Application of vitis amurensis gene VaWRKY65 in cold-resistant genetic improvement of plants

Abstract

The invention belongs to the field of plant genetic engineering, and discloses application of a vitis amurensis cold-resistant gene VaWRKY65 in plant cold-resistant genetic improvement, the VaWRKY65 gene is a transcription factor separated and cloned from extremely cold-resistant vitis amurensis, and the sequence of the VaWRKY65 gene is shown as SEQ ID NO.1. The invention further discloses a preparation method of the vitis amurensis cold-resistant gene VaWRKY65. The gene is used for constructing an overexpression and interference vector, the overexpression and interference vector is respectively introduced into arabidopsis thaliana and vitis amurensis through agrobacterium tumefaciens-mediated genetic transformation, and biological function verification of the obtained transgenic plant shows that the cloned VaWRKY65 gene has the function of improving the cold resistance of the plant. The discovery of the gene provides a new gene resource for plant stress resistance molecular design breeding and provides a new genetic resource for implementation of green agriculture and water-saving agriculture, and development and utilization of the genetic resource are beneficial to reduction of agricultural production cost and realization of environmental friendliness.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and specifically relates to the application of the Vitis amurensis gene VaWRKY65 in genetic improvement of plant cold resistance. The cold resistance of the obtained transgenic plants is significantly improved by overexpressing the gene in the plants, and the cold resistance of the obtained transgenic plants is significantly weakened by knocking out, inhibiting or silencing the gene in the plants. Background Art

[0002] Low temperature is the main abiotic stress factor that limits the production and distribution of some key economic crops. It can damage the cell membrane structure of plants, interfere with the synthesis of chlorophyll and photosynthesis, lead to decreased enzyme activity, increased reactive oxygen levels, dysregulated cell metabolism, and even cause plant death in extreme cases (Chinnusamy et al., 2007). In the long-term process of natural selection and evolution, plants have developed a series of complex and sophisticated response mechanisms to cope with fluctuations in the external environment. When plants encounter the stimulation of environmental changes, they can activate the expression of a series of defense and resistance genes through internal signal transduction pathways (Pankaj et al., 2016). In addition, these stress responses will also stimulate the enhancement of the antioxidant defense system and cause changes in a series of metabolites, such as soluble sugars, fatty acids, proline and betaine (Thomashow, 1999).

[0003] Low temperature response genes can be roughly divided into two categories: regulatory genes and functional genes. Regulatory genes are responsible for regulating signal transduction and gene expression, while the encoded products of functional genes directly play a protective role in cells (Wang et al., 2003; Zhu, 2016). As a type of regulatory gene, transcription factors play a dual role of "sensing-response". They can not only sense low temperature signals, but also specifically bind to cis-acting elements in the promoter region of genes, thereby regulating the expression of multiple low temperature response genes and enhancing the cold resistance of plants (Golldack et al., 2011; Nakashima et al., 2014). Therefore, the discovery and application of transcription factors is an efficient strategy to improve plant tolerance to adversity.

[0004] The WRKY transcription factor family is one of the largest families in higher plants. Increasing evidence shows that WRKY transcription factors can act as regulatory factors in transcriptional networks by binding to W-box (TGAC) in the promoter of target genes, and participate in a series of biological processes including development, secondary metabolite synthesis, carbohydrate synthesis, reactive oxygen species (ROS) homeostasis, hormone signaling, and aging (Wang et al., 2023; Jiang et al., 2017; Rushton et al., 2010). In addition, some studies have shown that WRKY also plays an important role in responding to various abiotic stresses, especially cold stress. For example, overexpression of OsWRKY71 and OsWRKY76 confers cold stress resistance in rice (Yokotani et al., 2013; Kim et al., 2016). Overexpression of CdWRKY2 can promote sucrose biosynthesis and CBF signaling pathways to jointly improve the cold tolerance of Bermuda grass (Huang et al., 2022). However, existing technologies have not shown that WRKY transcription factors are involved in grape low temperature response.

[0005] Grape is a fruit crop widely planted around the world with high economic value. Low temperature damage is one of the important factors limiting the stability and sustainable development of the grape industry, and has an adverse effect on the growth, development, fruit quality and yield of grapes (Wan et al., 2008). The most common cultivated varieties are from V. vinifera, which is extremely sensitive to cold stress (Fennell, 2004; Xu et al., 2014). Therefore, improving cold resistance has always been one of the main goals of grape breeding programs. However, grapes face long life cycles, severe inbreeding depression, and complex genetic control of economic traits. Traditional breeding methods in production have limited the selection of new grape varieties and the rapid development of the industry to a large extent due to their low efficiency, high cost and long cycle. V. amurensis is a cold-resistant wild grape variety that can tolerate temperatures as low as -40℃. It has been widely used in traditional breeding to produce cold-resistant varieties (Fennell, 2004) and is an ideal material for discovering important grape cold-resistant genes. Therefore, cloning the cold-resistance-related genes of Vitis amurensis is the key and foundation of cold-resistance genetic engineering. Summary of the invention

[0006] The present invention aims to provide an application of the Vitis amurensis gene VaWRKY65 in genetic improvement of plant cold resistance. By overexpressing or silencing the gene in plants, plants with enhanced or weakened cold resistance can be obtained. The sequence of the protein encoded by the gene is shown in SEQ ID NO.2, and the corresponding nucleotide sequence is shown in SEQ ID NO.1.

[0007] In order to achieve the above purpose, the present invention adopts the following technical measures

[0008] Based on plant gene cloning technology, the applicant isolated and cloned a transcription factor from the extremely cold-resistant wild grape (Vitis amurensis). The applicant named it VaWRKY65, and its sequence is shown in SEQ ID NO.1, and its corresponding amino acid sequence is shown in the sequence table SEQ ID NO.2; open reading frame (ORF) prediction found that the gene contains one ORF, is 837bp in length, and encodes a protein of 278 amino acids. The applicant used qRT-PCR technology to analyze the induction of the relative expression of the VaWRKY65 gene by low temperature stress. In addition, the phenotypes and related physiological indicators of the VaWRKY65 transgenic strains before and after low temperature treatment were analyzed. The results showed that compared with the wild-type and control plants, the VaWRKY65 overexpressing plants had stronger cold resistance. In addition, the survival rate, BAM activity and soluble sugar content were significantly higher, and the conductivity, MDA content, starch content, H2O2 content and O2 ·- The content of VaWRKY65 in the plants was low, while the opposite was true in the VaWRKY65 knockout and transient silencing plants, indicating that the VaWRKY65 gene is a potential cold-resistance breeding gene.

[0009] The protection scope of the present invention includes:

[0010] Application of the protein shown in SEQ ID NO.2 or the gene encoding the protein in regulating plant cold resistance;

[0011] The above-mentioned applications are specifically:

[0012] Increasing the expression of the protein shown in SEQ ID NO.2 or the gene encoding the protein in the plant to improve the cold resistance of the plant, the application specifically comprising: introducing a substance that increases the expression of the protein shown in SEQ ID NO.2 or the gene encoding the protein into the plant;

[0013] Inhibiting or reducing the expression of the protein shown in SEQ ID NO.2 in Vitis amurensis to weaken the cold resistance of Vitis amurensis;

[0014] Knock out, inhibit or silence the gene encoding the protein shown in SEQ ID NO.2 to weaken the cold resistance of Vitis amurensis;

[0015] In the above-mentioned application, preferably, the knockout, inhibition or silencing of the expression of the gene encoding the protein shown in SEQ ID NO.2 is achieved by VIGS interference or CRISPR / Cas9 knockout system.

[0016] Application of the protein shown in SEQ ID NO.2 or a gene encoding the protein in preparing a cold-resistant transgenic plant, the application specifically comprising: introducing a substance that increases the expression amount of the protein shown in SEQ ID NO.2 or the expression amount of the gene encoding the protein shown in SEQ ID NO.2 into the plant;

[0017] In the above application, preferably, the substance is a nucleic acid molecule encoding the protein shown in SEQ ID NO.2, or its expression frame, recombinant vector, or recombinant microorganism;

[0018] In the above-mentioned application, preferably, when it is necessary to increase the expression level of the protein shown in SEQ ID NO.2 in the plant or to increase the expression level of the gene encoding the protein shown in SEQ ID NO.2 in the plant, the expression vector carrying the gene encoding the protein shown in SEQ ID NO.2 of the present invention is introduced into the plant cell by using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation and other conventional biotechnology methods (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition)).

[0019] The nucleic acid molecule encoding the protein shown in SEQ ID NO.2 is shown in SEQ ID NO.1.

[0020] In the above application, preferably, the plant is Vitis amurensis or Arabidopsis thaliana.

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] The discovery and identification of the VaWRKY65 gene provides new genetic resources for the design and breeding of plant stress resistance molecules, and provides new genetic resources for the implementation of green agriculture and water-saving agriculture. The development and utilization of this genetic resource is conducive to reducing agricultural production costs and achieving environmental friendliness. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is a technical flow chart of the present invention.

[0024] Figure 2 It is a schematic diagram of the expression pattern of VaWRKY65 in the present invention in response to low temperature stress treatment.

[0025] Figure 3 It is a schematic diagram of the subcellular localization of the VaWRKY65 gene of the present invention.

[0026] Figure 4 It is a schematic diagram of the analysis of the transcriptional activation activity of the VaWRKY65 gene of the present invention.

[0027] Wherein: A is a schematic diagram of the construction of the VaWRKY65 gene deletion fragment of the present invention; B is the detection of the transcriptional activation activity of the VaWRKY65 gene of the present invention.

[0028] Figure 5 This is a schematic diagram of the measurement of the low temperature treatment phenotype and physiological indexes of Arabidopsis thaliana transgenic with VaWRKY65 gene of the present invention;

[0029] Among them: A is the phenotype of transgenic Arabidopsis (#1, #3) and wild-type Arabidopsis after low temperature treatment; B is the relative expression of VaWRKY65; C is the survival rate of Arabidopsis after treatment; D is the relative conductivity of Arabidopsis after treatment; E is the MDA content of Arabidopsis after low temperature treatment; F is the BAM activity of Arabidopsis after low temperature treatment; G is the starch content of Arabidopsis after treatment; H is the soluble sugar content of Arabidopsis after treatment.

[0030] Figure 6 This is a schematic diagram of the measurement of the phenotype and physiological indexes of the root system of the transgenic grape overexpressing VaWRKY65 under low temperature treatment;

[0031] Among them: A is the relative expression of VaWRKY65 in the overexpression root system; B is the relative expression of VaBAM3 in the overexpression root system; C is the relative conductivity before and after the overexpression root system treatment; D is the MDA content of the overexpression root system before and after low temperature treatment; E is the DAB staining image after the overexpression root system treatment; F is the NBT staining image after the overexpression root system treatment; G is the BAM activity before and after the overexpression root system treatment; H is the starch content before and after the overexpression root system treatment; I is the soluble sugar content before and after the overexpression root system treatment.

[0032] Figure 7 This is a schematic diagram of the measurement of the root phenotype and physiological indexes of the VaWRKY65 knockout transgenic grapes subjected to low temperature treatment;

[0033] Among them: A is the sequence of VaWRKY65 in the knockout root system; B is the relative expression of VaBAM3 in the knockout root system; C is the relative conductivity before and after the knockout root system treatment; D is the MDA content of the knockout root system before and after low temperature treatment; Figure 7 E in the middle is the DAB staining image after root knockout treatment; F is the NBT staining image after root knockout treatment; G is the BAM activity before and after root knockout treatment; H is the starch content before and after root knockout treatment; I is the soluble sugar content before and after root knockout treatment.

[0034] Figure 8 This is a schematic diagram of the identification of VIGS silencing materials and the relative expression quantitative analysis of the present invention;

[0035] Among them: A is the identification of VaWRKY65 silencing materials (VaWRKY65-TRV2); B randomly selected 9 positive materials to identify the relative expression level of VaWRKY65.

[0036] Fig. 9 This is a schematic diagram of cold resistance analysis of Vitis amurensis plants with silenced VaWRKY65 gene (abbreviated as TRV-VaWRKY65);

[0037] Among them: A is the phenotype of empty TRV and intervention plant TRV-VaWRKY65 before and after low temperature treatment; B is the relative conductivity of intervention Vitis avium before and after low temperature treatment; C is the MDA content of intervention Vitis avium before and after low temperature treatment; D is the BAM activity of intervention Vitis avium before and after low temperature treatment; E is the starch content of intervention Vitis avium before and after low temperature treatment; F is the soluble sugar content of intervention Vitis avium before and after low temperature treatment; G is the DAB staining image of intervention Vitis avium before and after low temperature treatment; H is the NBT staining image of intervention Vitis avium before and after low temperature treatment. DETAILED DESCRIPTION

[0038] The present invention is described in detail below in conjunction with specific embodiments. Based on the following description and embodiments, those skilled in the art can determine the essential features of the present invention, and can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention to make it suitable for various uses and conditions.

[0039] Embodiment 1:

[0040] Cloning of the full-length cDNA of VaWRKY65 gene from Vitis amurensis and construction of the overexpression vector pBI121

[0041] The cDNA of V. amurensis was used as a template and a high-fidelity enzyme was used for amplification. The primers used were the overexpression primers of pSAK277-WRKY65: F: 5'-GACACTAGTGGATCCAAAGAATTCATGGACGGCAGATTCAACAGTAA-3' and R: 5'-TCCCTCGAGAAGCTTTTTGAATTCGCTTGTGGTCCCACACATGGG-3'.

[0042] The amplified product was purified and recovered using the AxyPrep-96 DNA gel recovery kit (Axygene, USA). The purified product was connected to the linearized overexpression vector pSAK277 using DNA seamless cloning technology, and then the ligation product was transformed into DH5α competent cells, plated, shaken, and then positive identification was performed. After obtaining the positive clone, the positive clone was sent to Sangon Biotech for sequencing. According to the sequencing results, the full-length cDNA sequence of the VaWRKY65 gene was obtained. The protein encoded by the VaWRKY 65 gene is shown in SEQ ID NO.2, and its corresponding polynucleotide is shown in SEQ ID NO.1.

[0043] The E. coli with correct sequencing results were used to extract the plasmid using the AxyPrep plasmid DNA mini-extraction reagent (Axygen, USA) kit, and the plasmid was named pSAK277-VaWRKY65. The constructed pSAK277-VaWRKY65 recombinant vector with correct sequencing was transformed into Agrobacterium competent cells (GV3101) for use.

[0044] Embodiment 2:

[0045] Expression analysis of VaWRKY65 gene under different stress conditions

[0046] One-month-old wild-type Vitis amurensis tissue culture seedlings with the same growth potential were treated with low temperature (4°C) and the sampling time points were 0h, 2h, 4h, 8h, 24h, and 48h. The sampling site was the leaves, and cDNA was extracted.

[0047] The expression pattern of VaWRKY65 gene was analyzed by real-time fluorescence quantitative PCR (qRT-PCR). AceQ qPCR SYBR Green Master Mix (Novagen, Germany) was used for real-time fluorescence quantitative PCR. The method was referred to the instruction manual. The prepared reaction system was reacted by QuantStudio 7Flex system (Applied Biosystems, USA) fluorescence quantitative analyzer. The relative expression level of the gene was measured by 2 -ΔΔCTThe method was used for calculation, in which grape Actin was selected as the internal reference gene (forward primer: 5'-CTTGCATCCCTCAGCACCTT-3'; reverse primer: 5'-TCCTGTGGACAATGGATGGA-3') and VaWRKY65 real-time quantitative primers (forward primer: 5'-TCGCTGATCACAA CCGAAG-3'; reverse primer: 5'-ATCGGCGAACAGCGATTCA-3'). The results of this experiment showed that the expression of VaWRKY 65 gene was continuously induced by low temperature, with the highest expression at 48h, which increased by about 50 times compared with before treatment ( Figure 2 ).

[0048] Embodiment 3:

[0049] Genetic transformation and positive identification of Arabidopsis thaliana

[0050] 1) Use an inoculation loop to take a small amount of Agrobacterium liquid and streak it on LB+Spec (50 mg / L) medium, culture it at 28°C for about 48 hours, obtain a single clone and culture it in 5 mL LB+Spec (50 mg / L) liquid medium, 220 r / min, 28°C, overnight;

[0051] 2) Take 5 mL of bacterial solution and add it to 50 ml of LB+Spec (50 mg / L) liquid culture medium, at 28°C, 220-250 r / min, until the OD600 value of the bacterial solution is about 2;

[0052] 3) Transfer the bacterial solution into a 50 mL centrifuge tube, centrifuge at 4000 r / min for 5 min, discard the supernatant, resuspend the bacteria in 5% sucrose solution to make the OD600 of the bacterial solution about 0.8, add 0.02-0.03% of the active agent Silwet-77 and mix well;

[0053] 4) Soaking the Arabidopsis flower buds in the infection solution for 30 seconds, culturing the infected Arabidopsis in the dark at room temperature for 24 hours, placing the infected Arabidopsis in a growth chamber for growth, and collecting transgenic Arabidopsis seeds;

[0054] 5) Place the collected T0 generation seeds in a 1.5mL centrifuge tube, add 1mL disinfectant (20% NaClO + 0.1% Triton100-X), shake and mix for 5 minutes, wash with sterile water 4-5 times, and evenly spread the seeds on MS solid culture medium containing 40mg / L hygromycin, and seal the film after drying. Wrap the culture dish with tin foil, place it in the dark at 4℃ for 3 days, and then place it in a growth room for about 10 days. Transplant the positive seedlings with green cotyledons and long roots into the soil until the plants grow up.

[0055] When the T0 generation plants grow up and have 2-3 leaves, take a small amount of leaves for DNA extraction. The DNA extraction steps are as follows:

[0056] 1) Take a small amount of Arabidopsis leaves and put them into a 1.5 mL centrifuge tube, grind them into powder with liquid nitrogen, and add 600 μL of CATB extract;

[0057] 2) After thorough mixing, place in a 65°C water bath for 90 minutes, inverting and mixing every 30 minutes;

[0058] 3) After the water bath is completed, add 700 μL of 24:1 (chloroform: isoamyl alcohol) mixed extract, mix vigorously by inversion, centrifuge at 12000 r / min for 15 min at room temperature, and transfer the supernatant (about 500 μL) to a new 1.5 mL centrifuge tube;

[0059] 4) Add an equal volume of pre-cooled isopropanol to the supernatant, mix thoroughly by inverting, and place in a -20°C refrigerator for precipitation (precipitation time can be extended);

[0060] 5) After precipitation, take out the pellet and centrifuge at 12000r / min for 10min. Pour off the supernatant, add 1mL of pre-cooled 75% ethanol, wash 2-3 times, discard the alcohol, and air-dry in a fume hood;

[0061] 6) Add 20-30 μL ddH2O to each tube to dissolve the DNA and store the dissolved DNA in a -20℃ refrigerator.

[0062] For concentration detection, 1 μL of each sample was taken and measured on a NanoDrop2000 ultra-micro spectrophotometer (Thermo, USA). When the OD260 / OD280 ratio was within the range of 1.8-2.0, the DNA purity was high. It was also detected by gel electrophoresis.

[0063] Using the identification primers, multiple positive plants were obtained by PCR identification. The identification primer sequences were 35S-F: 5'-TCCTCGGATTCCATTGCCCAGC-3 and gene-R: 5'-TCCCTCGAGAAGCTTTTTGAATTCGCTTGTGGTCCCACACATGGG-3'. Real-time fluorescence quantitative analysis of the relative expression of VaWRKY65 in positive Arabidopsis plants showed that the expression of VaWRKY65 was significantly increased compared with WT ( Figure 5 (B), based on the positive seedling identification results, T3 generation seeds of #1 and #3 overexpressing plants were selected for subsequent analysis.

[0064] Embodiment 4:

[0065] Analysis of cold resistance of transgenic Arabidopsis

[0066] 14-day-old potted transgenic Arabidopsis and wild-type Arabidopsis (WT) were used for cold resistance identification. After being treated at -6℃ for 1 hour, most leaves of wild-type Arabidopsis turned yellow and wilted, while only some leaves of transgenic Arabidopsis showed waterlogging and wilting ( Figure 5 After recovery, the survival rate of transgenic Arabidopsis plants was calculated. The survival rate of #1 and #4 plants was 72.2% and 88.9%, respectively, while the survival rate of wild-type plants was only 40%. Figure 5 C), the relative conductivity of wild-type Arabidopsis after low temperature treatment is higher than that of overexpressed Arabidopsis ( Figure 5 D), indicating that the cell membrane of wild-type Arabidopsis was severely damaged. In addition, compared with WT Arabidopsis, transgenic Arabidopsis accumulated lower MDA content ( Figure 5 Middle E). Compared with wild-type Arabidopsis, BAM activity is higher in overexpressed Arabidopsis ( Figure 5 F), starch content decreased ( Figure 5 G), the soluble content increased significantly ( Figure 5 In conclusion, phenotypic observations and physiological data showed that overexpression of the VaWRKY65 gene enabled transgenic Arabidopsis to have higher cold tolerance and frost resistance.

[0067] Embodiment 5:

[0068] Genetic transformation of grape hairy roots

[0069] Based on previous studies (Meng et al., 2019), a transgenic system for grape hairy roots induced by Agrobacterium rhizogenes was developed. Specifically, the 35S promoter-driven overexpression vector pSAK277-VaWRKY65 and the crispr-cas9 vector pKSE401-VaWRKY65 were transformed into MSU440 Agrobacterium rhizogenes, and single positive clones were selected on a medium containing antibiotics after 3 days of culture. Single clones were picked out and cultured overnight until OD = 0.8, and then acetosyringone (100 μM) was added for activation at 28 ° C for 2 hours for use.

[0070] The stems of six-week-old rose fragrant tissue culture seedlings were cut into fragments containing two buds and immersed in the suspension for 8 minutes. The stem segments were transferred to 1 / 2MS culture medium and cultured together at 25°C in the dark for two days. The stem segments were then washed with sterile water (400mg / L cefotaxime sodium (cef) + 400mg / L carbenicillin disodium salt (carb)) for 5 minutes and washed 3 times in total. The explants were transferred to new 1 / 2MS culture medium (200mg / L cef + 200mg / L carb + 10mg / L kanamycin (kan)) and cultured at 26°C for one month. Subsequent experiments were performed after the root system grew well.

[0071] The pKSE401-VaWRKY65 vector was constructed by logging on to the website http: / / www.genome.arizona.edu / crisp r / CRISPRsearch.html, screening the target site, the target site sequence is: GTTCAAAAGGCTGCCCAGCT, designing primers, the primer structure is as follows:

[0072] VaWRKY65-DT1-BsF:ATATATGGTCTCGATTGTTCAAAAGGCTGCCCAGCTGTT

[0073] VaWRKY65-DT1-F0:TGTTCAAAAGGCTGCCCAGCTGTTTTAGAGCTAGAAATAGC

[0074] VaWRKY65-DT2-R0:AACCGCCTAGGTCAGTGAACTTTCAATCTCTTAGTCGACTCTACVaWRKY65-DT2-BsR:ATTATTGGTCTCGAAACCGCCTAGGTCAGTGAACTTTCAA

[0075] Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100 times as a template, the PCR product was purified and recovered, and the following restriction digestion-ligation system was established to obtain the pKSE401-VaWRKY65 vector:

[0076]

[0077]

[0078] Take 5ul of transformed E. coli competent cells, grow a single clone and sequence it.

[0079] Using the identification primers, multiple overexpression positive root systems were obtained by PCR identification, and the identification primer sequences were 35S-F and gene-R (Example 3). Real-time fluorescence quantitative analysis of the relative expression levels of VaWRKY65 and the downstream gene VaBAM3 in the positive root system (VaWRKY65 fluorescence quantitative primers are shown in Example 2, and the downstream gene VaBAM3 fluorescence quantitative primers are B3-qF: 5'-GGCAAGTAAAGATGGCGACTAAGAC-3' and B3-qR: 5'-CCAATGTAAAGGTCTGTC CCGC-3'). The results showed that the expression levels of VaWRKY65 and the downstream gene VaBAM3 were significantly increased compared with the empty control (i.e., the root system only transferred with the pSAK277 vector) ( Figure 6 Middle A, Figure 6Middle B), based on the positive seedling identification results, all overexpressing root lines were used for subsequent analysis.

[0080] Using the identification primers, multiple knockout root lines were obtained after PCR amplification and sequencing on the Hi-TOM platform ( Figure 7 A), the identification primer sequences are 35S-F: 5'-GGAGTGAGTACGGTGTGCCATCCGATTCATGGGCTT GGAG-3' and gene-R: 5'-GAGTTGGATGCTGGATGGTCTTCGGTTGTGATCAGCG-3'. At the same time, the relative expression level of the downstream gene VaBAM3 in the knockout root system was analyzed by real-time fluorescence quantitative analysis. Compared with the empty group (i.e., the root system with only the pKSE401 vector), the expression level of the gene VaBAM3 in the knockout root system was significantly reduced ( Figure 7 Middle B), based on the knockout site sequencing results, all knockout root lines were used for subsequent analysis.

[0081] Example 6: Identification of cold resistance of knockout grape roots

[0082] The rose fragrance VaWRKY65 gene overexpression root system and knockout root system prepared in Example 5 were subjected to low temperature treatment (-5°C) for 4 hours, and various tests were performed. The test results are as follows, and the following results are all average values:

[0083] After being treated at -5℃ for 4h, the relative conductivity of the overexpression root system was also significantly lower than that of the empty load control ( Figure 6 In C), the overexpression root system was 28.5%, while the empty root system was 53.7%. At the same time, the overexpression root system accumulated less MDA ( Figure 6 D), which is 55% of the empty root system. At the same time, DAB staining and NBT staining showed that the H2O2 and O2 ·- Higher content ( Figure 6 Middle E, Figure 6 In addition, after low temperature treatment, the BAM activity and soluble sugar content of the overexpression roots were significantly higher than those of the empty load, while the starch content was significantly lower than that of the empty load ( Figure 6 Middle G, Figure 6 Medium H Figure 6 Middle I).

[0084] The knockout roots showed the opposite phenotype. After being treated at -5℃ for 4h, the relative conductivity of the knockout roots was also significantly higher than that of the wild type ( Figure 7 C), where the knockout root system was 45.4% and the empty root system was 32.9%. At the same time, the knockout accumulated more MDA content ( Figure 7D), where the knockout root system was 4.0nmol / mg prot and the empty root system was 3.2nmol / mg prot. At the same time, DAB staining and NBT staining showed that the H2O2 and O2 ·- Higher content ( Figure 7 Middle E, Figure 7 In addition, after low temperature treatment, the BAM activity and soluble sugar content of the overexpression roots were significantly lower than those of the empty load, while the starch content was significantly higher than that of the empty load ( Figure 7 Middle G, Figure 7 Medium H Figure 7 Middle I).

[0085] Therefore, these results indicate that the VaWRKY65 gene is associated with the ability to scavenge reactive oxygen species and the accumulation of soluble sugars, which may be an important reason for its enhanced low temperature resistance. Using the above method, overexpression of the gene in plants can significantly improve the cold resistance of plants.

[0086] Example 7: VIGS Interference in Vitis amurensis and Identification of Positive Seedlings

[0087] VIGS material identification and low temperature resistance analysis

[0088] TRV2 homologous recombination primers were designed with the non-conserved fragment of the VaWRKY65 gene sequence to construct the TRV2 vector (the construction and transformation process was the same as pSAK277-VaWRKY65 above) to interfere with the normal expression of the VaWRKY65 gene. The primers were TRV2-VaWRKY65-F: 5'-TTCTCTAGAAGGCCTCCATGGGGATCCGCAATTTTCTCAAGCCA AGC-3' and TRV2-VaWRKY65-R: 5'-GTTTAATGTCTTCGGGACATGCCCGGGGCTTGTGG TCCCACACATGGG-3'.

[0089] The gene was silenced by VIGS-mediated method. The transformed plants were detected by two pairs of primers, TRV1-F: 5'-ATTGAGGCGAAGTACGATGG-3', TRV1-R: 5'-CCATCCACAATTATTTTCCG C-3' and TRV2-F: 5'-ATTCACTGGGAGATGATACGCT-3', TRV2-VaWRKY65-R: 5'-GTTTA ATGTCTTCGGGACATGCCCGGGGCTTGTGGTCCCACACATGGG-3'. Only when the transformed plants can amplify bands with two pairs of primers at the same time, they are identified as positive plants. The plants co-transformed with TRV2-VaWRKY65 and TRV1 empty plasmid were the experimental group (TRV-VaWRKY65), and the plants co-transformed with TRV2 empty plasmid and TRV1 empty plasmid were the control group (TRV). After transformation, positive plants were identified. Figure 8 A), 9 positive seedlings were selected and their VaWRKY65 was quantitatively analyzed in real time ( Figure 8 (B) The results showed that the expression level of VaWRKY65 in the positive plants was inhibited by 20%-70% compared with the empty vector, and the general expression level was low, indicating that VIGS has a high silencing efficiency.

[0090] Before low temperature treatment, there was no obvious phenotype difference between VaWRKY65 silenced plants and control plants. However, after low temperature treatment, the leaf wilting degree of silenced plants was much higher than that of the control group ( Fig. 9 Compared with the control group, before low temperature treatment, the conductivity and MDA content of the silent plants were basically the same as those of the control plants, but after low temperature treatment, the conductivity and MDA content of the silent plants increased significantly ( Fig. 9 In addition, the BAM activity and soluble sugar content of the silenced plants after low temperature treatment were significantly lower than those in the empty load, while the starch content was significantly higher than that in the empty load ( Fig. 9 Middle D, Fig. 9 Medium E Fig. 9 In addition, the DAB staining and NBT staining of the leaves of the VaWRKY65 interference plants after low temperature treatment were darker ( Fig. 9 Middle E, Fig. 9 (F). These results indicate that interfering with the VaWRKY65 gene destroyed the active oxygen scavenging system in the plant, inhibiting the removal of active oxygen in Vitis amurensis under low temperature treatment, making the plant more vulnerable to low temperature stress. In summary, VaWRKY65 is a positive regulatory factor in plant resistance to low temperature stress.

[0091] Embodiment 8:

[0092] Subcellular localization and transcriptional activation analysis of VaWRKY65 gene

[0093] The ORF region of VaWRKY65 (excluding the stop codon) was amplified with primer sequences of p101YFP-WRKY65-F: 5'-GGATCTACTAGTGAATTCATGGACGGCAGATTCAA-3' and p101YFP-WRKY65-R: 5'-GGTACCGTCGACGGATCCGCTTGTGGTCCCACACATGG-3'. The target gene was constructed into the 101LYFP vector, and the YFP protein was located at the 3' end of the gene. The expression was driven by the CaMV35S promoter. 35S:VaWRKY65-YFP+mCherry and the control 35S:YFP+mCherry were transiently transformed into the leaf epidermal cells of Arabidopsis thaliana. Laser confocal fluorescence observation showed that the fluorescence of the control filled the entire epidermal cell, including the cytoplasm and the nucleus, while the fluorescence of the transformed 35S:VaWRKY65-YFP was only concentrated in the nucleus. This indicates that VaWRKY65 is a nuclear localized protein ( Figure 3 ).

[0094] The results of subcellular localization of VaWRKY65 gene showed that VaWRKY65 is a transcription factor localized in the nucleus. In order to study and analyze the transcriptional activation activity of VaWRKY65, the gene was divided into full-length; WRKY65-F1 (1-225bp / 1-75aa), amplification primers were 5'-ATGGCCATGGAGGCCGAATTCATGGACGGCAGATTCAAC-3' and 5'-CTAGTTATGCGGCCGCTGCAGGGAGCACAGTCCCCCTTGA-3'); WRKY65-F2 (226bp-408bp / 76-136aa) - bHLH interaction region, amplification primers were 5'-ATGGCCATGGAGGCCGAATTCACCATCCGATTCATGGG CT-3' and 5'-CTAGTTATGCGGCCGCTGCAGCCATGGATGGTTGTGTTCGCA-3') and WRKY65-F3 (409-834bp / 137-278aa), the amplification primers were 5'-ATGGCCATGGAGGCCGAATTCCCGGCTTC TAGAAACCACCA-3' and 5'-CTAGTTATGCGGCCGCTGCAGTCAGCTTGTGGTCCCACACA-3'). Then, the VaWRKY65 gene coding region sequence fragments were connected to the yeast GAL4 fusion expression vector pGBK T7 to construct the recombinant vector, and then transformed into yeast AH109 competent cells ( Figure 4A), the transcriptional activation activity of VaWRKY65 was tested on the corresponding defective medium. Positive and negative controls were set up in the experiment. The results showed that all transformants could grow on SD / -Trp deficiency medium, while only full-length, VaWRKY65-FL and VaWRK Y65-F3 could grow normally on deficiency medium SD-Trp / Ade / His and SD-Trp / Ade / His+X-α-Gal ( Figure 4 (B) This indicates that the C-terminus of VaWRKY65 can activate the LacZ reporter gene, which then causes the degradation of β-galactosidase, degrading X-α-Gal to show blue.

Claims

1. Application of the protein shown in SEQ ID NO.2 or the gene encoding the protein in regulating plant cold resistance.

2. The use according to claim 1, characterized in that: The cold resistance of plants is improved by increasing the expression level of the protein shown in SEQ ID NO. 2 or the gene encoding the protein in the plants.

3. The use according to claim 1, characterized in that: The cold resistance of Vitis amurensis is weakened by inhibiting or reducing the expression of the protein shown by SEQ ID NO. 2 in Vitis amurensis.

4. The use according to claim 1, characterized in that: Knock out, inhibit or silence the gene encoding the protein shown in SEQ ID NO.2 to weaken the cold resistance of Vitis amurensis.

5. The use according to claim 4, characterized in that: Knocking out, inhibiting or silencing the expression of the gene encoding the protein shown in SEQ ID NO.2 adopts VIGS interference or CRISPR / Cas9 knockout system.

6. Use of the protein shown in SEQ ID NO.2 or the gene encoding the protein in preparing cold-resistant transgenic plants.

7. The use according to claim 6, characterized in that: The application is specifically: introducing a substance that increases the expression level of the protein shown in SEQ ID NO.2 or the expression level of the gene encoding the protein shown in SEQ ID NO.2 into a plant.

8. The use according to claim 7, characterized in that: The substance is a nucleic acid molecule encoding the protein shown in SEQ ID NO.2, or its expression frame, recombinant vector, or recombinant microorganism.

9. The use according to claim 1 or claim 6, characterized in that: The gene encoding the protein shown in SEQ ID NO.2 is shown in SEQ ID NO.

1.

10. The use according to claim 1 or claim 6, characterized in that: The plant is Vitis amurensis or Arabidopsis thaliana.

Images