 Culture in an incubator.

[0015] In the above method, the virus is harvested when 70% to 80% of the chicken embryo fibroblasts show lesions.

[0016] The chicken Marek's disease virus miR-M6-5p gene deletion strain provided by the present invention is named RB1B-ΔmiR-M6-5p, which is a recombinant chicken Marek's disease virus RB1B strain with the miR-M6-5p gene removed. The results of in vitro biological characteristics showed that compared with the chicken Marek's disease virus RB1B strain, the replication level of RB1B-ΔmiR-M6-5p infected cells 72-120 hours increased significantly (experimental example 3). The results of animal experiments showed that compared with chickens infected with the chicken Marek's disease virus RB1B strain, the tumor incidence of chickens infected with RB1B-ΔmiR-M6-5p was reduced (experimental example 4). Therefore, the RB1B-ΔmiR-M6-5p provided by the present invention is applied to the research and development of chicken Marek's disease vaccine, which can reduce the cost of vaccine production and the tumor incidence of immune chickens, and has good application prospects in the prevention of chicken Marek's disease.

[0017] The patent deposit information of the chicken Marek's disease virus miR-M6-5p gene deletion strain is as follows:

[0018] Biomaterial (strain): MDV1-ΔmiR-M6-5p

[0019] Classification name: Marek's disease virus

[0020] Deposit date: October 10, 2024

[0021] Deposit number: CGMCC No.46202

[0022] Depository: China General Microbiology Center (CGMCC)

[0023] Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Agarose gel electrophoresis of the bacterial solution PCR products of the bacterial artificial chromosome clone of the RB1B strain of Marek's disease virus with the miR-M6-5p gene deleted; Lane M: DL2000bp; Lanes 1-10: PCR products of different colonies of the bacterial artificial chromosome clone of the RB1B strain of Marek's disease virus with the miR-M6-5p gene deleted; Lane NC: negative control (with ddH 2 O as template) of the PCR product.

[0025] Figure 2It is a microscope photo of chicken embryo fibroblasts (CEF) (magnification 50); the left picture shows the viral plaques formed after chicken embryo fibroblasts (CEF) were infected with the RB1B strain of Marek's disease virus lacking the miR-M6-5p gene (RB1B-ΔmiR-M6-5p); the right picture shows chicken embryo fibroblasts (CEF) that were not infected with the virus.

[0026] Figure 3 Agarose gel electrophoresis of PCR amplification products of RB1B-ΔmiR-M6-5p virus and RB1B-BAC virus; M: DL2000bp; Lanes 1-4: PCR amplification products of miR-M6-5p region; Lanes 5-8: PCR amplification products of viral meq gene; Lanes 1 and 5: amplification products using total DNA of CEF cells infected with RB1B-ΔmiR-M6-5p virus as template; Lanes 2 and 6: amplification products using total DNA of CEF cells infected with RB1B-BAC virus as template; Lanes 3 and 7: amplification products using total DNA of CEF cells not infected with virus as template; Lanes 4 and 8: amplification products using ddH 2 O is the amplification product of the template.

[0027] Figure 4 It is a part of the sequencing results of the amplified products of the miR-M6-5p region of the RB1B-ΔmiR-M6-5p virus and the RB1B-BAC virus, showing the miR-M6-5p gene (TCTGTTGTTCCGTAGTGTTCTC) (SEQ ID NO: 3) missing from the RB1B-ΔmiR-M6-5p virus.

[0028] Figure 5 The fluorescence quantitative PCR detection results of miR-M6-5p expression in different strains; Mock represents blank control (CEF cells not infected with the virus).

[0029] Figure 6 The in vitro replication curves of RB1B-ΔmiR-M6-5p virus and RB1B-BAC virus.

[0030] Figure 7 This is the pGalK plasmid map.

[0031] Figure 8 This is the plasmid map of pEPkan-S.

[0032] Fig. 9 This is the plasmid map of pDS-pHA1.

[0033] Sequence Description

[0034] SEQ ID NO:1 is the nucleotide sequence of the galK gene fragment with homologous sequences at both ends of miR-M6-5p (referred to as M6-galK fragment).

[0035] SEQ ID NO:2 Nucleotide sequence of the kan gene fragment with homologous sequences at both ends of miR-M6-5p (referred to as M6-kan fragment).

[0036] SEQ ID NO:3 Nucleotide sequence of the miR-M6-5p gene deleted from the viral RB1B-ΔmiR-M6-5p.

[0037] SEQ ID NO:4 Nucleotide sequence of the meq gene of the virus.

[0038] SEQ ID NO: 5 to SEQ ID NO: 18 are nucleotide sequences of PCR primers used in the construction of virus RB1B-ΔmiR-M6-5p. DETAILED DESCRIPTION

[0039] The following embodiments are provided:

[0040] 1. The miR-M6-5p gene-deficient strain of Marek's disease virus, whose deposit number is CGMCC No.46202.

[0041] 2. The chicken Marek's disease virus miR-M6-5p gene deletion strain described in Example 1, wherein the nucleotide sequence of the deleted miR-M6-5p gene is TCTGTTGTTCCGTAGTGTTCTC.

[0042] 3. Use of the miR-M6-5p gene-deficient strain of Marek's disease virus described in Example 1 in the preparation of Marek's disease vaccine.

[0043] 4. A virus solution comprising the miR-M6-5p gene-deficient strain of Marek's disease virus described in Example 1.

[0044] 5. Cells comprising the chicken Marek's disease virus miR-M6-5p gene deletion strain described in Example 1.

[0045] 6. The cells described in Example 5 are chicken embryo fibroblasts.

[0046] 7. A vaccine comprising the miR-M6-5p gene-deficient strain of Marek's disease virus described in Example 1.

[0047] 8. The vaccine described in Example 7 is a live vaccine.

[0048] 9. The vaccine described in Example 8 is the virus liquid of the chicken Marek's disease virus miR-M6-5p gene deleted strain described in Example 1.

[0049] 10. The vaccine described in Example 8, wherein the vaccine is the cell described in Example 5 or 6.

[0050] 11. The vaccine described in any one of Examples 7 to 10, wherein the vaccination dose is 2000 to 2500 PFU per chicken.

[0051] 12. A method for preparing a Marek's disease vaccine, comprising: infecting chicken embryo fibroblasts with the Marek's disease virus miR-M6-5p gene deletion strain described in Example 1, culturing the cells and harvesting the virus.

[0052] 13. The method described in Example 12, wherein the chicken embryo fibroblasts infected with the miR-M6-5p gene deletion strain of Marek's disease virus are placed at 37°C and 5% CO 2 Culture in an incubator.

[0053] 14. The method described in Example 12 or 13, wherein the virus is harvested when the chicken embryo fibroblasts show 70% to 80% lesions.

[0054] 15. The method described in any one of Examples 12 to 14, wherein the method for harvesting the virus is to directly collect the cells.

[0055] 16. The method described in any one of Examples 12 to 14, wherein the method for harvesting the virus is to lyse the cells and then centrifuge to obtain the supernatant, and the supernatant is the virus liquid.

[0056] 17. The method described in Example 16, wherein the cells are lysed by repeated freezing and thawing, enzymatic hydrolysis or ultrasonic disruption.

[0057] The present invention is further explained below in conjunction with experimental examples. It should be understood that the following experimental examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0058] If not otherwise specified, the reagents used in the following experimental examples are all conventional reagents in the art, which can be obtained commercially or prepared according to conventional methods in the art, and the specifications are laboratory pure. If not otherwise specified, the experimental methods and conditions used in the following experimental examples are all conventional experimental methods and conditions in the art, and reference can be made to relevant experimental manuals, known documents or manufacturer specifications. Unless otherwise defined, the meanings of all technical and scientific terms used herein are the same as those generally understood by those of ordinary skill in the art to which the present invention belongs.

[0059] The pGalK plasmid used in the following experiments ( Figure 7 ) and pEPkan-S plasmid ( Figure 8) are all commercially available plasmids purchased from Addgene Plasmid Depository in the United States.

[0060] The Escherichia coli SW102 (abbreviated as SW102-RB1B-BAC) containing the bacterial artificial chromosome (BAC) of Marek's disease virus RB1B strain used in the following experimental examples was constructed and maintained by our laboratory. The construction method refers to the construction method of the BAC clone of the highly virulent MDV strain RB-1B described in the article "Petherbridge L, Brown AC, Baigent SJ, et al. Oncogenicity of Virulent Marek's Disease Virus Cloned as Bacterial Artificial Chromosomes [J]. Journal of Virology, 2004, 78 (23): 13376-13380."

[0061] The Marek's disease virus RB1B strain, pDS-pHA1 plasmid and Escherichia coli SW102 were used in the construction of the above SW102-RB1B-BAC. The Marek's disease virus RB1B strain is described in "Schat KA, Calnek BW, Fabricant J. Characterization of two highly oncogenic strains of Marek's disease virus [J]. Avian Pathology, 1982, 11 (4): 593-605." The public can obtain the strain from Beijing Academy of Agriculture and Forestry Sciences; pDS-pHA1 plasmid ( Fig. 9 ) is a commercially available plasmid purchased from the Addgene Plasmid Depository in the United States; Escherichia coli SW102 is described in the article "Sren W, Nina C, Court DL, et al. Simple and highly efficient BAC recombineering using galK selection [J]. Nucleic Acids Research, 2005 (4): 4." The public can obtain this strain from Beijing Academy of Agriculture and Forestry Sciences.

[0062] The chicken embryo fibroblasts (CEF) used in the following experimental examples were prepared by our laboratory using 9-day-old specific pathogen free (SPF) chicken embryos. The SPF chickens used were white Leghorn breeds purchased from Beijing Boehringer Ingelheim Weitong Biotechnology Co., Ltd.

[0063] The main reagents used in the following experiments include: High-Fidelity 2X Master Mix was purchased from NewEngland Biolabs Co., Ltd.; agarose gel recovery kit was purchased from Omega Biotechnology Co., Ltd.; 2×T5Super PCR Mix was purchased from Beijing Qingke Biotechnology Co., Ltd.; L-arabinose was purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd.; PureLink TM HiPure Plasmid Maxi Kit and Lipofectamine TM 3000 transfection reagent was purchased from Thermo Fisher Scientific (China) Co., Ltd.; blood / cell / tissue genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; total RNA rapid extraction kit was purchased from Shanghai Feijie Biotechnology Co., Ltd.; Hairpin-it miRNA qRT-PCR quantitative kit was purchased from Suzhou Jima Biotechnology Co., Ltd.; fluorescent quantitative SYBR Green Supermix was purchased from Bio-Rad Life Sciences Products (Shanghai) Co., Ltd.

[0064] Table 1 PCR primers used in the following experimental examples

[0065]

[0066] Experimental Example 1

[0067] Construction of a bacterial artificial chromosome (BAC) clone of the Marek's disease virus (MDV) RB1B strain lacking the miR-M6-5p gene

[0068] Primers were designed based on the genome sequence of Marek's disease virus RB1B strain (GenBank: MZ054335.1) to construct the miR-M6-5p gene-deficient MDV RB1B BAC clone. All primers in Table 1 were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0069] Using pGalK plasmid as template, using M6-galk-F and M6-galk-R primers in Table 1, amplify the galK gene fragment with homologous sequences at both ends of miR-M6-5p (referred to as M6-galK fragment, whose nucleotide sequence is shown in SEQ ID NO: 1) by polymerase chain reaction (PCR). Using pEPkan-S plasmid as template, using M6-kan-F and M6-kan-R primers in Table 1, amplify the kan gene fragment with homologous sequences at both ends of miR-M6-5p (referred to as M6-kan fragment, whose nucleotide sequence is shown in SEQ ID NO: 2) by PCR. The PCR reaction system is: 25 μL High-Fidelity 2X Master Mix, 2.5 μL forward primer (10 μM), 2.5 μL reverse primer (10 μM), 1 μL template (10 ng), 19 μL ddH 2 O. The PCR reaction program was: (98°C 30s) 1 cycle; (98°C 10s, 56°C 30s, 72°C 1min) 35 cycles; (72°C 2min) 1 cycle. The PCR products were detected by agarose gel electrophoresis, and the target fragments were recovered and purified using the Omega agarose gel recovery kit to obtain the M6-galK fragment and the M6-kan fragment.

[0070] The purified M6-galK fragment and M6-kan fragment were successively electroporated into competent cells of Escherichia coli SW102 (abbreviated as SW102-RB1B-BAC) containing the bacterial artificial chromosome of the Marek's disease virus RB1B strain to replace two copies of the miR-M6-5p gene. The electroporation conditions are: 1800V, 25μF, 200Ω. After electroporation, 3mL of LB liquid culture medium was quickly added and shaken in a 32°C incubator for 2 hours. The bacteria were collected by centrifugation, most of the supernatant was removed, and the bacteria were resuspended with the remaining liquid and the bacterial solution was spread on the LB plate and inverted in a 32°C incubator for 3-5 days. A single clone was picked and inoculated into LB liquid culture medium. After shaking and culturing in a 32°C incubator for 12 hours, the M6-F and M6-R primers in Table 1 were used for bacterial solution PCR identification. The PCR reaction system was as follows: 10 μL 2×T5 Super PCR Mix, 1 μL M6-F (10 μM), 1 μL M6-R (10 μM), 1 μL bacterial solution, 7 μL ddHO 2 O. The PCR reaction program was: (98℃5min) 1 cycle; (98℃10s, 56℃15s, 72℃20s) 35 cycles; (72℃2min) 1 cycle. PCR products were detected by agarose gel electrophoresis. The recombinant strain with the correct identification result was named SW102-RB1B-galK-kan.

[0071] The homologous complementary single-stranded sequences at both ends of miR-M6-5p (M6-galk-DE-F and M6-galk-DE-R in Table 1) were denatured and annealed to form double-stranded DNA. The reaction system was as follows: 10 μg M6-galk-DE-F and 10 μg M6-galk-DE-R were dissolved in 100 μL PCR Buffer. The reaction procedure was as follows: 95°C for 5 min, followed by a gradient cooling (-1°C / s) to 25°C. The reaction product was detected by agarose gel electrophoresis, and the double-stranded DNA product was gel-recovered and purified using the Omega agarose gel recovery kit.

[0072] The purified double-stranded DNA product was electroporated into the above-mentioned recombinant bacteria SW102-RB1B-galK-kan to remove the galK gene, and finally 10% L-arabinose (final concentration 0.1%) was added to induce the expression of I-Scel enzyme to remove the kan gene. The bacterial solution with the galK gene and kan gene removed was identified by PCR using the M6-F and M6-R primers in Table 1. The PCR reaction system was: 10 μL 2×T5 Super PCR Mix, 1 μL M6-F (10 μM), 1 μL M6-R (10 μM), 1 μL bacterial solution, 7 μL ddH 2 O. The PCR reaction program was: (98℃5min) 1 cycle; (98℃10s, 56℃15s, 72℃20s) 35 cycles; (72℃2min) 1 cycle. PCR products were detected by agarose gel electrophoresis. The results are shown in Figure 1 As shown, the PCR product in lane 5 has only one band at 500 bp, indicating that the inserted galK gene fragment (1231 bp) and kan gene fragment (995 bp) have been removed, and the bacterial artificial chromosome clone of the Marek's disease virus RB1B strain with miR-M6-5p gene deleted was successfully obtained and named SW102-RB1B-BACΔmiR-M6-5p.

[0073] Experimental Example 2

[0074] Rescue and identification of the Marek's disease virus (MDV) RB1B strain lacking the miR-M6-5p gene

[0075] 2.1 Rescue of miR-M6-5p gene-deficient MDV RB1B strain

[0076] The recombinant bacteria SW102-RB1B-BAC and SW102-RB1B-BACΔmiR-M6-5p in Experimental Example 1 were inoculated into LB liquid culture medium, shaken and cultured in a 32°C incubator for 16 hours, and then purified by PureLink TMPlasmids were extracted using HiPure Plasmid Extraction Kit (Thermo Fisher). The recombinant plasmid in SW102-RB1B-BAC was named pDS-RB1B-BAC, and the recombinant plasmid in SW102-RB1B-BACΔmiR-M6-5p was named pDS-RB1B-BACΔmiR-M6-5p.

[0077] Lipofectamine TM 2 μg of the extracted plasmids pDS-RB1B-BAC and pDS-RB1B-BACΔmiR-M6-5p were transfected into a monolayer of chicken embryo fibroblasts (CEF) in a 6-well cell plate using 3000 transfection reagent (Thermo Fisher) to rescue the miR-M6-5p gene-deficient Marek's disease virus RB1B strain (abbreviated as RB1B-ΔmiR-M6-5p) and Marek's disease virus RB1B strain (abbreviated as RB1B-BAC). The transfected cells were placed at 37°C and 5% CO 2 After 5-7 days of culture in the incubator, the cells were digested with trypsin, collected and subcultured into T25 cell bottles with CEF monolayers. This was repeated for 2-3 times, and the formation of virus plaques was observed under a microscope. When the RB1B-ΔmiR-M6-5p virus and RB1B-BAC virus to be rescued expanded to a certain amount, they were frozen in liquid nitrogen for later use.

[0078] The results showed that compared with CEF ( Figure 2 , right), typical plaque lesions of Marek's disease virus produced by RB1B-ΔmiR-M6-5p virus infection can be observed under a microscope ( Figure 2 , left), indicating that the miR-M6-5p gene-deficient Marek's disease virus RB1B strain (RB1B-ΔmiR-M6-5p) was successfully rescued.

[0079] 2.2 Identification of miR-M6-5p gene-deficient MDV RB1B strain

[0080] Chicken embryo fibroblasts (CEF) were infected with 1000 plaque forming units (PFU) of RB1B-ΔmiR-M6-5p virus and RB1B-BAC virus, and CEF cells not infected with the virus were set as blank controls. Cells were collected 72 hours after infection, and DNA was extracted using a blood / cell / tissue genomic DNA extraction kit (Tiangen), and RNA was extracted using a total RNA ultra-fast extraction kit (Shanghai Feijie).

[0081] Using the extracted DNA as a template, the miR-M6-5p region was amplified using the M6-F and M6-R primers in Table 1, and the meq gene (SEQ ID NO: 4) of the virus was amplified using the meq-F and meq-R primers in Table 1. The PCR reaction system was: 15 μL 2×T5Super PCR Mix, 1.5 μL forward primer (10 μM), 1.5 μL reverse primer (10 μM), 2 μL template, 10 μL ddH 2 O. The PCR reaction program was: (98℃5min) 1 cycle; (98℃10s, 56℃15s, 72℃10s) 35 cycles; (72℃2min) 1 cycle. The PCR products were identified by agarose gel electrophoresis and sequencing. The electrophoresis results showed that the amplified product of the miR-M6-5p region of the RB1B-ΔmiR-M6-5p virus ( Figure 3 , Lane 1) is higher than the amplified product of the miR-M6-5p region of the RB1B-BAC virus ( Figure 3 , Lane 2) is smaller, and the amplified product of the meq gene of the RB1B-ΔmiR-M6-5p virus ( Figure 3 , Lane 5) and the amplified product of the meq gene of the RB1B-BAC virus ( Figure 3 , Lane 6) are of the same size. Figure 4 As shown, compared with the RB1B-BAC virus, the RB1B-ΔmiR-M6-5p virus lacked the 22 bp miR-M6-5p gene (TCTGTTGTTCCGTAGTGTTCTC) (SEQ ID NO: 3), indicating that the expected RB1B-ΔmiR-M6-5p strain was obtained.

[0082] The extracted RNA was reverse transcribed using the Hairpin-it miRNA qRT-PCR quantitative kit to obtain cDNA. Using cDNA as a template, the M6-QF and M6-QR primers in Table 1 were used for fluorescence quantitative PCR to detect the expression of the miR-M6-5p gene. The fluorescence quantitative PCR reaction system was: 10 μL 2×SYBR Green Supermix, 1 μL M6-QF (10 μM), 1 μL M6-QR (10 μM), 1 μL template, 7 μL ddH 2 O. The reaction program was: (95℃2min) 1 cycle; (95℃15s, 58℃1min) 40 cycles. After the program was completed, the data was analyzed using Bio-Rad CFX Maestro software. The results are shown in Figure 5As shown, CEF infected with RB1B-BAC virus expressed a large amount of miR-M6-5p, while CEF infected with RB1B-ΔmiR-M6-5p did not express miR-M6-5p, further confirming that the obtained RB1B-ΔmiR-M6-5p strain was a miR-M6-5p gene deletion strain.

[0083] The obtained RB1B-ΔmiR-M6-5p strain was sent to the China General Microbiology Center (CGMCC) for preservation, with the preservation number CGMCC No.46202.

[0084] Experimental Example 3

[0085] In vitro replication curve determination of RB1B-ΔmiR-M6-5p strain

[0086] Chicken embryo fibroblasts (CEF) were infected with 1000 PFU of RB1B-ΔmiR-M6-5p virus (CGMCC No. 46202) and RB1B-BAC virus, respectively. Cells were collected at 0, 12, 24, 48, 72, 96 and 120 hours after infection, and DNA was extracted using a blood / cell / tissue genomic DNA extraction kit (Tiangen).

[0087] The extracted DNA was used as a template and the meq-QF and meq-QR primers in Table 1 were used to perform absolute fluorescence quantitative PCR to detect the copy number of the Marek's disease virus (MDV) genome. The reaction system was: 10 μL 2×SYBR Green Supermix, 1 μL meq-QF (10 μM), 1 μL meq-QR (10 μM), 1 μL template, 7 μL ddH 2 O. The reaction program was: (95℃2min) 1 cycle; (95℃15s, 58℃1min) 40 cycles. After the program was completed, the data was analyzed by Bio-Rad CFX Maestro. The pDS-RB1B-BAC plasmid extracted from Experimental Example 2 was diluted 10 times and then diluted to different concentrations (10 8 -10 1 The same fluorescence quantitative PCR reaction was performed using pDS-RB1B-BAC plasmid (100 copies / mL) as a template. The standard curve was generated using Bio-Rad CFXMaestr software and the genome copy number of MDV was calculated based on the PCR fluorescence signal intensity of RB1B-ΔmiR-M6-5p and RB1B-BAC viral DNA.

[0088] The results are as follows Figure 6As shown, at 72, 96 and 120 hours after infection, the genome copy number of RB1B-ΔmiR-M6-5p virus was significantly higher than that of RB1B-BAC virus. Therefore, the replication level of RB1B-ΔmiR-M6-5p virus on CEF cells was significantly increased.

[0089] Experimental Example 4

[0090] Determination of tumor incidence in chickens infected with RB1B-ΔmiR-M6-5p strain

[0091] One-day-old specific pathogen free (SPF) chickens were randomly divided into three groups, namely, RB1B-ΔmiR-M6-5p infection group (14 chickens), RB1B-BAC infection group (14 chickens), and negative control group (9 chickens). Among them, the RB1B-ΔmiR-M6-5p infection group was inoculated with 1000 PFU (0.1 mL) of RB1B-ΔmiR-M6-5p (CGMCC No. 46202) virus solution; the RB1B-BAC infection group was inoculated with 1000 PFU (0.1 mL) of RB1B-BAC virus solution; the SPF chickens in the negative control group were inoculated with an equal amount of blank chicken embryo fibroblast (CEF) suspension. All chickens were killed 35 days after infection, and the tumor incidence was counted after autopsy.

[0092] The results are shown in Table 2. None of the chickens in the negative control group developed tumors; 7 of the 14 chickens infected with the RB1B-BAC virus developed tumors, with a tumor incidence of 50%; 3 of the 14 chickens infected with the RB1B-ΔmiR-M6-5p virus developed tumors, with a tumor incidence of 21.4%. Therefore, the pathogenicity of the RB1B-ΔmiR-M6-5p virus was significantly reduced.

[0093] Table 2 Tumor incidence determination results

[0094] Group Total number of chickens Number of birds with tumors Tumor incidence Negative control group 9 0 0 RB1B-BAC infection group 14 7 50％ RB1B-ΔmiR-M6-5p infection group 14 3 21.4％

[0095] Experimental Example 5

[0096] Preparation of chicken Marek's disease vaccine using RB1B-ΔmiR-M6-5p strain

[0097] The RB1B-ΔmiR-M6-5p virus (deposit number CGMCC No. 46202) was expanded and cultured on chicken embryo fibroblasts (CEF), and the cells were frozen when about 70% of the cells showed pathological changes to obtain CEF cytotoxin.

[0098] Determination of virus titer: Take out the frozen CEF cell virus and place it in a 37°C water bath to quickly dissolve it. Then dilute the virus 10 times (10 -1 -10 -6 ). Six gradients of cell dilutions were inoculated into 12-well cell plates covered with a monolayer of CEF, 1 mL / well, and three replicates were set for each gradient. Incubate at 37°C and 5% CO 2 After culturing in the incubator for 5 days, the culture medium in the 12-well cell plate was discarded and the cells were washed three times with PBS; 4% cell tissue fixative was used for fixation at room temperature for 15 minutes and washed three times with PBS; 0.1% Triton X-100 was used for permeabilization on ice for 15 minutes and washed three times with PBS; 5% bovine serum albumin (BSA) was added for blocking at room temperature for 2 hours and washed three times with PBS; anti-MDV chicken serum (provided by the National Veterinary Microbiology and Bacteria (Virus) Collection Center) was used as the primary antibody, incubated at room temperature for 1 hour and washed three times with PBS; HRP-labeled goat anti-chicken IgY (Sigma-Aldrich (Shanghai) Trading Co., Ltd., A9792) was used as the secondary antibody, incubated at room temperature for 40 minutes and washed three times with PBS; AEC (3-amino-9-ethylcarbazole) substrate color development kit (Solarbio, A2010) was used to stain the plaques according to the product instructions, and the number of plaques was counted under a microscope at a dilution between 20 and 50. Finally, the average number of plaques in three replicate wells of the corresponding dilution was multiplied by the corresponding dilution factor to obtain the RB1B-ΔmiR-M6-5p virus titer.

[0099] Preparation of vaccine: Take out the frozen CEF cell virus and place it in a 37℃ water bath to dissolve quickly, then inoculate it into the monolayer of CEF. When about 70% of the cells show lesions, harvest the virus to obtain the chicken Marek's disease vaccine. Vaccinate chickens at a dose of 2000PFU / 200μL / chicken.

Claims

1. The miR-M6-5p gene-deficient strain of Marek's disease virus, whose deposit number is CGMCC No.46202.

2. The chicken Marek's disease virus miR-M6-5p gene deletion strain according to claim 1, characterized in that: The nucleotide sequence of the missing miR-M6-5p gene is TCTGTTGTTCCGTAGTGTTCTC.

3. Use of the miR-M6-5p gene-deficient strain of Marek's disease virus according to claim 1 in the preparation of a Marek's disease vaccine.

4. A virus solution comprising the miR-M6-5p gene-deficient strain of Marek's disease virus according to claim 1.

5. A vaccine comprising the miR-M6-5p gene deleted strain of Marek's disease virus according to claim 1.

6. The vaccine according to claim 5, characterized in that The vaccine is a live vaccine.

7. The vaccine according to claim 6, characterized in that The inoculation dose of the vaccine is 2000-2500 PFU per chicken.

8. A method for preparing a chicken Marek's disease vaccine, comprising: The chicken embryo fibroblasts are infected with the chicken Marek's disease virus miR-M6-5p gene deletion strain according to claim 1, the cells are cultured and the viruses are harvested.

9. The method according to claim 8, characterized in that The chicken embryo fibroblasts infected with the miR-M6-5p gene deletion strain of Marek's disease virus were placed in a 37° C., 5% CO 2 incubator for culture.

10. The method according to claim 9, characterized in that The virus is harvested when 70% to 80% of the chicken embryo fibroblasts show lesions.

Images