Method for removing linker self-linking product in preparation process of small RNA (Ribonucleic Acid) library

Abstract

The invention provides a method for removing a linker self-linking product in a small RNA library preparation process. The method comprises the following steps: step a) adding excessive reverse transcription primers to close a 3'linker; a step b) of Damp; l, enzyme treatment; and a step c) of Cas-sgRNA complex treatment. The invention also provides a method for removing a linker self-linking product and polluted nucleic acid in the preparation process of the small RNA library, a preparation method of the small RNA library, a multi-omics sequencing library containing the small RNA and the like.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and more specifically, relates to a method for removing linker self-ligation products during the preparation of a small RNA library. Background Art

[0002] Cell heterogeneity is the intrinsic variation between cells caused by factors such as differences in genes between cells, differences in the surrounding environment, random expression of genes or proteins, and random interactions of biomacromolecules (Chappellet.al.., 2018). Even cells with the same phenotype may have very different internal molecular compositions. The previous bulk-seq method ignored the differences between cells and only provided a virtual, homogenized "portrait" of a complex cell population. With the deepening and refinement of research, such a low-resolution "portrait" can no longer meet the needs in many aspects. Single-cell sequencing technology is different. It can obtain the molecular composition of each single cell and finely depict the unique characteristics of each cell. This allows inventors to discover differences in cell expression, distinguish heterogeneity between cells, find rare cell types, reconstruct the morphology of tissues or organs at the single-cell scale, understand the state of cells, construct cell development trajectories, and track cell lineages (Birnbaum, 2018). Since its birth in 2009, single-cell RNA sequencing technology has attracted much attention. With ten years of development and maturity, single-cell RNA sequencing technology has been widely used in tumorigenesis (Savas et al., 2018; Wagner et al., 2019; Zilionis et al., 2019), embryonic development (Biase et al., 2014; Blakeley et al., 2015; Pijuan-Sala et al., 2019; Xue et al., 2013; Yan et al., 2013), organ formation (Cui et al., 2019; Gao et al., 2018; Sun et al., 2018), reproductive and nervous systems (Gu et al., 2019; Sohni et al., 2019; Tan and Wilkinson, 2019; Tiklova et al., 2019; Zeisel et al., 2018), and so on. et.al.., 2015; Zhang et.al.., 2018; Zhong et.al.., 2018) and other fields.

[0003] Compared with the rapid development of single-cell RNA sequencing methods, the development of single-cell small RNA sequencing methods is relatively slow. This is mainly because the special nature of small RNA sequences makes it impossible to obtain cDNA libraries through simple reverse transcription and amplification like mRNA. Small RNA does not have a poly (A) tail and cannot be reverse transcribed using oligo-dT primers. At the same time, small RNAs are generally short. For example, the length of miRNA is concentrated around 20-22nt, the length of endo-siRNA is concentrated around 20nt, and the slightly longer piRNA is only more than 30nt at most. It is not appropriate to use random primers for reverse transcription of such short sequences. Therefore, the current mainstream strategy requires that the adapter sequence (adapter) be connected to both ends of the small RNA first to facilitate subsequent reverse transcription and amplification (Hafner et.al.., 2011). The general process is that the small RNA is first connected to the 3' end adapter under the action of RNA ligase, and then the connected 3' end adapter sequence is complementary paired with the reverse transcription primer and connected to the 5' end adapter. The obtained small RNA with adapters at both ends forms a single-stranded cDNA under the action of reverse transcriptase, and subsequent amplification reactions can be performed to amplify these products ( Figure 1 ). The final product contains universal sequencing sequences at both ends and can be used for high-throughput sequencing.

[0004] This ligation-based strategy has inherent defects: the 3' linker and 5' linker in the system will inevitably form ligation byproducts (linker self-ligation). Especially when the starting RNA is too little, the production of byproducts will be far more than the formation of the target ligation product, resulting in poor quality of the library or even failure of library construction. This also leads to the following difficult-to-solve problems in the construction of small RNA libraries in the case of trace RNA or single cells.

[0005] First, since the absolute number of small RNA molecules in a single cell is small, the detection sensitivity of the library construction method must be high enough to effectively obtain the complete information of small RNA in a single cell. Previous research results have found that increasing the concentration of the linker and the concentration of PEG in the ligation reaction can effectively increase the ligation reaction and improve the sensitivity of the method. These methods are effective for detecting miRNAs with a small number of species and high expression levels in a single cell, but it is unclear whether they are effective for some small RNAs with a large number of species but low abundance, such as piRNA and endo-siRNA.

[0006] Secondly, the absolute number of small RNA molecules in a single cell is very small. Although the efficiency of the ligation reaction is improved after adding an excess of adapter sequences, the adapter sequences in the ligation reaction do not have enough available small RNA molecules to connect with them due to the excess adapter sequences. As a result, the adapter self-ligation produces hundreds of times more adapter self-ligation products than the target product. In the past, there were many methods to reduce the products of adapter self-ligation. For example, CN107488655B uses a Cas9 / sgRNA complex to remove the adapter self-ligation products; Trilink's cleanTag technology uses adapters with modified ends to reduce the self-ligation effect of the adapter. However, none of the methods can completely or effectively remove the adapter self-ligation products, making the construction of single-cell small RNA libraries difficult and the data quality worrying.

[0007] Commonly used small RNA library construction methods and commonly used library construction kits require a relatively high amount of initial RNA, generally more than 100ng of total cell RNA, such as NEB NEXT small RNA library prep set, which cannot meet the needs of small RNA sequencing of trace samples. In 2016, Yang et al. published a method for constructing a small RNA library with a minimum of 10 ng of total cell RNA for library construction (Yang et al., 2016). Faridani et al. established the first single-cell small RNA sequencing method Small-seq, and studied the expression differences of small RNAs in initial embryonic stem cells and activated embryonic stem cells (Faridani et al., 2016). Soon after, Yang et al. established Cas-seq, and studied the types and expression changes of small RNAs in human mature eggs and early embryos at the single egg level (Yang et al., 2019). However, the above two methods failed to completely solve the problems existing in the construction of single-cell small RNA libraries, but made certain compromises in sensitivity or data quality. Small-seq increases the concentration of adapters to improve the efficiency of ligation and the sensitivity of the method, but it also increases the generation of ligation byproducts, making it impossible to distinguish between the formal sample and the negative control in terms of library pattern (Hagemann-Jensen et al., 2018); CAS-seq uses a relatively low adapter concentration and uses Cas9 to specifically remove the adapter self-ligation product, effectively inhibiting the formation of byproducts. However, this method has a significant reduction in sensitivity and cannot obtain high-quality small RNA data using a single somatic cell.

[0008] Therefore, how to effectively remove the self-ligation products of adapters while ensuring the detection sensitivity of the library construction method is the key issue in the current construction of single-cell small RNA libraries. This greatly limits the high-throughput sequencing of small RNAs in trace samples and single cells, and also greatly hinders the development of single-cell multi-omics technologies including small RNAs. Summary of the invention

[0009] The object of the present invention is to provide a method for removing adapter self-ligation products during the preparation of a small RNA library, comprising: step a) adding an excess of reverse transcription primer (RTP) to block the 3' adapter; step b) D&L enzyme treatment; and step c) Cas-sgRNA complex treatment. The present invention also provides a method for removing adapter self-ligation products and contaminating nucleic acids during the preparation of a small RNA library, a method for preparing a small RNA library, and a multi-omics preparation method containing a small RNA library.

[0010] In a first aspect of the present invention, a method for removing linker self-ligation products during the preparation of a small RNA library is provided, comprising:

[0011] Step a) adding excess reverse transcription primer (RTP) to block the 3' linker;

[0012] step b) D&L enzyme treatment; and

[0013] Step c) Cas-sgRNA complex treatment.

[0014] In one or more embodiments, the small RNA is RNA extracted from cells, cell supernatants, tissues, organs, body fluids or secretions.

[0015] In one or more embodiments, the small RNA is derived from oocytes, HEK293T cells, HEK293FT cells, Hela cells, testicles, brain tissue, adipose tissue, skin tissue, nervous tissue, lymphatic tissue, muscle tissue, serum, plasma, urine, cerebrospinal fluid, saliva, nasal secretions, alveolar lavage fluid, milk, synovial fluid, semen, uterine fluid, bile, lymph fluid, feces, amniotic fluid, and embryo culture fluid.

[0016] In one or more embodiments, the small RNA is total RNA derived from a small number of cells, RNA from a single cell, or RNA from an incomplete single cell (e.g., 1 / 4 single cell, 1 / 2 single cell, 3 / 4 single cell).

[0017] In one or more embodiments, step a) comprises:

[0018] Step a1): using the 3' adapter to carry out a ligation reaction with the RNA to be sequenced to obtain a 3' adapter ligation reaction product;

[0019] Step a2): adding an excess of reverse transcription primer (RTP) to block the 3' adapter not involved in the ligation reaction to form an RTP / 3' adapter double-stranded product.

[0020] In one or more embodiments, the concentration of the reverse transcription primer (RTP) in step a2) is 2 to 100 times, 3 to 50 times, 4 to 30 times, or 5 to 20 times the concentration of the 3' adapter sequence.

[0021] In one or more embodiments, step a2) is carried out under denaturation slow annealing conditions, which are incubation at 75±5°C for 2±0.5 minutes, slowly cooling to 60±5°C, and incubation at 60±5°C for 2±0.5 minutes; more preferably, the slow cooling condition is 0.3±0.1°C per second.

[0022] In one or more embodiments, the conditions for the 3' linker ligation reaction in step a1) are any one of the following:

[0023] Condition 1: 22±3℃ ligation reaction for 2±0.5 hours, preferably 22±1℃ ligation reaction for 2±0.2 hours;

[0024] Condition 2: ligation reaction at 30±2℃ for 6±0.5 hours and then at 4±2℃ for 10±0.5 hours, preferably ligation reaction at 30±1℃ for 6±0.2 hours and then at 4±1℃ for 10±0.2 hours;

[0025] Condition 3: 16±2°C for ligation reaction for 16±0.5 hours, preferably 16±1°C for ligation reaction for 16±0.2 hours.

[0026] In one or more embodiments, in the step a1), a 3' linker ligase is added to allow the 3' linker to undergo a ligation reaction.

[0027] In one or more embodiments, the 3' linker ligase includes but is not limited to: T4 RNA ligase 2 and its variants (preferably, the variants include truncations, such as truncations K227Q and truncations KQ), T4 RNA ligase 1 and its variants, 5'APP DNA / RNA ligase and its variants, and RTCB ligase and its variants.

[0028] In one or more embodiments, the step b) comprises:

[0029] Step b1): D&L enzyme treatment of the 3' linker / 3' linker in the RTP double-stranded product; (preferably, the Deadenylation enzyme removes the 5'-rAPP of the 5'-rAPP-3' linker to generate a 5'-P-3' linker, and then Lambda exonuclease preferentially digests the 5'-P-3' linker / 3' linker with a 5'-P modification in the RTP double-stranded product)

[0030] Step b2): After removing the 3' linker, a 5' linker is added to carry out a ligation reaction.

[0031] In one or more embodiments, the D&L enzyme includes: 5'deadenylase, lambda exonuclease, and an optional RNase inhibitor; more preferably, corresponding to 10pg to 100ng RNA, 10 to 100 units (e.g., 15, 25, 45 units) of 5'deadenylase and 2 to 20 units (e.g., 5, 10, 15 units) of lambda exonuclease are used.

[0032] In one or more embodiments, in step b2), a 5' linker ligase is added to allow the 5' linker to undergo a ligation reaction.

[0033] In one or more embodiments, the 5' linker ligase includes but is not limited to: T4 RNA ligase 1 and its variants, T4 RNA ligase 2 and its variants (preferably, the variants include truncations, such as truncations K227Q and truncations KQ), 5'APP DNA / RNA ligase and its variants, and RTCB ligase and its variants.

[0034] In one or more embodiments, the step c) comprises:

[0035] Step c1): reverse transcribing the product obtained in step b2) to obtain a reverse transcription product;

[0036] Step c2): performing PCR amplification on the reverse transcription product obtained in step c1) to obtain a PCR amplification product;

[0037] Step c3): The PCR amplification product obtained in step c2) is mixed with the Cas enzyme and sgRNA to remove the 3' adapter and 5' adapter ligation byproducts in the PCR amplification product.

[0038] In one or more embodiments, in step c3), the sgRNA includes sgRNAs selected from the nucleotide sequences shown in SEQ ID NOs: 10, 11, and 12 (such as containing at least 1, 2 or all of them).

[0039] In a second aspect of the present invention, a method for removing adapter self-ligation products and contaminating nucleic acids during the preparation of a small RNA library is provided, comprising: the method for removing adapter self-ligation products during the preparation of a small RNA library according to the present invention, and the method for removing contaminating nucleic acids during the preparation of a small RNA library.

[0040] In one or more embodiments, the method for removing contaminating nucleic acids during the preparation of the small RNA library comprises: mixing the PCR amplification product from which the adapter self-ligation product has been removed with the Cas enzyme and sgRNA, thereby removing the contaminating nucleic acids in the PCR amplification product.

[0041] In one or more embodiments, the sgRNA includes an sgRNA having a nucleotide sequence as shown in SEQ ID NO:14.

[0042] In a third aspect of the present invention, a method for preparing a small RNA library is provided, comprising:

[0043] The method for removing the self-ligation products of the adapter in the process of preparing the small RNA library of the present invention or the method for removing the self-ligation products of the adapter and the contaminating nucleic acid in the process of preparing the small RNA library of the present invention, and,

[0044] Step d): PCR amplification; and,

[0045] Step e): Library recovery.

[0046] In one or more embodiments, the step d) is to perform PCR amplification on the product obtained in step c3) to obtain a PCR amplification product.

[0047] In one or more embodiments, the library recovery method in step e) is recovery using magnetic beads or gel electrophoresis; preferably, the cDNA fragment size obtained after library recovery is 135-180 bp (ie, the inserted fragment is 15-60 nt).

[0048] In a fourth aspect of the present invention, a kit is provided, comprising:

[0049] An RNA 3' end connection module, wherein the connection module comprises a 3' end adapter and is used to connect the 3' end adapter to the 3' end of the RNA;

[0050] A reverse transcription primer blocking module, which contains a reverse transcription primer and is used to block the 3' end adapter;

[0051] A D&L enzyme cleavage module, which contains a D&L enzyme and is used to remove the 3' end adapter and the reverse transcription primer connection product generated by the 3' end connection module;

[0052] An RNA 5' end connection module, wherein the connection module comprises a 5' end adapter and is used to connect the 5' end adapter to the 5' end of the RNA connected to the 3' end adapter;

[0053] A reverse transcription module, comprising a reverse transcriptase and used for reverse transcribing the RNA molecule connected with the 3' end adapter and the 5' end adapter;

[0054] A first amplification module, which contains enzymes required for DNA amplification and is used to amplify based on the product of the reverse transcription module;

[0055] A Cas cleavage module, which comprises a Cas enzyme and sgRNA and is used to remove the adapter self-ligation products generated by the amplification module;

[0056] The second amplification module contains enzymes required for DNA amplification and is used to amplify the enzyme cleavage products to obtain the final library.

[0057] In one or more embodiments, the concentration of the reverse transcription primer (RTP) is 2 to 100 times, 3 to 50 times, 4 to 30 times, or 5 to 20 times the concentration of the 3' end adapter.

[0058] In one or more embodiments, the D&L enzyme includes: 5'deadenylase, lambda exonuclease, and an optional RNase inhibitor; more preferably, corresponding to 10pg to 100ng RNA, 10 to 100 units (e.g., 15, 25, 45 units) of 5'deadenylase and 2 to 20 units (e.g., 5, 10, 15 units) of lambda exonuclease are used.

[0059] In one or more embodiments, the sgRNA includes an sgRNA selected from the nucleotide sequences shown in SEQ ID NO: 10, 11, and 12 (such as containing at least 1, 2 or all).

[0060] In a fifth aspect of the present invention, a small RNA library is provided, which is prepared by the method for preparing a small RNA library according to the present invention.

[0061] In a sixth aspect of the present invention, a multi-omics sequencing library containing a small RNA library is provided, wherein the small RNA library is prepared by the method for preparing a small RNA library described in the present invention.

[0062] In one or more embodiments, other omics of the multi-omics sequencing library may include: long RNA sequencing library (e.g., mRNA sequencing library), genomic library, methylation library, CLIP library, RIP library, MeRIP library, GRO library, ATAC library, translation group library, RNA structure library.

[0063] In a sixth aspect of the present invention, a method according to any embodiment of the present invention (including a method for removing adapter self-ligation products during small RNA library preparation, a method for removing adapter self-ligation products and contaminating nucleic acids during small RNA library preparation, and a method for preparing a small RNA library) or a kit according to the present invention, or a library according to the present invention, or an application of a multi-omics sequencing library according to the present invention is provided, comprising:

[0064] Perform sequencing analysis or sequence comparison;

[0065] Conduct analysis of gene structure, expression or regulation;

[0066] Screening or analysis of functional genes;

[0067] Screening or analyzing disease genes (disease-causing genes);

[0068] Monitoring or analysing IVF embryo quality or sperm quality; or

[0069] Analysis of gene abundance.

[0070] In one or more embodiments, the disease includes: tumor, preeclampsia, Parkinson's disease.

[0071] In one or more embodiments, the screening or analysis includes screening or analysis in the absence of disease, early stage, middle stage, late stage of disease, or prognosis.

[0072] Other aspects of the present invention will be apparent to those skilled in the art in view of the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 , the small RNA library construction process and the main optimization contents of the present invention.

[0074] The main process of the method of the present invention ethaned Cas-seq (hereinafter referred to as eCas-seq) is that the small RNA is first connected to the 3' adapter at its 3' end under the action of T4 RNA ligase 2, and then the 3' adapter is complementary to the reverse transcription primer to form a double-stranded DNA region. After 5'deadenylase and lambda exonuclease treatment remove most of the unused 3' adapters, the 5' adapter is connected, and the obtained connection product can be amplified to produce more templates, and the residual adapter self-ligation products and contaminated RNA are removed by Cas9 treatment. The library after the final amplification can be sequenced in high throughput. eCas-seq has made the following improvements on the previous small RNA sequencing methods: 1. The amount of 3' adapter, 5' adapter and corresponding reverse transcription primer is increased; 2. The connection conditions are optimized, and different connection temperatures and times are tested; 3. The process of exonuclease treatment is increased; 4. The process of Cas9 treatment is optimized, and the efficiency of by-product removal is improved.

[0075] Figure 2 , testing of linker dosage and RNA denaturation conditions.

[0076] a. Gel quality inspection of small RNA libraries constructed with different adapter amounts and with or without RNA denaturation conditions. 10pg of mouse testicular total RNA was used as the material, and the original adapter amount and 10 times the adapter amount were used, and three different amplification cycle numbers were tested. At the same time, each combination of adapter amount and amplification conditions was tested with and without the addition of RNA / RTP denaturation annealing process. O represents the original version, with RNA / RTP denaturation annealing added; S represents the simplified version, without RNA / RTP denaturation annealing. Since mouse testicular RNA was used, the constructed library is mainly a 150bp piRNA band. b. miRNA expression heat map analysis of the miRNA expression detected in the library with different adapter amounts. When other conditions are the same, increasing the amount of adapters can significantly increase the number of miRNA types detected.

[0077] Figure 3 , three Comparative analysis of different joint connection conditions.

[0078] a. Scatter plot of miRNA expression in libraries constructed under three different connection conditions (connection condition 1: 30℃6h, 4℃10h; connection condition 2: 22℃2h; connection condition 3: 16℃16h). The results show that the miRNA expression information obtained under different connection conditions has a high Pearson correlation and small differences. b. Comparison of the number of miRNA species detected under the three different connection conditions. Whether it is high-expression or low-expression miRNA, the three connection conditions have similar detection efficiency.

[0079] Figure 4 , removal strategies and testing of linker self-ligation products.

[0080] a. Strategy for removing adapter self-ligation products. The dashed box on the left indicates that the adapter self-ligation products mainly come from the connection between the unused 3' adapter and the 5' adapter. The dashed box on the right indicates the strategy used by eCas-seq to remove self-ligation products. b. Test gel results of adapter connection conditions and self-ligation product removal strategy. The results of lanes 1-5 show that only using reverse transcription primer blocking and 5'deadenylase and lambda exonuclease treatment cannot effectively remove adapter self-ligation products. The results of lanes 6-8 show that adding Cas9 treatment can effectively remove adapter self-ligation products on the basis of the first two treatments, and a better effect can be achieved when the treatment time is greater than 1 hour. The results of lanes 9-11 show that incubation at 22°C for two hours has the least adapter self-ligation products.

[0081] Figure 5 , testing of the effect of Cas9 treatment.

[0082] a. When the amount of total RNA from 293T cells was 1000, 100, 10, 1, and 0 pg RNA, the PAGE gel electrophoresis quality inspection of the Cas9-treated and untreated libraries was constructed. The Cas9 treatment conditions were 37°C for 2 hours. Except for the addition of Cas9 enzyme, the other components of the untreated sample were consistent with the treated sample. The gray arrow indicates the 140bp miRNA library band, the black arrow indicates the 120bp adapter self-ligation product, and the asterisk indicates the suspected self-ligation product. b. PAGE gel electrophoresis quality inspection of the Cas9-treated and untreated libraries constructed when the amount of plasma exosome RNA was 50, 5, 0.5, 0.05, and 0 pg RNA, respectively. The main band is the 150bp YRNA library.

[0083] Figure 6 , off-target testing of Cas9 treatment.

[0084] a. Design of sgRNA-1 and the cleavage site mediated by it. b. Design of sgRNA-2 and the cleavage site mediated by it. c. The left figure is a scatter plot of miRNA expression in the library before and after Cas9 / sgRNA-1 treatment. The right figure shows the sequence of the miRNA whose expression changes in the library after treatment, which starts with NGG, and N represents any nucleotide. d. Scatter plot of miRNA expression in the library before and after Cas9 / sgRNA-1 (left figure) and -2 (middle figure, right figure) treatment. The same miRNA expression changes exist in the repeated samples of the Cas9 / sgRNA-1 treated library, while there is no such expression change in the Cas9 / sgRNA-2 treated library.

[0085] Figure 7 , removal of contaminating E.coli rRNA.

[0086] a. Sequences of contaminating E. coli rRNA in small RNA libraries and design of corresponding sgRNA. b. qPCR determination of the percentage of E. coli rRNA in Cas9-treated and untreated libraries. c. Sequencing analysis of the percentage of contaminating E. coli rRNA in Cas9-treated and untreated libraries.

[0087] Figure 8 , serially diluted 293FT cell total RNA and single / half-cell small RNA libraries constructed using eCas-seq.

[0088] a. Small RNA libraries were constructed using 10ng to 10pg 293FT cell total RNA, half or one 293FT cell lysate, and PAGE gel was used for quality inspection. The results showed that a clear 140bp miRNA library band could be observed in all samples, and the 120bp adapter self-ligation product increased with the decrease of RNA input. Total RNA was used as the starting material, and each gradient had three technical replicates; cells were used as the starting material, and biological replicates from three different cells were used. b. Comparative analysis of miRNA species detected in small RNA libraries constructed from gradient diluted 293FT total RNA, single or half 293FT cells, error bars represent the standard deviation of the mean, and three replicates were used in each group. c. The miRNA expression in small RNA libraries constructed from gradient diluted 293FT total RNA, single or half 293FT cells has a very high correlation between repeated samples.

[0089] Fig. 9 , Comparison of small RNA library construction using 3 / 4, 1 / 2 and 1 / 4 293FT single cell lysates.

[0090] ab, Gel run quality inspection results (a) and sequencing analysis results (b) of small RNA libraries constructed using 3 / 4, 1 / 2 and 1 / 4 293FT single cell lysates. Each group includes 2 biological replicates. The quality inspection results of sequencing data in Figure b are as follows: 3 / 4 293FT single cell group: 87% available sequence ratio, 61% comparable sequence ratio, 40% mRNA ratio; 1 / 2 293FT single cell group: 88% available sequence ratio, 59% comparable sequence ratio, 19% mRNA ratio; 1 / 4 293FT single cell group: 70% available sequence ratio, 49% comparable sequence ratio, 16% mRNA ratio; 10pg 293FT cell total RNA group: 65% available sequence ratio, 33% comparable sequence ratio, 20% mRNA ratio. The results show that using 1 / 2 or more cell lysates can obtain better small RNA libraries.

[0091] Fig.10 , eCas-seq method evaluation.

[0092] a. Small RNA libraries were constructed using 100 ng to 10 pg of mouse testis total RNA and three different library construction methods and then analyzed by PAGE. The results showed that a clear 150 bp piRNA library band was observed in all samples, and the 120 bp adapter self-ligation product increased with the decrease of RNA input. Each gradient contained three technical replicates. b. The average number of miRNAs (left) and piRNAs (right) detected in the gradient dilution of mouse testis total RNA. All samples were analyzed using 2 million sequencing raw data. If the number of molecules detected for a miRNA or piRNA exceeded 10, it was indicated in dark gray, and if it exceeded 1, it was indicated in light gray. The mean and standard deviation were calculated by calculating three replicates. c. Perason correlation heat map of the abundance of miRNAs (left) and piRNAs (right) detected in the gradient dilution of mouse testis total RNA. de. The ratio of miRNAs (d) and piRNAs (e) that can be detected reproducibly in the gradient dilution samples. Each set is based on the molecules detected in 100 ng of mouse testis RNA. The mean and 90% confidence interval are shown on the graph, and the sample annotations are arranged from high to low according to the detection ratio.

[0093] Fig.11 , comparison of eCas-seq and single-cell small RNA sequencing methods.

[0094] Comparison of ac, eCas-seq and Small-seq data in terms of available sequences (a), alignable sequences (b) and detectable miRNA types (c). Comparison of df, eCas-seq and Wang-seq data in terms of available sequences (d), alignable sequences (e) and detectable miRNA types (f).

[0095] Fig.12 , construction and analysis of trace exosome small RNA library.

[0096] a. Design of sgRNA for ysRNA. b. 6% PAGE gel proves that Cas9 can effectively remove ysRNA in plasma exosome samples. c. After Cas9 removal, the proportion of ysRNA decreased from about 30% to 13%. d. Cas9 treatment does not introduce changes in miRNA expression. e. There is a high correlation between Cas9-treated and untreated samples. f. Analysis of the types and abundance of small RNAs in plasma exosome RNA. g. Analysis of the length and types of small RNAs in plasma exosome RNA.

[0097] Fig.13 , the method of the present invention is used to construct a single-cell translation group library.

[0098] a. Single-cell translation group library construction process. First, select a single cell and treat it with nuclease to digest the RNA that is not protected by protein. Then use protease to digest the protein to release the RNA fragments protected by the protein. Then use eCas-seq to construct the library, select the library size and sequence it. b. Comparative analysis of the single-cell ribosomal imprinting library soRibo-seq constructed by eCas-seq and the reference data scRibo-seq.

[0099] Fig.14 , The method of the present invention is used to construct a micro Rip-seq library.

[0100] a. Gel run detection of wild-type (WT) and PIWIL1 knockout (PIWIL1 KO) hamster oocyte PIWIL1 IP library. Input represents the control library without IP, PIWIL1 IP represents the library constructed using PIWIL1 antibody enrichment products, and IgG IP represents the library of control IgG antibody enrichment products. b. Sequencing results of oocyte PIWIL1 IP library.

[0101] Fig.15 , Schematic diagram of the design of single-cell multi-omics methods that include small RNA information.

[0102] a. The single cell lysate is divided equally, one part is used for small RNA library construction, and the other part is used for polyA+RNA library construction, which are sequenced and analyzed independently to establish the expression and regulatory information of long and short RNA in a single cell. b. In addition to small RNA and mRNA, the cell nucleus is used for DNA library construction, and single cell tri-omics data can be obtained simultaneously.

[0103] Fig.16 , a single-cell small RNA and transcriptome co-sequencing method was established.

[0104] a. Sources of intracellular and intercellular differences. Intracellular differences mainly come from unequal distribution of cell lysate and differences in sequencing methods themselves (technical variation); while intercellular differences come more from heterogeneity of cells themselves. bd. Correlation analysis of miRNA expression in 18 half-cells from 9 single cells of K562 (b), 293FT (c) and Hela (d). The left side is a Pearson correlation heat map, reflecting the similarity between all samples. The right side is a scatter plot of miRNA expression in two parts of a selected single cell. ef. Correlation analysis of mRNA expression in 18 half-cells from 9 single cells of 293FT (e) and Hela (f). The left side is a Pearson correlation heat map of mRNA expression in different half-cells, reflecting the similarity between all samples. The right side is a scatter plot of mRNA expression in two parts of a selected single cell. RPM stands for reads per million, and TPM stands for transcript per million. DETAILED DESCRIPTION

[0105] RNA source

[0106] Herein, the RNA may be of different origins, depending on the mode of origin, the number of cells, and whether it originates from within cells.

[0107] From the perspective of the source mode, the RNA can be RNA extracted from cells or cell supernatants (including but not limited to: oocytes, HEK293T cells, HEK293FT cells, Hela cells), tissues or organs (including but not limited to: testis, brain tissue, adipose tissue, skin tissue, nerve tissue, lymphatic tissue, muscle tissue), and various body fluids and secretions (including but not limited to: serum, plasma, urine, cerebrospinal fluid, saliva, nasal secretions, alveolar lavage fluid, milk, synovial fluid, semen, uterine fluid, bile, lymph fluid, feces, amniotic fluid, embryo culture fluid), or commercial RNA. RNA can be extracted by conventional methods in the art, including but not limited to: Trizol method, centrifugal column method, magnetic bead method, LiCl precipitation method, phenol chloroform-isopropanol precipitation method to extract RNA.

[0108] From the perspective of the number of source cells, the RNA can be total RNA from a small number of cells, RNA from a single cell, or RNA from an incomplete single cell (e.g., 1 / 4 single cell, 1 / 2 single cell, 3 / 4 single cell).

[0109] From the perspective of whether it originates from the cell, the RNA can be intracellular RNA or extracellular RNA, such as extracellular vesicle (including exosomes, microvesicles, apoptotic cells, and large oncosomes) RNA.

[0110] Small RNA vs. long RNA

[0111] Herein, the "RNA" includes small RNA and long RNA. The "RNA library" mentioned herein is a library containing RNA generated by reverse transcription using an RNA template, including a small RNA library and a long RNA library.

[0112] The "small RNA" mainly refers to RNA with a length of less than 50 nt, such as 18 to 40 nt, including (but not limited to): miRNA, endo-siRNA, piRNA, YRNA, sncRNA, snRNA, snoRNA, srRNA, siRNA, tRNAfragments, rRNA fragments, tsRNA, tfRNA. Generally, small RNA does not have a poly (A) tail and cannot be reverse transcribed using oligo-dT primers.

[0113] The "long RNA" mainly refers to RNA with a length greater than 200 nt, such as 200 to 10,000 nt, including (but not limited to): mRNA, lncRNA, rRNA, tRNA. Generally speaking, small RNAs have lower expression levels but more types, while long RNAs have higher expression levels and fewer types.

[0114] Method for removing adapter self-ligation products during small RNA library preparation

[0115] In the process of preparing small RNA libraries, due to the small absolute number of small RNA molecules in a single cell, the detection sensitivity of the library construction method is required to be high enough to effectively obtain the complete information of small RNA in a single cell. By increasing the concentration of adapters, the ligation reaction can be effectively increased, and the sensitivity of the method can be improved. However, due to the excessive adapter sequence, there are not enough small RNA molecules available for the adapter sequence to connect with it in the ligation reaction, so that the adapter self-connects, or the adapter connects with other molecules in the reaction system, such as endogenous or exogenous contaminated RNA, single nucleotides or oligonucleotides (1-3 nt), resulting in hundreds of times more adapter self-connection products than the target product.

[0116] After in-depth research, the inventors provide a method for removing adapter self-ligation products during small RNA library preparation, comprising: step a) adding excess reverse transcription primer (RTP) to block the 3' adapter; step b) D&L enzyme treatment; and step c) Cas-sgRNA complex treatment.

[0117] Step a) Add excess reverse transcription primer (RTP) to block the 3' linker

[0118] In the process of preparing small RNA library, 3' adapter sequence is usually added first, and then 5' adapter sequence is added. In order to reduce the formation of adapter self-ligation products by 3' adapter sequence and 5' adapter sequence, after adding 3' adapter sequence, a reverse transcription primer in excess (e.g., 2-100 times, 3-50 times, 4-30 times or 5-20 times) relative to 3' adapter sequence can be added, and the reverse transcription primer (RTP) and 3' adapter sequence are complementary paired as much as possible through a denaturation slow annealing program. Due to the presence of far excess reverse transcription primer (RTP), most of the free single-stranded 3' adapters are combined with reverse transcription primer (RTP) to form 3' adapter / RTP double-stranded DNA (dsDNA). Most of the 3' adapter sequence is combined with the reverse transcription primer to form double-stranded DNA, and the ligase used in the subsequent addition of 5' adapter sequence has extremely low ligation activity of single-stranded RNA and double-stranded DNA, which hinders the formation of adapter self-ligation products by 3' adapter / RTP (dsDNA) and 5' adapter sequence.

[0119] In one or more embodiments, step a) comprises:

[0120] Step a1): using the 3' adapter to carry out a ligation reaction with the RNA to be sequenced to obtain a 3' adapter ligation reaction product;

[0121] Step a2): adding an excess of reverse transcription primer (RTP) to block the 3' adapter that is not involved in the ligation reaction, thereby obtaining a 3' adapter / RTP ligation byproduct.

[0122] In one or more embodiments, the concentration of the reverse transcription primer (RTP) in step a2) is 2 to 100 times, 3 to 50 times, 4 to 30 times, or 5 to 20 times the concentration of the 3' adapter sequence.

[0123] In one or more embodiments, step a2) does not include a denaturation slow annealing condition. In another one or more embodiments, step a2) is performed under a denaturation slow annealing condition. In one or more embodiments, the denaturation slow annealing condition is incubated at 75±5°C for 2±0.5 minutes, slowly cooled to 60±5°C, and incubated at 60±5°C for 2±0.5 minutes; preferably, the slow cooling condition is reduced by 0.3±0.1°C per second.

[0124] In one or more embodiments, the conditions for the 3' linker ligation reaction in step a1) are any one of the following:

[0125] Condition 1: 22±3℃ ligation reaction for 2±0.5 hours, preferably 22±1℃ ligation reaction for 2±0.2 hours;

[0126] Condition 2: ligation reaction at 30±2℃ for 6±0.5 hours and then at 4±2℃ for 10±0.5 hours, preferably ligation reaction at 30±1℃ for 6±0.2 hours and then at 4±1℃ for 10±0.2 hours;

[0127] Condition 3: 16±2°C for ligation reaction for 16±0.5 hours, preferably 16±1°C for ligation reaction for 16±0.2 hours.

[0128] In one or more embodiments, in step a1), the 3' linker is subjected to a ligation reaction by adding a 3' linker ligase, which includes but is not limited to: T4 RNA ligase 2 and variants thereof (preferably, the variants include truncations, such as truncations K227Q and KQ), T4 RNA ligase 1 and variants thereof, 5'APP DNA / RNA ligase and variants thereof, and RTCB ligase and variants thereof.

[0129] In one or more embodiments, in step a1), 2-20 pmol (eg, 5, 10, 20 pmol) of 3' linker sequence is used corresponding to 10 pg-100 ng RNA.

[0130] Step b) D&L enzyme treatment

[0131] The "D&L enzymes" described in this article include: 5'deadenylase and lambda exonuclease. 5'deadenylase can dehydrogenate from the 5' end of DNA and RNA, leaving the phosphate at the 5' end. Lambda exonuclease mainly acts on double-stranded DNA, and prefers the strand with a phosphate group at the 5' end of the double-stranded DNA. If one of the strands in the double-stranded DNA carries a 5' monophosphate, lambda exonuclease will preferentially remove this strand. Using this principle, by adding a pre-adenylation (rApp) modification to the 5' end of the 3' end adapter, 5'deadenylase converts rApp into 5' monophosphate, and then lambda exonuclease preferentially digests the 3' adapter sequence in the double-stranded DNA formed by the 3' adapter and the reverse transcription primer, thereby effectively removing excess adapter self-ligation products.

[0132] In one or more embodiments, the step b) comprises:

[0133] Step b1): D&L enzyme treatment of 3' linker / RTP ligation byproducts;

[0134] Step b2): After removing the 3' adapter in the 3' adapter / RTP double-stranded product, a 5' adapter is added to carry out a ligation reaction.

[0135] In one or more embodiments, the D&L enzyme includes: 5'deadenylase, lambda exonuclease, and optionally an RNase inhibitor.

[0136] In one or more embodiments, 10-100 units (eg, 15, 25, 45 units) of 5'deadenylase and 2-20 units (eg, 5, 10, 15 units) of lambda exonuclease are used for 10 pg-100 ng of RNA.

[0137] In one or more alternative embodiments, 1-20 units (eg, 4, 8, 12 units) of RNase inhibitor are used for each 1 ng of RNA.

[0138] In one or more embodiments, the temperature of the D&L enzyme treatment is a gradient treatment, i.e., first treatment at 30±7°C and then treatment at 37±7°C; preferably, first treatment at 30±5°C and then treatment at 37±5°C; for example, first treatment at 30±3°C and then treatment at 37±3°C.

[0139] In one or more embodiments, the D&L enzyme treatment time is 60±15 minutes first and 60±15 minutes later; preferably, 60±10 minutes first and 60±10 minutes later; more preferably, 60±5 minutes first and 60±5 minutes later.

[0140] In one or more embodiments, in step b2), a 5' linker ligase is added to allow the 5' linker to undergo a ligation reaction. The 5' linker ligase includes, but is not limited to, T4 RNA ligase 1 and variants thereof, T4 RNA ligase 2 and variants thereof (preferably, the variants include truncations, such as truncations K227Q and truncations KQ), 5'APP DNA / RNA ligase and variants thereof, and RTCB ligase and variants thereof.

[0141] In one or more embodiments, in step a1), 15-75 pmol (eg, 25, 45, 65 pmol) of 5' linker sequence is used corresponding to 10 pg-100 ng RNA.

[0142] Step c) Cas-sgRNA complex treatment

[0143] During the construction of the small RNA library, the byproduct generated after the 5' adapter (RNA) and the 3' adapter (DNA) are connected is an RNA-DNA hybrid chain. The hybrid chain is reverse transcribed by reverse transcriptase to produce a cDNA chain. After one round of amplification, a double-stranded DNA product with a self-connected adapter is obtained. For this double strand, a specific sgRNA can be designed. The sgRNA and Cas protein are incubated to form a Cas-sgRNA complex. The sgRNA sequence-specific recognition of the self-connected adapter product and binding to it, Cas exerts endonuclease activity to cut off the bound self-connected adapter product. The cut product cannot be amplified in the subsequent library amplification, thereby effectively removing the excess self-connected adapter product.

[0144] In one or more embodiments, the step c) comprises:

[0145] Step c1): reverse transcribing the product obtained in step b2) to obtain a reverse transcription product;

[0146] Step c2): performing PCR amplification on the reverse transcription product obtained in step c1) to obtain a PCR amplification product;

[0147] Step c3): The PCR amplification product obtained in step c2) is mixed with the Cas enzyme and sgRNA to remove the 3' adapter and 5' adapter ligation byproducts in the PCR amplification product.

[0148] In one or more embodiments, step c2) is PCR pre-amplification (first amplification).

[0149] In one or more embodiments, the Cas-sgRNA complex generally contains a Cas protein with endonuclease activity and a single-stranded sgRNA, or is composed of a Cas protein with endonuclease activity and a single-stranded sgRNA. The Cas-sgRNA complex complementarily pairs with the template strand in the target DNA through the pairing region of the sgRNA, and the double-stranded DNA is cut at a specific position by Cas.

[0150] In one or more embodiments, the Cas protein can be various Cas proteins with endonuclease activity and variants thereof known in the art. The Cas protein can guide the cutting of one or both chains at the position of the target sequence, for example, guiding the cutting within the target sequence and / or within the complementary sequence of the target sequence. Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified forms thereof.

[0151] Generally, sgRNA includes two parts: the target region and the Cas protein recognition region. The target region and the Cas protein recognition region are usually connected in the 5' to 3' direction. Each Cas enzyme recognizes a different sgRNA. Therefore, corresponding Cas protein recognition regions need to be designed for different Cas enzymes. The Cas protein recognition regions for different Cas enzymes are well known in the art.

[0152] In one or more embodiments, the Cas enzyme is a Cas9 enzyme, including but not limited to Cas9 from Streptococcus pyogenes (SpCas9), Cas9 from Staphylococcus aureus (SaCas9), and Cas9 from Streptococcus thermophilus (St1Cas9).

[0153] In one or more embodiments, when the Cas protein is a Cas9 protein having endonuclease activity and a variant thereof, the sgRNA includes an sgRNA selected from a nucleotide sequence as shown in SEQ ID NO: 11, 12, or 14 (such as containing at least 1 or 2 or 3 sequences), or is composed of an sgRNA having a nucleotide sequence as shown in SEQ ID NO: 11, 12, or 14.

[0154] In one or more specific embodiments, the method for removing adapter self-ligation products during the small RNA library preparation process includes:

[0155] Step a1): using the 3' adapter to carry out a ligation reaction with the RNA to be sequenced to obtain a 3' adapter ligation reaction product;

[0156] Step a2): adding an excess of reverse transcription primer (RTP) to block the 3' adapter that is not involved in the ligation reaction to obtain a 3' adapter / RTP double-stranded product;

[0157] Step b1): treating the 3' linker in the 3' linker / RTP double-stranded product with D&L enzyme;

[0158] Step b2): after removing the 3' linker, add the 5' linker to carry out ligation reaction;

[0159] Step c1): reverse transcribing the product obtained in step b2) to obtain a reverse transcription product;

[0160] Step c2): performing PCR amplification on the reverse transcription product obtained in step c1) to obtain a PCR amplification product;

[0161] Step c3): The PCR amplification product obtained in step c2) is mixed with the Cas enzyme and sgRNA to remove the 3' adapter and 5' adapter ligation byproducts in the PCR amplification product.

[0162] In one or more embodiments, step c2) is PCR pre-amplification (first amplification).

[0163] The method for treating the Cas-sgRNA complex can refer to, for example, CN107488655B, and the relevant contents of CN107488655B are introduced in full herein. Different from this, in the present invention, the step of treating the Cas-sgRNA complex is performed after the PCR amplification (including PCR pre-amplification) step, rather than after the reverse transcription step. Therefore, in the present invention, double-stranded DNA is used as the substrate for treating the Cas-sgRNA complex, rather than the RNA / DNA hybrid double-stranded in the invention of CN107488655B, which is a better Cas-sgRNA complex substrate, so that the self-linked products of the connector can be more thoroughly removed. At the same time, using the product after pre-amplification as a substrate also greatly expands the scope of substrate selectability, which is convenient for specific excision of nucleic acids contaminated by endogenous or exogenous sources.

[0164] Method for removing adapter self-ligation products and contaminating nucleic acids during small RNA library preparation

[0165] In addition to the self-ligation products of the adapter, there are also contaminated nucleic acids in the preparation process of the small RNA library, which affects the quality of the library. Contaminated nucleic acids include exogenously contaminated nucleic acids and endogenously contaminated nucleic acids. Among them, exogenously contaminated nucleic acids mainly include nucleic acids in the surrounding environment or contaminated nucleic acids in the reagents used, especially trace amounts of bacterial nucleic acids carried in the ligase used. Endogenously contaminated nucleic acids are mainly large amounts of irrelevant tRNA, rRNA and mRNA fragments in cells. By specifically designing sgRNA, contaminated nucleic acids can be removed while removing the self-ligation products of the adapter, thereby improving the quality of the library.

[0166] In one or more embodiments, the method for removing adapter self-ligation products and contaminating nucleic acids during the small RNA library preparation process includes:

[0167] Step a1): using the 3' adapter to carry out a ligation reaction with the RNA to be sequenced to obtain a 3' adapter ligation reaction product;

[0168] Step a2): adding an excess of reverse transcription primer (RTP) to block the 3' adapter that is not involved in the ligation reaction to obtain a 3' adapter / RTP double-stranded product;

[0169] Step b1): D&L enzyme treatment of the 3' linker / 3' linker in the RTP double-stranded product;

[0170] Step b2): after removing the 3' linker, add the 5' linker to carry out ligation reaction;

[0171] Step c1): reverse transcribing the product obtained in step b2) to obtain a reverse transcription product;

[0172] Step c2): performing PCR amplification on the reverse transcription product obtained in step c1) to obtain a PCR amplification product;

[0173] Step c3): The PCR amplification product obtained in step c2) is mixed with the Cas enzyme and sgRNA to remove 3' adapter and 5' adapter ligation byproducts and contaminating nucleic acids in the PCR amplification product.

[0174] In one or more embodiments, when the Cas protein is a Cas9 protein having endonuclease activity and a variant thereof, the sgRNA includes an sgRNA (such as containing at least 1, 2 or 3) selected from a nucleotide sequence as shown in SEQ ID NO: 11, 12 or 14, or is composed of an sgRNA having a nucleotide sequence as shown in SEQ ID NO: 11, 12 or 14.

[0175] In one or more embodiments, step c2) is PCR pre-amplification (first amplification).

[0176] Small RNA library preparation method (enhanced Cas-seq method, referred to as eCas-seq method)

[0177] In a preferred embodiment, the method for preparing the small RNA library comprises:

[0178] Removing the linker self-ligation products and the contaminating nucleic acids by steps a) to c) of the method for removing linker self-ligation products and contaminating nucleic acids of the present invention;

[0179] Step d): PCR amplification; and,

[0180] Step e): Library recovery.

[0181] The "pre-amplification" and "first amplification" described herein can be used interchangeably. Similarly, the "re-amplification" and "second amplification" can be used interchangeably.

[0182] The "amplification", "pre-amplification" or "re-amplification" mentioned herein, unless otherwise specified, refers to amplification by the polymerase chain reaction (PCR) method.

[0183] By removing the adapter self-ligation products and contaminated nucleic acids through steps a) to c), unwanted sequences can be effectively removed to obtain a purer target sequence. Through the second amplification, the target sequence in a smaller amount of sample can be amplified, ensuring the sensitivity of the small RNA library preparation process and greatly improving the library quality.

[0184] Various methods for recovering small RNA libraries can be applied to the present invention, including but not limited to: recovery by gel electrophoresis and screening using magnetic beads. These methods are all within the scope of the present invention.

[0185] Afterwards, the recovered products can be quantified, sequenced and / or quality-checked using conventional methods in the art.

[0186] On the other hand, the present invention also provides a kit for constructing a small RNA library. According to an embodiment of the present invention, the kit comprises:

[0187] An RNA 3' end connection module, wherein the connection module comprises a 3' end adapter and is used to connect the 3' end adapter to the 3' end of the RNA;

[0188] A reverse transcription primer blocking module, which contains a reverse transcription primer and is used to block the 3' end adapter;

[0189] A D&L enzyme cleavage module, which contains a D&L enzyme and is used to remove the 3' end adapter and the reverse transcription primer connection product generated by the 3' end connection module;

[0190] An RNA 5' end connection module, wherein the connection module comprises a 5' end adapter and is used to connect the 5' end adapter to the 5' end of the RNA connected to the 3' end adapter;

[0191] A reverse transcription module, comprising a reverse transcriptase and used for reverse transcribing the RNA molecule connected with the 3' end adapter and the 5' end adapter;

[0192] A first amplification module, which contains enzymes required for DNA amplification and is used to amplify based on the product of the reverse transcription module;

[0193] A Cas cleavage module, which comprises a Cas enzyme and sgRNA and is used to remove the adapter self-ligation products generated by the amplification module;

[0194] The second amplification module contains enzymes required for DNA amplification and is used to amplify the enzyme cleavage products to obtain the final library.

[0195] Preferably, the kit also includes instructions to guide technicians to use the components contained in the kit to perform one or more methods described herein.

[0196] In one or more embodiments, the concentration of the reverse transcription primer (RTP) is 2 to 100 times, 3 to 50 times, 4 to 30 times, or 5 to 20 times the concentration of the 3' end adapter.

[0197] In one or more embodiments, the D&L enzyme includes: 5'deadenylase, lambda exonuclease, and optionally an RNase inhibitor.

[0198] In one or more embodiments, 10-100 units (eg, 15, 25, 45 units) of 5'deadenylase and 2-20 units (eg, 5, 10, 15 units) of lambda exonuclease are used for 10 pg-100 ng of RNA.

[0199] In one or more embodiments, the sgRNA includes an sgRNA selected from the nucleotide sequences shown in SEQ ID NOs: 11, 12, and 14 (such as containing at least 1 or 2), or consists of an sgRNA with a nucleotide sequence shown in SEQ ID NOs: 11, 12, and 14.

[0200] In another aspect of the present invention, a method for determining the sequence information of a small RNA molecule is provided. According to an embodiment of the present invention, the method includes: constructing a small RNA library based on a small RNA sample according to the method described in the present invention; sequencing the small RNA library to obtain sequencing results; and determining the sequence information of the small RNA molecule based on the sequencing results.

[0201] According to another aspect of the present invention, a system for determining sequence information of small RNA molecules is provided. According to an embodiment of the present invention, the system comprises: a small RNA library construction device, the small RNA library construction device is the kit described in the present invention; a sequencing device, the sequencing device is used to sequence the small RNA library constructed by the kit for the sample to obtain the sequencing result of the sample; and an analysis device, the sequencing result of the sample is analyzed to obtain the sequence information of the small RNA molecule.

[0202] The system for determining the sequence information of small RNA molecules according to the embodiment of the present invention can sensitively, accurately and efficiently determine the sequence information of small RNA in a trace sample (>10 pg RNA).

[0203] Small RNA library and its application

[0204] In one aspect of the present invention, a small RNA library prepared by the small RNA library preparation method of the present invention or a small RNA library prepared by the kit of the present invention is provided.

[0205] At the same time, the present invention also provides a multi-omics sequencing library including the small RNA library of the present invention. In one or more embodiments, the multi-omics sequencing library, the multi-omics sequencing library, other omics include but are not limited to: long RNA sequencing library, genomic library, methylation library, CLIP library, RIP library, MeRIP library, GRO library, ATAC library, translation group library, RNA structure library. In one or more embodiments, the long RNA sequencing library is an mRNA sequencing library.

[0206] In one or more embodiments, the multi-omics sequencing library may be a two-omics sequencing library or a three-omics sequencing library.

[0207] Another aspect of the present invention also provides a method for preparing a small RNA library according to the present invention or use of the kit according to the present invention in constructing a multi-omics sequencing library.

[0208] The advantages of the present invention are:

[0209] (1) Adding excess reverse transcription primer (RTP) to block the 3' adapter and reduce the formation of self-ligation products between the 3' adapter and the 5' adapter;

[0210] (2) Before the PCR amplification step, D&L enzyme treatment is used to remove excess adapters to avoid ligation with subsequent sequences;

[0211] (3) Design specific sgRNA and use Cas-sgRNA complex treatment after the PCR amplification step, which has excellent removal effect and good specificity, only removing the adapter self-ligation products and contaminating nucleic acids without affecting the expression of other small RNAs;

[0212] (4) Adding excess reverse transcription primer (RTP) to block the 3' adapter to form a large amount of 3' adapter-RTP double-stranded DNA, which cooperates with D&L enzyme treatment to effectively remove a large amount of adapter self-ligation products;

[0213] (5) The system integrates the addition of excess reverse transcription primer (RTP) to block the 3' adapter, D&L enzyme treatment, and Cas-sgRNA complex treatment, which can effectively remove adapter self-ligation products while ensuring the detection sensitivity of the small RNA library.

[0214] (6) By increasing the concentration of adapters and optimizing the adapter ligation reaction conditions, the ligation efficiency of small RNAs is increased, and the sensitivity of the small RNA library preparation method is improved, the sequence information of small RNAs in trace samples (>10pg RNA) can be sensitively, accurately, and efficiently determined; combined with the method of removing adapter self-ligation products, the excessive adapter self-ligation products and contaminating nucleic acids present in high-efficiency ligation reactions are removed, effectively improving the quality of the prepared small RNA library.

[0215] (7) For contaminated nucleic acids, sgRNA is designed specifically and removed using the Cas9-sgRNA complex, which has good specificity and significant removal effect.

[0216] (8) By integrating the single-cell small RNA library construction method, the single-cell transcriptome library construction method Smart-seq2, and the genome or methylation group sequencing method, it is possible to simultaneously construct a small RNA library, an mRNA library, and a gene library / methylation library from a single cell, realize multi-omics sequencing, and maximize the mining of sequencing information in single cells.

[0217] (9) The high sensitivity and repeatability of the method provide underlying library construction technical support for other related sequencing methods, including but not limited to micro-Rip-seq, single-cell translation group sequencing, and micro-Clip-seq.

[0218] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The methods and materials used in the examples are, unless otherwise stated, conventional methods and materials in the art.

[0219] Materials and Methods

[0220] 1. Sequence information

[0221] (1) 3' linker sequence (SEQ ID NO: 1):

[0222] 5'- / 5rApp / TGGAATTCTCGGGTGCCAAGG / 3ddC / -3';

[0223] (2) 5' linker sequence (SEQ ID NO: 2):

[0224] 5'-rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC-3';

[0225] (3) Bio-RT Primer (bio-RTP) (SEQ ID NO: 3):

[0226] 5'-biotin-GCCTTGGCACCCGAGAATTCCA-3';

[0227] (4) PCR upstream primer (SEQ ID NO: 4, FPI, 8N are indicator sequences, which can be designed according to certain rules according to the situation):

[0228] 5'-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACGTTCAGAGTTCTACAGTCCGA-3';

[0229] (5) PCR downstream primer (SEQ ID NO: 5; RPI, PCR primer, 6N is the index sequence, which can be designed by referring to the solutions of NEB or Illumina);

[0230] 5'-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3'

[0231] (6) Remove the self-linked sgRNA in vitro transcription upstream PCR primer 1 (SEQ ID NO: 6)

[0232] 5'-TAATACGACTCACTATAGGAGTTCTACAGTCCGACGATCGTTTTAGAGC-3'

[0233] (7) Remove the self-linked sgRNA in vitro transcription upstream PCR primer 2 (SEQ ID NO: 7)

[0234] 5'-TAATACGACTCACTATAGGACCCGAGAATTCCAGATCGTGTTTTAGAGC-3'

[0235] (8) Remove the self-linked sgRNA in vitro transcription upstream PCR primer 3 (SEQ ID NO: 8)

[0236] 5'-TAATACGACTCACTATAGGTCCGACGATCTGGAATTCTCGTTTTTAGAGC-3'

[0237] (9) sgRNA in vitro transcription downstream PCR primer (SEQ ID NO: 9):

[0238] 5-AAAAAAGCACCGACTCGGTGCC-3';

[0239] (10) In vitro transcribed sgRNA sequence 1 without adapter self-ligation (SEQ ID NO: 10, RNA prepared by T7 in vitro transcription, with triphosphate modification at the 5' end):

[0240] 5'-ppp-rArGrTrTrCrTrArCrArGrTrCrCrGrArCrGrArTrCrGrTrTrTrTrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArA rArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrC-3';

[0241] Note: “r” indicates that the sequence backbone is RNA.

[0242] (11) In vitro transcribed sgRNA sequence 2 without the linker self-ligation (SEQ ID NO: 11, RNA prepared by T7 in vitro transcription, with a triphosphate modification at the 5' end):

[0243] 5'-ppp-rArCrCrCrGrArGrArArTrTrCrCrArGrArTrCrGrTrGrTrTrTrTrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArA rArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrC-3';

[0244] Note: “r” indicates that the sequence backbone is RNA.

[0245] (12) In vitro transcribed sgRNA sequence 3 without the linker self-ligation (SEQ ID NO: 12, RNA prepared by T7 in vitro transcription, with a triphosphate modification at the 5' end):

[0246] 5'-ppp-rTrCrCrGrArCrGrArTrCrTrGrGrArArTrTrCrTrCrGrTrTrTrTrArGrArGrCrUrArGrArArArUrArGrCrArGrUrUrArA rArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrC-3';

[0247] Note: “r” indicates that the sequence backbone is RNA.

[0248] (13) sgRNA in vitro transcription upstream PCR primer 4 (SEQ ID NO: 13) to remove contaminated rRNA

[0249] 5'-TAATACGACTCACTATAGGCAACGCGAAGAACCTTACCTGTTTTAGAGC-3'

[0250] (14) In vitro transcribed sgRNA sequence 4 for removing contaminating rRNA (SEQ ID NO: 14, RNA prepared by T7 in vitro transcription, with triphosphate modification at the 5' end):

[0251] 5'-ppp-rCrArArCrGrCrGrArArGrArArCrCrTrTrArCrCrTrGrTrTrTrTrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArA rArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrC-3';

[0252] Note: “r” indicates that the sequence backbone is RNA.

[0253] (15) TSO sequence (SEQ ID NO: 15)

[0254] 5'-AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3'

[0255] (16) Oligo-dT 30VN sequence (SEQ ID NO: 16)

[0256] 5'-AAGCAGTGGTATCAACGCAGAGTACT30VN-3'

[0257] (17) IS PCR primer (SEQ ID NO: 17)

[0258] 5'-AAGCAGTGGTATCAACGCAGAGT-3'

[0259] (18) Transcriptome library amplification upstream primer Nextera501 (SEQ ID NO: 18)

[0260] 5'-AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTC-3'

[0261] (19) Transcriptome library amplification downstream primer Nextera701 (SEQ ID NO: 19)

[0262] 5'-CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG-3'

[0263] (20) Amplify the upstream PCR primer of sgRNA in vitro transcription for removing YRNA in exosomes (SEQ ID NO: 20)

[0264] 5'-TAATACGACTCACTATAGGGUUCUGAUAACCCACUACCAUGTTTTAGAGC-3'

[0265] (21) sgRNA sequence for removing YRNA in exosomes (SEQ ID NO: 21)

[0266] rGrGrUrUrCrUrGrArUrArArCrCrArCrUrArCrArUrGrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArGrUrUrArArArArU rArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrUrUrUrUrUrU

[0267] 2. Cell culture, single cell selection, cell lysis and total RNA extraction

[0268] HEK293T, HEK293FT and Hela cells used in the examples were cultured in DMEM medium (purchased from Thermo Fisher) supplemented with 10% serum, and K562 suspension cells were cultured in 1640 medium (purchased from Thermo Fisher) supplemented with 10% serum. The culture conditions were 37° C. and 5% CO 2 .

[0269] Single cell picking: If you are dealing with adherent cells, you should first use 0.5% trypsin to digest them, while suspension cells can be processed directly. The obtained single cell suspension is picked under a microscope using a mouth pipette. The picked single cells are washed several times in fresh PBS and placed in a PCR tube.

[0270] Cell lysis: Add cell lysis buffer to lyse the cells. The cells can be stored at -80°C for later use. The cell lysis buffer formula is 0.2% TritonX-100 and 1U / μl RiboLock RNase inhibitor (purchased from Thermo Fisher). When used, thaw the cells on ice, centrifuge to collect the liquid, and divide the lysate into two new PCR tubes. One is used for the construction of the small RNA library and the other is used for the construction of the transcriptome library.

[0271] Total RNA extraction from cells: Trizol reagent (purchased from Thermo Fisher) was used and operated according to its instructions. The purified RNA was quantified using Nanodrop (Thermo Fisher) and diluted with DEPC water for later use.

[0272] 3. Generation of sgRNA and Assembly of Cas9 / sgRNA Complex

[0273] The sgRNAs used in library construction were obtained by in vitro transcription. The DNA template was amplified and recovered from the plasmid template using the sgRNA front-end amplification primer and the universal end primer (Table 1). 500 ng or 1 μg of PCR product was used for in vitro transcription for 4 hours using T7 RNA polymerase (purchased from Thermo Fisher), followed by RNA extraction using Trizol, RNA quantification using Nano Drop 2000, and 10% denaturing PAGE gel to determine the quality of sgRNA.

[0274] After denaturation at 72°C, sgRNA was immediately placed back on ice. 2 moles of sgRNA and 1 mole of Cas9 protein were incubated in 1× Cas9 protein reaction buffer at 37°C for 15-30 minutes to complete the assembly of Cas9 protein and sgRNA.

[0275] Table 1

[0276]

[0277]

[0278]

[0279] Note: All sequences are 5'-3' sequences. sgRNA is prepared by T7 in vitro transcription, and the 5' end is modified with triphosphate. "r" indicates that the sequence backbone is ribonucleic acid.

[0280] 4. Construction of small RNA library

[0281] Taking a single cell as an example, the method for constructing a small RNA library in the present invention, referred to as the eCas-seq method, is as follows:

[0282] 3' adapter sequence ligation: First, add 10 pmol of 3' adapter sequence (SEQ ID NO: 1) to the lysate or the corresponding volume of total RNA or plasma exosome RNA, and heat denature at 72°C for 3 minutes. Add adapter ligation solution including 0.83× T4 RNA ligase buffer (purchased from NEB), 50U T4 RNA ligase 2 KQ (purchased from NEB) and 10U RiboLock RNase inhibitor (purchased from Thermo Fisher), mix well and ligate at 22°C for 2 hours.

[0283] Reverse transcription primer (RTP) blocked the 3' linker: 100 pmol of bio-RTP (SEQ ID NO: 3) was added and denaturation and slow annealing were performed, incubated at 75°C for 2 minutes, decreased by 0.3°C per second until 60°C, and incubated at 60°C for 2 minutes.

[0284] D&L enzyme treatment: Add an enzyme treatment reaction solution containing 5U Lambda exonuclease (purchased from NEB), 25U 5'deadenylase (purchased from NEB) and 8U RiboLock RNase inhibitor (purchased from NEB), and incubate at 30°C for 60 minutes and then at 37°C for 60 minutes.

[0285] 5' adapter sequence ligation: Add 5' adapter ligation solution (purchased from NEB) containing 0.23×T4 RNA ligase buffer (purchased from NEB), 45 pmol 5' adapter sequence (SEQ ID NO: 2), 4 U T4 RNA ligase 1 (purchased from NEB) and 0.68 mM ATP, and incubate at 22°C for 60 minutes.

[0286] Reverse transcription: Add RT reaction solution containing 1× Protoscript II reverse transcriptase reaction buffer (purchased from NEB), 10mM DTT, 0.5mM dNTPs, 10U RiboLock RNase inhibitor (purchased from NEB) and 100U Protoscript II reverse transcriptase (purchased from NEB), and incubate at 44°C for 60 minutes.

[0287] PCR pre-amplification: A pre-amplification reaction solution containing 1×Q5 reaction buffer, 0.2 mM dNTPs, 1.25 μM FPI primer (SEQ ID NO: 4, Sangon Biosynthesis) and 0.8 U Q5 hot start high-fidelity DNA polymerase (purchased from NEB) was added. The pre-amplification program was 94°C for 2 minutes, followed by 98°C for 10 seconds, 60°C for 30 seconds, and 72°C for 30 seconds, and repeated 13 times in total.

[0288] Cas9 / sgRNA complex treatment: The obtained pre-amplification product was added with a Cas9 / sgRNA complex containing 1×Cas9 reaction buffer (purchased from NEB), 1.2 pmol Cas9 enzyme (purchased from NEB) and 2 pmol sgRNA 2, 3, 4 (SEQ ID NO: 11, 12, 14) mixed solution, and incubated at 37°C for 2 hours.

[0289] PCR amplification again: add a second round of amplification reaction solution containing 1×Q5 reaction buffer (purchased from NEB), 0.2mM dNTPs, 0.5μM FPI primer (SEQ ID NO: 4, Sangon Biosynthesis), 0.5μM RPI primer (SEQ ID NO: 5, Sangon Biosynthesis) and 0.5UQ5 hot start high-fidelity DNA polymerase (purchased from NEB), the amplification program is 94°C for 2 minutes, then 98°C for 10 seconds, 60°C for 30 seconds, 72°C for 30 seconds, and repeated 10-13 times in total, and finally 72°C for 5 minutes. The number of cycles of the second round of amplification depends on the cell type or the total amount of RNA, and the number of cycles for half of the normal somatic cells is 13.

[0290] Library product recovery: All samples were pooled together and concentrated using the Monarch PCR & DNA Cleanup kit (purchased from NEB, catalog number T1030S) and products of appropriate size (135 bp to 180 bp) were recovered using 6% polyacrylamide gel.

[0291] 5. Construction of transcriptome (long RNA) library (Smart-seq2)

[0292] Taking single cells as an example, the construction of transcriptome library refers to Smart-seq2 (Picelli et.al.., 2013):

[0293] Reverse transcription: 1 μl of 10 μM oligo-dT 30VN primer (SEQ ID NO: 16) and 1 μl of 10 mM dNTP were added to the cell lysate and heat denatured at 72°C for 3 minutes.

[0294] Template conversion: add 7 μl of reverse transcription reaction solution containing 0.50 μl ProtoscriptII reverse transcriptase, 0.25 μl RiboLock RNase inhibitor, 2 μl ProtoscriptII reaction buffer, 1 μl 100 mM DTT, 2 μl 5 M betaine, 0.12 μl 0.5 M MgCl2 and 0.1 μl 100 μM TSO (SEQ ID NO: 15), incubate at 42°C for 90 min and 70°C for 15 min.

[0295] PCR pre-amplification: add 40 μl containing 1×KOD buffer, 0.2 mM dNTP, 2.5 mM MgSO4, 0.1 μM ISPCR primer (SEQ ID NO: 17) and 0.5 U KOD-plus-neo amplification enzyme (purchased from TOYOBO), the amplification program is 98°C for 3 minutes, then 98°C for 20 seconds, 67°C for 15 seconds, 72°C for 6 minutes, and repeat 10-21 times in total, and finally 72°C for 5 minutes. The number of PCR cycles depends on the cell type or the amount of starting RNA. Ordinary somatic cells use 18 cycles, and half a cell or 10 pg of total RNA uses 19 cycles.

[0296] Screening DNA library: The pre-amplification product was recovered using 0.8 times the volume of Ampure XP magnetic beads (purchased from Beckman Co., catalog number A63882), and quantified and quality checked. The process is as follows: add 40 μl of XP magnetic beads that have been mixed evenly and left at room temperature for 30 minutes to 50 μl of pre-amplification system. Use a gun to blow and aspirate evenly, and let stand at room temperature for 5 minutes. Use a magnetic stand to adsorb the magnetic beads, discard the supernatant, and add 200 μl of 80% ethanol to wash twice. After drying at room temperature, add an appropriate amount of water to resuspend the magnetic beads, and let stand at room temperature for 5 minutes. Use a magnetic stand to adsorb the magnetic beads, and transfer the supernatant to a new PCR tube.

[0297] Library quantification and quality control: The full-length library was quantified using a DNA high-sensitivity kit and Qubit, and the size of the DNA library was quality checked using a DNAHSD5000 ScreenTape assay kit (purchased from Agilent, catalog number 5067-5593). The size distribution of high-quality full-length DNA libraries was 500-10,000 bp, with the main peak concentrated between 1,000-3,000 bp.

[0298] Secondary PCR amplification: The full-length DNA library of qualified quality was constructed using the assembled Tn5 complex (laboratory purified). 0.2-1ng of the full-length DNA library was mixed evenly with 0.05-0.1μl of assembled Tn5 and 1× reaction buffer and incubated at 55°C for 7 minutes. 5μl of 0.2% SDS was added and incubated at room temperature for 7 minutes. Subsequently, 37.5μl of 1×Kapa DNA polymerase reaction buffer, 0.2mM dNTPs, 0.5mM N501 primer (SEQ ID NO: 14), 0.5mM N701 primer (SEQ ID NO: 15) and 1U Kappa HiFi DNA polymerase (purchased from Kappa) and amplification reaction solution were added. The amplification program was 72°C for 3 minutes, 98°C for 15 seconds, then 98°C for 10 seconds, 63°C for 30 seconds, 72°C for 3 minutes, and repeated 5-12 times in total, and finally 72°C for 3 minutes. The number of amplification cycles depends on the amount of full-length DNA, generally 12 cycles for 1 ng of DNA.

[0299] Screening of DNA library: The final transcriptome library was recovered using 1 volume of XP magnetic beads, and the process was the same as the screening of pre-amplified products.

[0300] Library quantification and quality control: Qubit (purchased from Thermo Fisher) was used to quantify the full-length library, and the DNA HSD1000 ScreenTape assay kit (purchased from Agilent, catalog number 5067-5585) was used to quality control the size of the DNA library. The size distribution of high-quality full-length DNA libraries was 300 to 1000 bp, with the main peak concentrated between 400 and 500 bp.

[0301] 6. Data Processing and Analysis

[0302] Both small RNA and long RNA libraries were sequenced using the Illumina Hiseq XTen (Illumina, PE150) platform.

[0303] The raw data of small RNA sequencing was used to remove the adapter sequence and filter low-quality data using cutadapt (Martin, 2011). After removing the adapter, sequences less than 17nt and low-quality sequences were filtered out (obtaining useful sequences, useful reads), and then the remaining sequences were aligned to the human genome (hg38) (PMID: 19261174) using bowtie to obtain mappable sequences (mappable reads). The mappable sequences were then aligned with known miRNAs, tRNA, rRNA, snoRNA, and snRNA. The identification criteria for miRNAs were that they could match the annotated, mature miRNA sequence (miRbaseV22) (Kozomara and Griffiths-Jones, 2014), and the 3' end of the sequence allowed a 1-2 base deletion. The remaining sequences were used to identify piRNAs using the methods reported (Rosenkranz and Zischler, 2012).

[0304] For long RNA, STAR was used to match the obtained sequences to the human genome (hg38) (Dobin et al., 2013), and the gene expression was calculated using the RSEM tool. The transcriptome annotation was derived from the Gencode database (V29) (Li and Dewey, 2011), and the gene counts were extracted from htseq. The annotation of transposons was derived from the Repbase database.

[0305] Example 1. Optimization of linker dosage and RNA denaturation conditions

[0306] Studies have found that increasing the amount of adapters in the system can improve the efficiency of ligation (Faridani et al., 2016; Zhang et al., 2013). Since a single somatic cell contains approximately 5-20 pg of total RNA, the inventors used 10 pg of mouse testicular RNA (laboratory extraction) as material and used different adapter concentrations to construct a small RNA library to simulate the construction of a small RNA library at the single-cell level. The PAGE gel electrophoresis quality inspection results showed that compared with the library constructed with a low concentration of adapters, the library with a high concentration of adapters had faint bands observed at 13 amplification cycles, and the bands were very clear at 16 amplification cycles ( Figure 2 a; Lane 1 vs 3, Lane 5 vs 7). The sequencing results showed that the library constructed with high-concentration adapters detected 52 more miRNAs on average than the library constructed with low-concentration adapters, and the majority of these detected miRNAs were low-expression miRNAs ( Figure 2b). The above results show that increasing the concentration of the adapter can indeed improve the efficiency of the connection and increase the sensitivity of the method.

[0307] RNA itself may have a higher-order structure that hides the 3' end inside, thus affecting the connection efficiency of the adapter. Therefore, before the connection reaction, the RNA generally needs to be heat-denatured and immediately placed on ice to maintain its loose structure. And then, in order to ensure efficient annealing of the 3' adapter and the reverse transcription primer (RTP), the RNA needs to be heat-denatured again. On the one hand, too many heat denaturation operations increase the risk of RNA degradation, and on the other hand, they also increase the complexity of the library construction process and the cost of reagents. Therefore, the inventors tried to remove the denaturation process before the annealing of the reverse transcription primer (i.e., the simplified version). By comparing the library construction results of the original version (O, denaturation before the annealing of the reverse transcription primer was not removed) and the simplified version (S, denaturation before the annealing of the reverse transcription primer was removed), the inventors found that the library of the simplified version generally has more adapter self-ligation products ( Figure 2 a), so the original version of the process is still used in the future.

[0308] Example 2. Optimization of connector connection conditions

[0309] The inventors tested three different 3' linker ligation conditions, namely, incubation at 22°C for 2 hours (Yang et al., 2019), incubation at 30°C for 6 hours and then at 4°C for 10 hours (Faridani et al., 2016), and incubation at 16°C for 16 hours. PAGE gel electrophoresis results showed that the three ligation conditions could successfully construct libraries, but the miRNA bands in the library incubated at 22°C for 2 hours were clearer and the linker self-ligation bands were weaker ( Figure 4 b, comparison of lanes 8, 9 and 10).

[0310] The sequencing results showed that the expression levels of miRNA detected by the three connection methods were highly correlated ( Figure 3 a), the number of miRNA species detected was basically the same ( Figure 3 b). This indicates that in the current ligation system, 2 hours of incubation has basically completed the connection between all miRNAs and adapters. Longer incubation time will not only fail to increase the effective products, but will lead to the production of more adapter self-ligation byproducts.

[0311] Therefore, the inventors selected 22° C. incubation for 2 hours as the condition for connector connection, which not only has a good effect but also saves a lot of time.

[0312] Example 3. Optimization of removal strategy for linker self-ligation products

[0313] The linker self-ligation products mainly come from the connection of excess 3' linkers and 5' linkers in the system ( Figure 4 a). The less starting material or the more adapters are used, the more adapter self-ligation products are produced. A careful observation of the PAGE gel electrophoresis results of the small RNA libraries constructed using different adapter amounts revealed that when 13 amplification cycles were used, the library with a higher adapter amount had obvious adapter self-ligation products, while the library with a low concentration of adapters did not see similar bands ( Figure 2 a; lane 1 vs lane 3). As the number of amplification cycles continued to increase, the products of self-ligation of adapters in the library constructed with high adapter concentration became more and more obvious, and were significantly more than those in the library constructed with low adapter concentration. Therefore, in the case of a small amount of RNA input, if you want to increase the sensitivity of detection by increasing the amount of adapters, you have to face the rather thorny problem of excessive self-ligation products of adapters.

[0314] To address this problem, the inventors integrated three methods for removing the self-ligation products of the linker ( Figure 4 a):

[0315] (1) Add excess reverse transcription primer to block the 3' linker:

[0316] Before ligating the 5' adapter, an excess of reverse transcription primer is used to block the 3' adapter to generate 3' adapter / RTP double-stranded DNA. Since T4 RNA ligase 1 has extremely low ligation activity for single-stranded RNA and double-stranded DNA, most of the ligation between the 3' adapter / RTP (dsDNA) and the 5' adapter (ssRNA) is avoided (Yang et al., 2019).

[0317] (2) D&L enzyme treatment:

[0318] For trace samples, even extremely low ligation efficiency will produce considerable adapter self-ligation in excess of sample ligation products. Therefore, the inventors used 5'deadenylase&lambda (D&L) enzyme treatment (Faridani et al., 2016). Lambda exonuclease preferentially digests DNA strands containing 5'-terminal monophosphate in double-stranded DNA, which can efficiently remove 3' adapters in the current system, reduce the amount of 3' adapters / RTP, and thus reduce the chance of self-ligation.

[0319] (3) Cas9 / sgRNA complex treatment:

[0320] Both previous studies (Hagemann-Jensen et al., 2018) and the inventors' own results show that the above treatment alone cannot cleanly remove the self-ligation of the junction at the single-cell level ( Figure 4b). Therefore, the inventors designed three sgRNAs (SEQ ID NO: 10, 11, 12, and sgRNA 2 and 3 were subsequently used to remove the adapter self-ligation) that specifically target the adapter self-ligation products, and added the Cas9 / sgRNA complex after one round of pre-amplification to remove the residual adapter self-ligation products.

[0321] In order to test the effect of the current strategy, the inventors used 20pg of 293 cell total RNA to construct a small RNA library. PAGE gel electrophoresis results showed that the library that only used RTP blocking and D&L treatment still had a large number of linker self-ligation products, and at this time, whether it was increasing the concentration of D&L enzyme or increasing the treatment time, it was impossible to further remove more self-ligation products ( Figure 4 b, lanes 1-5). On this basis, the addition of Cas9 treatment effectively inhibited the production of linker self-ligation products. Even after only 30 minutes of treatment, a significant reduction in self-ligation products could be observed, and the best effect was achieved when the treatment time was 60 minutes or more ( Figure 4 b, lanes 6–8).

[0322] Example 4. Cas9 treatment can effectively remove the remaining linker self-ligation products

[0323] The inventors used 1ng, 100pg, 10pg, and 1pg of gradient diluted 293T cell total RNA, and constructed Cas9-treated and untreated small RNA libraries under the condition of 22°C for 2h ( Figure 5 a). The results show that without Cas9 treatment, the bands of self-ligation of the adapters are very obvious (indicated by black arrows), and a library that passes the gel run quality inspection can only be constructed starting with 1ng of total RNA. At the appropriate number of amplification cycles, a 140bp miRNA library band can be seen (indicated by gray arrows). When the total RNA is less than 1ng, the pattern of the library is similar to that of the control group without RNA addition, with some diffuse bands and the lack of specific miRNA library bands. When Cas9 is used for treatment, the products of self-ligation of the adapters are significantly reduced, and a library that passes the quality inspection can be obtained starting with 10pg of total RNA ( Figure 5 a, lane 8). When 1 pg of total RNA was used, the bands were diffuse and no clear miRNA library bands were observed, which was similar to the results of the control group without RNA addition.

[0324] At the same time, the inventors also used plasma exosome RNA (laboratory extraction) to construct a small RNA library to illustrate the treatment effect of Cas9. The composition of plasma exosome RNA is significantly different from that of total cell RNA. It does not contain 18srRNA and 28srRNA. It is mainly some very short mRNA and YRNA fragments. The proportion of small RNA is relatively high, so a smaller amount of RNA can be used to construct a small RNA library. The inventors used 50pg, 5pg, 0.5pg, and 50fg gradient diluted plasma exosome RNA to construct small RNA libraries treated and not treated with Cas9. Figure 5 As shown in the results of b, in the absence of Cas9 treatment, the self-ligation of the adapter is more serious. The band of the YRNA library obtained using 5pg RNA is almost invisible, and the pattern of the library is similar to that of the control group without RNA addition ( Figure 5 b, Lane 2). In samples treated with Cas9, the number of self-ligated products was significantly reduced, and a library with clear bands could be obtained with as little as 5 pg RNA. Libraries constructed with an input of 0.5 pg or less of RNA, regardless of whether or not they were treated with Cas9, had patterns similar to those of the control group without RNA.

[0325] The above results show that the addition of Cas9 processing flow can indeed effectively eliminate the formation of linker self-ligation products and reduce the requirements for the amount of starting RNA. It also illustrates the versatility and robustness of this method for detecting small RNAs from different biological materials.

[0326] Example 5. Off-target analysis of Cas9 treatment

[0327] When using Cas9 to treat libraries, one issue that must be treated with caution is whether Cas9 will mistakenly cut off non-target DNA while removing the adapter self-ligation product, thereby affecting the detection of small RNA expression. To explore this issue, the inventors compared the differences in miRNA types and abundance between libraries treated with Cas9 and those not treated with Cas9.

[0328] like Figure 6 As shown in the results, the library treated with Cas9 / sgRNA-1 showed a significant decrease in miRNA expression compared with the untreated library ( Figure 6 ). A careful analysis of the sequences of these miRNAs revealed that they all started with NGG, which just happened to serve as the PAM sequence of sgRNA-1 ( Figure 6 c and d). The correlation of miRNA expression between Cas9 / sgRNA-2 treated and untreated libraries was greater than 0.999 (Pearson correlation, R), and no obvious changes in miRNA expression were observed.

[0329] Therefore, the inventors subsequently used sgRNA-2 for Cas9 treatment.

[0330] Example 6. Removal of endogenous or exogenous contaminating RNA

[0331] The improvement of ligation efficiency will make the library extremely susceptible to interference from exogenous or endogenous contaminating RNA. There are a large number of rRNA and tRNA fragments in cells. Since they do not have the standard sequence characteristics of 5' monophosphate and 3' hydroxyl, it is generally difficult to be constructed into the library. However, the improvement of ligation efficiency increases the possibility of this part of RNA being connected, especially in the small RNA library of single cells, where rRNA sequences (reads) can reach 50% or more of all alignable sequences. These contaminating nucleic acids will affect the detection of the target small RNA, resulting in the failure of library construction or data waste (Hagemann-Jensenet.al.., 2018; Wang et.al.., 2019). In addition, most of the enzymes used in small RNA library construction are expressed and purified in Escherichia coli, usually carrying trace amounts of Escherichia coli RNA. This part of RNA has little effect when there is a lot of starting material, but it will take up a considerable amount of sequencing data in single-cell sequencing. Previous methods have no ideal strategy to remove these contaminating RNAs, and eCas-seq can solve this problem by adding relevant sgRNAs to the Cas9 processing process. For example, the 3' linker is connected using a high concentration (50U) of T4 RNA ligase 2 KQ, which contains more E. coli RNA residues. The residual nucleic acid contamination in different batches of this ligase is different, and can account for up to about 15% of all useful sequences ( Figure 7 b and c).

[0332] The sequencing results showed that the contaminating RNAs all originated from the same rRNA, so the inventors designed a corresponding sgRNA 4 (SEQ ID NO: 14) for this rRNA and added it to the Cas9 treatment process ( Figure 7 a). Figure 7 The qPCR results in b showed that the proportion of contaminating rRNA in the treated library was reduced by about 6 times (13% vs. 2%). Figure 7 The sequencing results of c showed that the proportion of contaminating rRNA in the processed library to all useful data was reduced from an average of 13% to less than 1%.

[0333] The above results show that eCas-seq can flexibly remove endogenous and exogenous contaminating RNA by adding corresponding sgRNA, improve the quality of the library and reduce the formation of such byproducts. This is an advantage that previous small RNA library construction methods do not have.

[0334] Example 7. Construction of gradient dilution 293FT cell total RNA and single / half cell small RNA library

[0335] In order to evaluate the sensitivity, robustness and reproducibility of eCas-seq, the inventors used 10ng, 1ng, 100pg, 10pg of 293FT cell total RNA, 293FT single or half cell, respectively, and constructed a small RNA library according to the eCas-seq method ( Figure 8 a).

[0336] like Figure 8 The results of a showed that all libraries passed the PAGE gel electrophoresis quality inspection, and the repeated samples had highly similar library patterns. As the RNA input amount decreased, the amount of adapter self-ligation was always within a reasonable range. When using less than 100pg total RNA and single / half cells, the library pattern changed slightly, but the band of the 140bp miRNA library was still clearly visible.

[0337] The sequencing results of 293FT cell total RNA, single cell and half cell libraries showed that the number of detected miRNA species gradually decreased with the decrease of RNA input. An average of 215 miRNAs can be detected in a single 293FT cell, which is equivalent to the level of 10pg 293FT total RNA, accounting for about half of the miRNAs that can be detected in 1ng total RNA ( Figure 8 b). On average, 160 miRNAs can be detected in half of a 293T cell, which is only about 1 / 3 of the detectable amount of 1ng of total RNA. Although the number of detected miRNAs has decreased significantly, the correlation between samples remains at a relatively high level ( Figure 8 c).

[0338] The above results show that eCas-seq can detect significant miRNA expression using as little as 10 pg of total cell RNA or half a cell as starting material, and the method has very good robustness.

[0339] Example 8. Construction of small RNA library using 3 / 4, 1 / 2 and 1 / 4 293FT single cells

[0340] In order to further determine the limit of the amount of cell samples required for eCas-seq, the inventors also tried to use 3 / 4, 1 / 2 and 1 / 4 293FT cells for library construction. PAGE gel electrophoresis results showed that clear miRNA library bands were obtained using the above proportions of cells, which was very different from the pattern in the water negative control, but the bands were more blurred when 1 / 4 cells were used ( Fig. 9 a).

[0341] The sequencing results showed that the libraries constructed using 3 / 4 and 1 / 2 cells had comparable ratios of useful reads and mappable reads, and a lower dosage would result in a more obvious reduction ( Fig. 9 b). The proportion of miRNA data in the library constructed using 3 / 4 cells is about 30%, while the proportion of miRNA in the libraries constructed using 1 / 2, 1 / 4 and 10pg of total cell RNA is between 16-20%. The results of the small RNA length distribution show that the decrease in the proportion of miRNA may be due to the increase in the proportion of tRNA, rRNA and mRNA fragments.

[0342] The above results suggest that eCas-seq can use at least 1 / 2 of the cells to obtain a small RNA library of relatively good quality.

[0343] Example 9. Evaluation of eCas-seq performance

[0344] The abundance of miRNA in ordinary somatic cells is high, and the types are few, so it is relatively simple to detect. In mouse testicular RNA, there are many types of piRNA and the expression of a single type is not high. The types and expression of miRNA are also maintained at a relatively low level, which is a relatively big challenge for small RNA sequencing methods. Therefore, it is a material with very good sensitivity and reproducibility of the analysis method. The inventors used 100ng, 10ng, 1ng, 10pg gradient dilutions of mouse testicular total RNA (laboratory extraction) to construct a small RNA library ( Fig.10 a). Similar to the results of total RNA from 293FT cells, all libraries were successfully constructed. The pattern of libraries constructed using 100 pg of RNA or less began to change, but the band of the 150 bp piRNA library was not affected overall.

[0345] The sequencing results of mouse testicular total RNA library showed that the number of miRNA species that could be detected using 100ng, 10ng, 1ng, and 100pg testicular RNA was basically similar, at more than 320 species ( Fig.10 b, left). Highly expressed miRNAs (reads counts>=10) can be stably detected in all libraries, but when the RNA input is reduced to 10pg, information begins to be lost. At this time, the number of detectable miRNA species is about 220, accounting for more than half of all detectable miRNA species. The results of piRNA are similar to those of miRNA as a whole, but due to the large number of piRNA species and low expression, the differences between libraries constructed with different RNA inputs are more obvious ( Fig.10b, right). A maximum of more than 200,000 piRNAs can be detected with 100ng RNA input. As the RNA input decreases to 100pg, most highly expressed piRNAs can still be stably detected, but low-abundance piRNAs begin to be seriously lost. When the RNA input is further reduced to 10pg, only 25,000 highly expressed piRNAs can be detected. The above results show that the current method can capture the information of miRNA and piRNA in as little as 10pg of total RNA.

[0346] The inventors then analyzed the correlation between miRNA and piRNA expression in the mouse testis RNA library. Fig.10 c The results show that the Pearson correlation of miRNA expression between the three replicate samples with the same RNA input amount is above 0.95. The correlation between two adjacent gradients is also maintained at a high level, but as the difference in RNA input amount increases, the correlation of miRNA expression gradually decreases. The correlation of miRNA expression between the highest and lowest RNA input libraries is still greater than 0.8, which suggests that even if only 10pgRNA is used, miRNA expression information very similar to that in 100ngRNA can be obtained ( Fig.10 c, left). The results of piRNA are similar to those of miRNA, except that the differences between libraries with different RNA input amounts are more obvious ( Fig.10 c, right). The above results demonstrate that eCas-seq has excellent robustness.

[0347] Secondly, the inventors evaluated the ratio of miRNA and piRNA that can be stably detected in RNA samples diluted in a gradient of 100 ng, 10 ng, 1 ng, 100 pg, and 10 pg ( Fig.10 de) to analyze the reproducibility of the method. The results showed that highly expressed miRNAs and piRNAs could be stably detected in all dilution gradients, while the detection ratio of low-expressed small RNAs began to decrease significantly when the input amount was 100pg of total RNA, and the information loss was more serious when the input amount was 10pg of total RNA. However, even in the low-input library, the detection ratio of low-expressed small RNAs between repeated samples remained at a relatively stable level.

[0348] The above results demonstrate that eCas-seq has fairly good reproducibility.

[0349] Example 10. Comparison of eCas9 with other small RNA sequencing methods

[0350] In order to compare with the previous trace small RNA library construction methods, the inventors used the NEBNext small RNA library construction method (NEB, catalog number E7330S), SA-seq method (see 2016-Science Advance-Highly sensitive sequencing reveals dynamic modifications and activities of small RNAs in mouse oocytes and early embryos) and Cas9-seq method (2019-Nature Communication-Single-cell CAS-seq reveals a class of short PIWI interacting RNAs in human oocytes or CN107488655B) at the same time, and constructed a small RNA library according to the appropriate RNA input amount of each method, that is, the RNA input amount of the NEBNext method was 100 ng, the RNA input amount of the SA-seq method was 10 ng, and the RNA input amount of the Cas9-seq method was 1 ng. Fig.10 a).

[0351] The sequencing results showed that eCas-seq could obtain more or equivalent miRNA and piRNA species even with only 100 pg of total RNA than NEBNext method using 100 ng of total RNA, SA-seq using 10 ng of total RNA, and Cas-seq using 1 ng of total RNA ( Fig.10 b and 10d-e). Interestingly, there are obvious systematic differences between different methods, suggesting that different library construction methods may have different preferences for small RNA connections ( Fig.10 c).

[0352] The above results show that compared with previous commercial kits or trace library construction methods, eCas-seq can preserve more small RNA information under the same conditions and has higher sensitivity.

[0353] Example 11. Comparison of eCas9 with other single-cell small RNA sequencing methods

[0354] Two methods for single-cell small RNA sequencing have been reported previously, namely Small-seq and Wang-seq (Faridani et al., 2016; Wang et al., 2019). The inventors downloaded the data of the 293FT single-cell small RNA library constructed using Small-seq and the data of the K562 single-cell small library constructed using Wang-seq, and used eCas-seq to construct single-cell small RNA libraries of 293FT and K562 for comparative analysis.

[0355] Compared with Small-seq, eCas-seq can obtain nearly twice as many available sequences (46.63% vs. 86.11% on average) and comparable sequences (12.20% vs. 27.50% on average) at the same sequencing depth, and detect 90 more miRNAs ( Fig.11 Compared with Wang-seq, eCas-seq can obtain nearly three times more available sequences (average 20.91% vs. 78.38%) and nine times more comparable sequences (average 4.76% vs. 48.58%), and detect nearly three times more miRNAs (55 vs. 210) ( Fig.11 df).

[0356] The above results show that the performance of eCas9 on single cells is superior to these two single-cell methods in terms of library quality and detection sensitivity.

[0357] Example 12. Extracellular small RNA sequencing analysis

[0358] There are many body fluids in the human body, such as blood, sweat, urine and milk, which usually contain RNA molecules (extracellular RNAs, exRNA). More and more evidence shows that extracellular small RNAs can reflect the physiological and pathological characteristics of the corresponding tissues of the body and can be used as molecular markers for the diagnosis and treatment of various diseases (Cossetti et al., 2014; Hazan-Halevy et al., 2015). Since the amount of body fluid samples is small and precious, the sensitivity of small RNA methods is relatively high. For example, many body fluids contain extracellular vesicles (EVs), which are membrane structures released by cells into the extracellular space. They vary in size (from 40 nm to 10 μm) and are wrapped by a phospholipid bilayer membrane (Ciardiello et al., 2016). They can be used as carriers for transferring bioactive molecules, transporting proteins, lipids, DNA and RNA (Turturici et al., 2014; Kanada et al., 2015), and completing information exchange between cells. The RNA content in each milliliter of plasma EV is between 2 and 5 ng, and contains a large number of highly expressed ysRNAs, which affects the detection of miRNA expression. Currently, there is no targeted small RNA library sequencing to solve these problems.

[0359] The inventors optimized the conditions such as the amount of adapters and connection conditions in eCas-seq, including: 1) reducing the concentrations of 3' adapters (10 times), RTP (5 times) and 5' adapters (5 times) in the system; 2) shortening the D&L treatment time to 30 degrees for 30 minutes and then 37 degrees for 30 minutes to adapt it to the construction of trace exRNA libraries. The inventors also designed the corresponding sgRNA 5 (SEQ ID NO: 21) for ysRNA to minimize the content of ysRNA ( Fig.12 ab).

[0360] Both the gel image and sequencing results showed that the proportion of ysRNA decreased significantly after treatment, and the treatment did not affect the types and expressions of other small RNAs ( Fig.12 ce). The optimized method can effectively improve the detection of miRNA and obtain more high-quality data ( Fig.12 fg).

[0361] Example 13. Construction of single-cell ribosomal imprint sequencing library (scRibo-seq)

[0362] Ribosome imprinting sequencing technology (Ribo-seq) can study the level, region, rate, etc. of gene translation in cells. Combined with transcriptome, small RNA sequencing, proteome, etc. for association analysis, it can more accurately study post-transcriptional regulation and translation regulation mechanisms. Traditional Ribo-seq uses RNase to digest RNA in cells to obtain RNA fragments (RFs) that are protected by ribosomes and are being translated, and then uses specific antibodies to enrich, sequence and analyze these RFs. Because it involves the enrichment of ribosomes, the material requirements are large and it cannot be applied to precious samples, such as oocytes. The recently published scRibo-seq method (2021-Nature-Single-cell Ribo-seq reveals cell cycle-dependent translationalpausing) removes the RFs enrichment process and constructs a library of RFs based on the small RNA library establishment method, which greatly simplifies the experimental process and improves the sensitivity of detection. The inventors used this idea as a model and replaced the small RNA construction method in this method with the more sensitive eCas-seq.

[0363] The data quality and sensitivity of this method are slightly better than the original method, and it can stably obtain the RNA bound to ribosomes in a single cell and its specific binding location ( Fig.13 ).

[0364] Example 14. Construction of RNA immunoprecipitation library from trace samples (RIP-seq)

[0365] RIP-seq is one of the most effective means to study protein-binding RNA, and it can obtain information about all RNAs bound by a certain RNA-binding protein. However, the current RIP-seq method (refer to the RIP-seq operation methods of illumina, novogene, etc.) is limited by its sensitivity and cannot be applied to rare samples, such as precious oocytes, early embryos, and a small number of cells that are difficult to obtain, which greatly limits the application of this method. The most important limiting factor is that very little RNA is obtained after protein IP, and the corresponding library cannot be effectively constructed using conventional methods. The high sensitivity of eCas-seq can effectively utilize these trace amounts of RNA to obtain high-quality libraries.

[0366] The inventors used wild-type (WT) and PIWIL1 mutant single oocytes (isolated and collected from laboratory animals), used PIWIL1 protein antibodies to IP its bound piRNA, and used the eCas-seq method for library construction and sequencing.

[0367] The specific steps are as follows: take an appropriate amount of protein G beads (Thermo Fisher), wash once with lysis buffer (50 mMTris-HCl (pH 7.4), 150 mM NaCl, 0.005% NP-40), add 1.5 μg PIWIL1 protein antibody or IgG antibody (Thermo Fisher), rotate at room temperature for 0.5 h, then wash once with lysis buffer for use; 6-10 oocytes are lysed with 22.5-30 μl lysis buffer, placed on ice for 10 min, then centrifuged at 13000 rpm, 4℃ for 10 min, take 7.5 μl oocyte lysate and add it to the protein G beads that have been bound to the antibody, rotate slowly at 4℃ for 5 h, after the reaction is completed, wash 4 times with 20 μl lysis buffer, 5 min / time, then wash once with PBS, finally resuspend the beads with 2 μl DEPC water, incubate at 75℃ for 5 min, immediately place on ice, then recover the supernatant on the magnetic rack and transfer to a new PCR tube. Add 500 μl of Trizol to the remaining 7.5 μl of egg cell lysate for RNA extraction, and finally dissolve the precipitate with 2 μl of DEPC water and transfer it to a new PCR tube as input to construct a small RNA library using eCas-seq together with the IP group samples.

[0368] Fig.14 The results showed that the library could be successfully constructed, and the sequencing results were in line with expectations, with high data quality.

[0369] Example 15. Design of a single-cell multi-omics method including small RNAs

[0370] If you want to fully understand a cell, it is far from enough to obtain only one type of omics data, because the type and state of the cell are determined by the complex interactions between multiple molecules, and any single omics can only represent a small and low-complexity part of the information (Macaulay et al., 2017). Therefore, in order to study the regulation and function of gene expression mediated by small RNA at the single-cell level, the best strategy is to collect and analyze data in the same cell, thereby avoiding the deviation caused by intercellular heterogeneity. As a result, a variety of single-cell multi-omics sequencing methods have been born (Hedlund and Deng, 2017; Hu et al., 2018; Macaulay et al., 2017; Packer and Trapnell, 2018). In the past, there have been many studies on single-cell multi-omics, but these studies have focused more on the transcriptome and genome of single cells (Dey et al., 2015), the transcriptome and methylome of single cells (Hou et al., 2016; Anger mueller et al., 2016; Hu et al., 2016), the dual-omics of single-cell transcriptome and proteome, and the tri-omics of single-cell transcriptome, methylome and genome (Guo et al., 2017). The difficulties in the development of single-cell small RNA library construction methods have greatly hindered the development of multi-omics methods including small RNA. For example, in 2019, Wang et al. combined the single-cell small RNA library construction method with the existing single-cell transcriptome library construction method to simultaneously sequence the small RNA and transcriptome of a single cell (Wang et al., 2019), but because the small RNA library construction in this method uses a simplified version of small-seq, the library quality is very poor and little effective information is obtained. The difficulties in developing single-cell small RNA library construction methods have greatly hindered the development of multi-omics methods including small RNA.

[0371] The eCas-seq developed by the inventors has extremely high sensitivity and can obtain high-quality small RNA data using half a cell as material. Therefore, combining eCas-seq with single-cell transcriptome sequencing (such as Smart-seq2) can simultaneously obtain small RNA and mRNA expression information in a single cell ( Fig.15 a). The inventors used the eCas-seq+Smart-seq2 method as an example and verified it in the construction of a single-cell library.

[0372] Using 9 K562, 293FT and Hela single cells, 18 half-cell small RNA libraries were constructed according to the eCas-seq method. The sequencing results showed that the two parts of the same cell were very similar, indicating that the differences introduced by cell division and the method itself were relatively small. However, the similarities between the two parts of different cells were uneven and not exactly the same, indicating that the heterogeneity between different cells was different ( Fig.16 ad). The above results show that the current method will not introduce too many system differences at the level of small RNA sequencing and can truly reflect the heterogeneity between cells.

[0373] Secondly, 18 half-cell polyA+mRNA libraries were constructed using 9 Hela and 293T single cells respectively according to the Smart-seq2 method. The results also showed that the difference in mRNA expression within cells was smaller than that between cells ( Fig.16 ef), proving that the eCas-seq+Smart-seq2 method does not introduce too many system differences in mRNA library construction and can truly reflect intercellular heterogeneity. The above results prove that eCas-seq can be used to construct single-cell small RNA and mRNA co-sequencing libraries.

[0374] In addition to the single-cell small RNA and mRNA co-sequencing library, the eCas-seq of the present invention can also be used for the design of single-cell multi-omics methods including small RNA. For example, the above two-omics method only uses the cytoplasm part, and the information of the nucleus part is lost. By utilizing the nucleus and using the existing single-cell genome or methylation group sequencing methods, a single-cell small RNA, transcriptome and genome / methylation group three-omics sequencing method can be established ( Fig.15 b).

[0375] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. At the same time, all the documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference separately.

Claims

1. A method for removing adapter self-ligation products during small RNA library preparation, comprising: Step a) adding excess reverse transcription primer to block the 3' linker; Step b) D&L enzyme treatment; and Step c) Cas-sgRNA complex treatment.

2. The method according to claim 1, characterized in that The small RNA is RNA extracted from cells, cell supernatants, tissues, organs, body fluids or secretions; Preferably, the small RNA is derived from oocytes, HEK293T cells, HEK293FT cells, Hela cells, testes, brain tissue, adipose tissue, skin tissue, nerve tissue, lymphatic tissue, muscle tissue, serum, plasma, urine, cerebrospinal fluid, saliva, nasal secretions, alveolar lavage fluid, milk, synovial fluid, semen, uterine fluid, bile, lymph fluid, feces, amniotic fluid, embryo culture medium; More preferably, the small RNA is total RNA derived from a small number of cells, RNA from a single cell, or RNA from 1 / 4 of a single cell, 1 / 2 of a single cell, or 3 / 4 of a single cell.

3. The method according to claim 1 or 2, characterized in that The step a) comprises: Step a1): using the 3' adapter to carry out a ligation reaction with the RNA to be sequenced to obtain a 3' adapter ligation reaction product; Step a2): adding excess reverse transcription primer to block the 3' adapter not involved in the ligation reaction to form a RTP / 3' adapter double-stranded product; Preferably, the concentration of the reverse transcription primer in step a2) is 2 to 100 times, 3 to 50 times, 4 to 30 times or 5 to 20 times the concentration of the 3' linker sequence; and / or, Preferably, step a2) is performed under denaturation slow annealing conditions, wherein the denaturation slow annealing conditions are incubating at 75±5°C for 2±0.5 minutes, slowly cooling to 60±5°C, and incubating at 60±5°C for 2±0.5 minutes; more preferably, the slow cooling conditions are reduced by 0.3±0.1°C per second; and / or, Preferably, the conditions for the 3' linker ligation reaction in step a1) are any one of the following: Condition 1: 22±3℃ ligation reaction for 2±0.5 hours, preferably 22±1℃ ligation reaction for 2±0.2 hours; Condition 2: ligation reaction at 30±2℃ for 6±0.5 hours and then at 4±2℃ for 10±0.5 hours, preferably ligation reaction at 30±1℃ for 6±0.2 hours and then at 4±1℃ for 10±0.2 hours; Condition 3: 16±2°C for 16±0.5 hours, preferably 16±1°C for 16±0.2 hours; and / or, Preferably, in step a1), a 3' linker ligase is added to allow the 3' linker to undergo a ligation reaction; more preferably, the 3' linker ligase includes but is not limited to: T4 RNA ligase 2 and variants thereof, T4 RNA ligase 1 and variants thereof, 5'APP DNA / RNA ligase and variants thereof, and RTCB ligase and variants thereof.

4. The method according to claim 1 or 2, characterized in that: The step b) comprises: Step b1): treating the 3' adapter in the 3' adapter / reverse transcription primer double-stranded product with D&L enzyme; Step b2): after removing the 3' linker, add the 5' linker to carry out ligation reaction; Preferably, the D&L enzyme comprises: 5'deadenylase, lambda exonuclease, and an optional RNase inhibitor; more preferably, corresponding to 10pg to 100ng RNA, 10 to 100 units of 5'deadenylase and 2 to 20 units of lambda exonuclease are used; and / or, Preferably, in step b2), a 5' linker ligase is added to allow the 5' linker to undergo a ligation reaction; more preferably, the 5' linker ligase includes but is not limited to: T4 RNA ligase 1 and its variants, T4 RNA ligase 2 and its variants, 5'APP DNA / RNA ligase and its variants, and RTCB ligase and its variants.

5. The method according to claim 1 or 2, characterized in that: The step c) comprises: Step c1): reverse transcribing the product obtained in step b2) to obtain a reverse transcription product; Step c2): performing PCR amplification on the reverse transcription product obtained in step c1) to obtain a PCR amplification product; Step c3): mixing the PCR amplification product obtained in step c2) with the Cas enzyme and sgRNA, thereby removing the 3' adapter and 5' adapter ligation byproducts in the PCR amplification product; Preferably, in step c3), the sgRNA comprises an sgRNA selected from the nucleotide sequences shown in SEQ ID NO: 10, 11, and 12.

6. A method for removing adapter self-ligation products and contaminating nucleic acids during small RNA library preparation, comprising: A method for removing adapter self-ligation products during the preparation of a small RNA library as claimed in any one of claims 1 to 5, and a method for removing contaminating nucleic acids during the preparation of a small RNA library; Preferably, the method for removing contaminating nucleic acids during the preparation of the small RNA library comprises: mixing the PCR amplification product from which the adapter self-ligation product is removed with the Cas enzyme and the sgRNA, thereby removing the contaminating nucleic acids in the PCR amplification product; More preferably, the sgRNA comprises an sgRNA having a nucleotide sequence as shown in SEQ ID NO:

14.

7. A method for preparing a small RNA library, comprising: The method for removing adapter self-ligation products during the preparation of a small RNA library according to any one of claims 1 to 5 or the method for removing adapter self-ligation products and contaminating nucleic acids during the preparation of a small RNA library according to claim 6, and, Step d): PCR amplification; and, Step e): library recovery; Preferably, the step d) is to perform PCR amplification on the product obtained in step c3) to obtain a PCR amplification product; and / or, Preferably, the library recovery method in step e) is recovery using magnetic beads or gel electrophoresis; preferably, the cDNA fragment size obtained after library recovery is 135 to 180 bp.

8. A kit comprising: An RNA 3' end connection module, wherein the connection module comprises a 3' end adapter and is used to connect the 3' end adapter to the 3' end of the RNA; A reverse transcription primer blocking module, which contains a reverse transcription primer and is used to block the 3' end adapter; A D&L enzyme cleavage module, which contains a D&L enzyme and is used to remove the 3' end adapter and the reverse transcription primer connection product generated by the 3' end connection module; An RNA 5' end connection module, wherein the connection module comprises a 5' end adapter and is used to connect the 5' end adapter to the 5' end of the RNA connected to the 3' end adapter; A reverse transcription module, comprising a reverse transcriptase and used for reverse transcribing the RNA molecule connected with the 3' end adapter and the 5' end adapter; A first amplification module, which contains enzymes required for DNA amplification and is used to amplify based on the product of the reverse transcription module; A Cas cleavage module, which comprises a Cas enzyme and sgRNA and is used to remove the adapter self-ligation products generated by the amplification module; A second amplification module, which contains enzymes required for DNA amplification and is used to amplify the enzyme-digested products to obtain a final library; Preferably, the concentration of the reverse transcription primer is 2 to 100 times, 3 to 50 times, 4 to 30 times or 5 to 20 times the concentration of the 3' end adapter; and / or, Preferably, the D&L enzyme comprises: 5'deadenylase, lambda exonuclease, and an optional RNase inhibitor; more preferably, corresponding to 10pg to 100ng RNA, 10 to 100 units of 5'deadenylase and 2 to 20 units of lambda exonuclease are used; and / or, Preferably, the sgRNA includes an sgRNA selected from the nucleotide sequences shown in SEQ ID NO: 10, 11, and 12.

9. A small RNA library prepared by the method for preparing a small RNA library according to claim 7.

10. A multi-omics sequencing library containing a small RNA library, characterized in that: The small RNA library is prepared by the method for preparing a small RNA library according to claim 7; Preferably, other omics of the multi-omics sequencing library include: long RNA sequencing library, genomic library, methylation library, CLIP library, RIP library, MeRIP library, GRO library, ATAC library, translation group library, RNA structure library; more preferably, the long RNA sequencing library is an mRNA sequencing library.

11. Use of the method according to any one of claims 1 to 7, or the kit according to claim 8, or the library according to claim 9, or the multi-omics sequencing library according to claim 10, comprising: Perform sequencing analysis or sequence comparison; Conduct analysis of gene structure, expression or regulation; Screening or analysis of functional genes; Screening or analyzing disease genes; Monitoring or analyzing IVF embryo quality or sperm quality; or Analyze gene abundance; Preferably, the diseases include: tumor, preeclampsia, Parkinson's disease; Preferably, the screening or analysis includes screening or analysis in the absence of disease, early stage, middle stage, late stage or prognosis of disease.

Images