Method for creating watermelon male sterility germplasm through gene editing ClMS1L1

Abstract

The invention discloses a method for creating watermelon male sterility germplasm through gene editing ClMS1L1, and belongs to the technical field of plant gene engineering. According to the method for creating the watermelon male sterility germplasm through gene editing of the ClMS1L1, gene editing is conducted on the watermelon ClMSL1 through a CRISPR / Cas9 gene editing technology, the gene function is deleted, and therefore the phenotype of recessive nuclear male sterility is generated. Compared with a normal material, the watermelon male sterile line created by the method disclosed by the invention has the advantages that the fertility of male flowers is changed, and other tissues such as roots, stems, leaves, tendrils, female flowers, fruits, seeds, growth vigor and the like have no visible phenotypic change. If the created male sterile new germplasm is used for hybrid seed production, the labor cost is greatly reduced, the seed production efficiency is improved, and the important production and application potential is achieved.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and more specifically to a method for creating watermelon male sterile germplasm by gene editing ClMS1L1. Background Art

[0002] Watermelon (Citrullus lanatus) is a crop of the genus Citrullus in the Cucurbitaceae family. Its planting area accounts for 7% of the world's vegetable crop planting area, and the global annual output exceeds 100 million tons. According to statistics from the Food and Agriculture Organization of the United Nations (FAO), China's watermelon production in 2019 was 60.8612 million tons, accounting for 60.61% of the global watermelon production. China is the world's largest watermelon producer and consumer.

[0003] In production, watermelon has obvious hybrid advantages. However, the traditional seed production process of watermelon hybridization is mainly based on artificial emasculation and pollination, which leads to high seed production costs and difficulty in ensuring seed purity. At present, male sterile lines have been widely used in hybrid seed production of crops such as rice and rapeseed. Therefore, the development of new male sterile lines in other crops has important application value.

[0004] Male sterility refers to the physiological phenomenon that flowering plants cannot produce dehiscent anthers, functional pollen or viable male gametes during development. Male sterile lines in plants are not only an important tool for studying the utilization of crop heterosis, but also an ideal material for studying the function of plant flower development. At present, there are 7 reported watermelon male sterile mutants, including 6 recessive nuclear male sterile mutants and 1 dominant male sterile mutant. The recessive nuclear male sterile mutants are named as smooth hairless male sterile mutant (gms), male sterile dwarf plant (ms-dw), male sterile lines ms-1, ms-2, ms-3, male sterile dual-purpose line Se18, etc. The cloning and functional verification of the male sterile gene ClATM1 in Se18 mutant material have been completed, but no relevant research has been carried out on male sterile genes in other mutants, and the regulatory mechanism of watermelon male sterility has not been fully resolved. The dominant male sterile mutant is named ClMS1. Further studies found that the phenotype of this mutant was caused by a non-synonymous mutation in the ClHSP70 sequence, and the specific cellular and molecular mechanisms have not yet been revealed.

[0005] MS1 (MALE STERILE 1) is a member of the PHD-Finger protein family. Studies in Arabidopsis have shown that MS1 is a key gene for the development of the stamen tapetum and the maturation of microspores. In the ms1 mutant background, the early stages of pollen mother cell meiosis and the release of microspores are normal, but the later stages of pollen wall formation are abnormal, and the deposition of the inner and outer pollen walls is incomplete, resulting in complete degeneration of microspores and subsequent cavitation of the anther chamber, resulting in a male sterile phenotype. The molecular mechanism of MS1 gene regulation of tapetum development is limited to the model plant Arabidopsis, and has not been reported in watermelon. It is of great significance to fully understand the molecular mechanism of regulating male flower development, compare the functional conservation of MS1 in different species, and combine gene editing technology to mutate ClMS1L1 (ClMS1Like1) in watermelon.

[0006] Therefore, providing a method for creating watermelon male sterile germplasm by gene editing ClMS1L1 is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0007] In view of this, the present invention provides a method for creating watermelon male sterile germplasm by gene editing ClMS1L1.

[0008] In order to achieve the above object, the present invention adopts the following technical solution:

[0009] Through homologous sequence comparison, the homologous gene ClMS1L1 of the Arabidopsis MS1 gene in watermelon was found. Based on this gene, the present invention uses CRISPR / Cas9 technology to create watermelon male sterile materials, which are then applied to the production process of watermelon hybrids, which will improve seed production efficiency, hybrid purity, and reduce production costs.

[0010] A method for creating watermelon male sterile germplasm by gene editing ClMSL1, the specific steps are as follows:

[0011] (1) Two targets were designed on the third exon of ClMS1L1 based on the genomic DNA sequence of ClMS1L1 and named Target1 and Target2;

[0012] The ClMS1L1 genomic DNA sequence is shown in SEQ ID NO.1;

[0013] The target Target1 and Target2 sequences are as follows:

[0014] Target1 sequence: 5'-GTTGAGCATGAAATGGAGG-3'; SEQ ID NO.2;

[0015] Target2 sequence: 5'-TATTTATATCGGCGATACA-3'; SEQ ID NO.3

[0016] (2) Construction of CRISPR / Cas9 dual-target knockout vector;

[0017] ① Use restriction endonuclease BsaI-HF to digest the CRISPR / Cas9 vector pBSE402, and recover the digested vector pBSE402;

[0018] ②Using the intermediate vector pCBC-DT1T2 as a template, PCR amplification was performed using primers Target1-F / Target2-R to recover the target fragment;

[0019] ③ Perform homologous recombination between the vector pBSE402 digested in step ① and the target fragment recovered in step ② to transform DH5α competent cells;

[0020] ④ Identify the colonies obtained in step ③ and inoculate the colonies with the correct band size, shake the bacteria, extract the recombinant plasmid for sequencing, and transform the recombinant plasmid with the correct sequencing into Agrobacterium EHA105 competent cells;

[0021] (3) Genetic transformation of watermelon;

[0022] After the stages of immersion, co-cultivation, recovery culture, selection culture, bud elongation culture and rooting culture, gene-edited plants were obtained and phenotypic observations were carried out.

[0023] Further, the sequences of the primers Target1-F / Target2-R are as follows:

[0024] Target1-F:

[0025] 5'-TCGAAGTAGTGATTG GTTGAGCATGAAATGGAGG GTTTTAGAGC TAGAAATAGC-3'; SEQ ID NO.4;

[0026] Target2-R:

[0027] 5'-TTCTAGCTCTAAAAC TGTATCGCCGATATAAATA CAATCTCTTA GTCGA-3'; SEQ ID NO. 5.

[0028] Furthermore, the method for creating watermelon male sterile germplasm by gene editing ClMS1L1 is used in creating male sterile watermelon.

[0029] Furthermore, the watermelon male sterile material created by the method is used in hybrid seed production.

[0030] The material selected for genetic transformation of watermelon in the present invention is the wild variety 'YL'.

[0031] The present invention uses CRISPR / Cas9 technology to create a new watermelon male sterile germplasm. By editing the ClMS1L1 gene, the gene is mutated so that the protein function is lost, resulting in a sterile phenotype with male flowers and no pollen. The application of the male sterile material created by the method of the present invention in production can reduce the production cost of watermelon hybrids and improve seed production efficiency.

[0032] It can be known from the above technical scheme that compared with the prior art, the present invention discloses a method for creating watermelon male sterile germplasm by gene editing ClMS1L1. This method uses CRISPR / Cas9 technology for the first time to perform gene editing on the ClMS1L1 sequence, so that the gene mutates, thereby producing a recessive nuclear male sterile phenotype. Compared with normal materials, the male sterile line created by the method of the present invention has no visible phenotypic changes in other tissues such as roots, stems, leaves, tendrils, female flowers, fruit size, growth potential, etc., except for changes in male flower fertility. If the created new male sterile germplasm is used for hybrid seed production, it will greatly reduce labor costs, improve seed production efficiency, and has important production application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0034] Figure 1 The accompanying drawing is a schematic diagram of the ClMS1L1 gene structure and target location of the present invention;

[0035] The gene structure of ClMS1L1 includes 4 exons and 3 introns. Target1 and Target2 are both designed on the third exon (marked by red arrows); the arrow direction is the target direction;

[0036] Figure 2 The accompanying drawing is a map of the pBSE402 vector of the present invention;

[0037] Figure 3 The accompanying drawings are recombinant plasmid expression elements of the present invention;

[0038] Among them, U6-26p and U6-29p are promoters, U6-26t and U6-29t are terminators, gRNA-Sc is the gRNA skeleton, which is an element in the intermediate vector pCBC-DT1T2; Target1 and Target2 are target sites;

[0039] Figure 4 The accompanying drawings show the comparison results of YL (WT) of the present invention with clms1l1-1 and clms1l1-2 at two target sites;

[0040] Among them, - indicates deletion; the Target sequence and PAM sequence (including PAM complementary sequence) are marked with underscores and bold letters respectively;

[0041] Figure 5 The attached figure shows the pollen viability observation of clms1l1-1 of the present invention;

[0042] Among them, a: wild-type WT male flowers; b: clms1l1-1 male flowers; c: wild-type WT pollen vitality; d: clms1l1-1 pollen vitality. DETAILED DESCRIPTION

[0043] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0044] Example 1

[0045] Editing site design of ClMS1L1 (Cla97C11G207480)

[0046] The target sites for gene editing were designed based on the genomic DNA sequence of ClMS1L1 (SEQ ID NO.1) and the target site online design website CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / news.php, V2). Two sets of editing sites, Target1 (SEQ ID NO.2) and Target2 (SEQ ID NO.3), were designed. The schematic diagram of the ClMS1L1 gene structure is shown in Figure 1 Target 1 and Target 2 are both designed in the third exon. Exons are represented by capital letters, and introns are represented by lowercase letters.

[0047] Watermelon ClMS1L1 genomic DNA sequence (97103-YL sequence):

[0048] CCTCCATTTC ATGCTCAAC CTCAAATCCCCTCTCAACACACAACACAACTCCATGGAATACTCCCACAGCTTGGACGCATTCTTGCTCGAAACCTCTTGTCGATGGTCCCCAAAGCGTGTCGAGATGGCAGTTCGAGTCGTTGTTGAGGCATTGAAGCGAGCAGAGTTTCGATGGGTTTCAAGGCAGGAGGTCCGCGATGCAGCCCG TATTTATATCGGCGATACA

[0049] Target1 sequence: 5'-GTTGAGCATGAAATGGAGG-3'; SEQ ID NO.2;

[0050] Target2 sequence: 5'-TATTTATATCGGCGATACA-3'; SEQ ID NO.3.

[0051] Example 2 CRISPR / Cas9 editing vector construction

[0052] The CRISPR / Cas9 vector pBSE402 (vector map see Figure 2 ) for 2 h, and then the digested vector was recovered. Digestion system (20 μL): 10x CutSmart buffer 2 μL, pBSE402 (1 μg / μl) 2 μL, BsaI-HF 1 μL, ddH2O 15 μL.

[0053] PCR amplification was performed using the intermediate vector pCBC-DT1T2 as a template, Target1-F / Target2-R (containing Target1 and Target2, respectively) as primers, and Vazyme P505 high-fidelity enzyme (Phanta Max Super-Fidelity DNA Polymerase).

[0054] The Target1-F / Target2-R primer sequences are as follows:

[0055] Target1-F:

[0056] 5'-TCGAAGTAGTGATTG GTTGAGCATGAAATGGAGG GTTTTAGAGC TAGAAATAGC-3'; SEQ ID NO.4;

[0057] Target2-R:

[0058] 5'-TTCTAGCTCTAAAAC TGTATCGCCGATATAAATA CAATCTCTTA GTCGA-3'; SEQ ID NO. 5.

[0059] Amplification system (50 μL): 2x PhantaMax Buffer 25 μL, dNTP Mix (10 mM) 1 μL, upstream and downstream primers (10 μM) 2 μL each, PhantaMax Super-Fidelity DNA Polymerase 1 μL, template DNA 2 μL, ddH2O 17 μL. PCR reaction program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, 35 cycles; complete extension at 72°C for 5 min. The target fragment was recovered by 1% agarose gel electrophoresis.

[0060] The pBSE402 vector and the recovered target fragment were ligated with homologous recombination enzymes of Vazyme C112 ClonExpress II One Step Cloning Kit. Ligation reaction system (10 μL): 2 μL of linearized vector, 2 μL of target fragment, 2 μL of 5x CE II Buffer, 1 μL of Exnase II, 3 μL of ddH2O, react at 37°C for 30 min, and transform DH5α competent cells.

[0061] The transformed E. coli was tested by colony PCR using identification primers U626-F and U629-R. The primer sequences are as follows:

[0062] U626-F: 5'-TGTCCCAGGATTAGAATGATTAGGC-3'; SEQ ID NO.6;

[0063] U629-R: 5'-AGCCCTCTTTCTTTCGATCCATCAAC-3'; SEQ ID NO. 7.

[0064] After the band size is confirmed to be correct, inoculate the bacteria, shake the bacteria and extract the recombinant plasmid (see the recombinant plasmid expression element for details). Figure 3 ), after sequencing, sequence alignment was performed, and the recombinant plasmid with correct sequencing was transformed into Agrobacterium EHA105 competent cells.

[0065] Primers U626-F and U629-R were used for PCR detection of Agrobacterium.

[0066] Example 3 Watermelon Genetic Transformation

[0067] Sowing: Take 50 seeds of the laboratory watermelon germplasm material 'YL', soak them in a 55℃ water bath for 30 minutes, and then peel off the seed shells. In the clean bench, disinfect the peeled seed kernels with 75% alcohol for 1 minute, soak them in 3% sodium hypochlorite for 15 minutes, and then wash them with sterile water for 5 times. Spread the seed kernels on the sowing medium (BM, breeding medium; H2O, Agar 6g / L), and place them in the dark at 28℃ for about 40 hours.

[0068] Inoculation: Pick the correct Agrobacterium colony verified by colony PCR into LB liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and shake the bacterial solution until the concentration reaches OD 600 When the pH was 0.6-0.8, the cells were collected by centrifugation at 5000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in MS liquid medium (M519 4.43 g / L, sucrose 30 g / L, 6-BA 1.5 mg / L) to a final concentration of OD 600 =0.4.

[0069] Dip infection: When the radicle of the seed kernel grows to about 1 cm, cut off the two ends of the cotyledon and cut the explant into 8 pieces for dipping. Mix the cut cotyledons evenly in a 20mL syringe containing 10mL of resuspended bacterial solution, and then dip under negative pressure for 15 minutes. Take out the explant and dry it on sterile filter paper, transfer it to co-culture medium (CM, co-culture medium; M5194.43g / L, sucrose 30g / L, G32513g / L, 6-BA 1.5mg / L) padded with filter paper for co-culture, and culture in the dark at 28℃ for 3 days; M519 and G3251 were purchased from Phytotech, and 6-BA was purchased from Yuanye Company.

[0070] Recovery culture: After 3 days of co-cultivation, the cotyledon blocks were transferred to recovery medium (RM; M5194.43 g / L, sucrose 30 g / L, G32513 g / L, 6-BA 1.5 mg / L, 200 mg / L Timentin) and cultured for 7 days at 28°C, with a light intensity of 20,000 lux and a light duration of 16 h / d.

[0071] Selective culture: After the recovery culture is completed, the explants are transferred to selective medium (SM; M5194.43g / L, sucrose 30g / L, Agar 6.4g / L, 6-BA 1.5mg / L, 1.4mg / L Basta and 200mg / LTimentin) for selective culture, and subcultured at 28°C for 3-4 weeks, with subculture every 12 days.

[0072] Shoot elongation culture: The GFP-tagged explants with obvious buds were transferred to seedling elongation medium (SE; M519 4.43 g / L, sucrose 30 g / L, Agar 6.4 g / L, 6-BA 0.5 mg / L and Timentin 200 mg / L) for culture.

[0073] Rooting culture: The selected buds were transferred to MS medium containing 0.5 mg / L IAA and 200 mg / L Timentin for rooting culture and cultured at 28°C until roots formed.

[0074] Transplanting: When the regenerated seedlings take root and grow 4-5 true leaves, take them out of the culture bottle, carefully remove the culture medium at the roots, and transplant them into a flowerpot with a substrate: vermiculite ratio of 1:3. Water thoroughly to keep warm and moisturize, and manage normally after cultivation.

[0075] Example 4 Editing detection of ClMS1L1 transgenic plants

[0076] The GFP fluorescent watermelon regenerated seedlings transformed with the pBSE402 vector were selected, and the genomic DNA was extracted by the CTAB method. Specific steps: Take a small part of the young leaves and quickly grind them into powder in liquid nitrogen, put them in a 1.5ml centrifuge tube; add preheated 800μL CTAB extraction buffer, and water bath at 65℃ for 30min; add an equal volume of chloroform isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol is 24:1), mix well and centrifuge at 8000r / min for 10min; transfer the supernatant to a new 1.5mL centrifuge tube, add 2 / 3 volume of isopropanol, mix gently upside down and place in a -20℃ refrigerator for precipitation for 1h; centrifuge at 10000r / min for 10min; discard the supernatant, rinse the precipitate twice with 75% ethanol by volume, pour it out and dry the remaining liquid, dry it at room temperature, dissolve it with 100μL ddH2O (containing 0.1% RNase), and store it at 4℃ for later use.

[0077] Using the extracted genomic DNA as a template, the primers ClMS1L1-JC-F and ClMS1L1-JC-R were used to perform PCR amplification on the sequences of the two target sites. The positive control was the recombinant plasmid, and the negative control was the non-transgenic plant DNA. The specific primer sequences of ClMS1L1-JC-F and ClMS1L1-JC-R are as follows:

[0078] ClMS1L1-JC-F: 5'-GGAAGGTGAGTTTGAAGGACA-3'; SEQ ID NO.8;

[0079] ClMS1L1-JC-R: 5'-GAGTAAGTGGCTTTTCAAG-3'; SEQ ID NO. 9.

[0080] Amplification system (25 μL) and reaction procedure: 2x T5 SuperMIX 12.5 μL, primers (10 μM) 1 μL each, template DNA 1 μL, ddH2O 9.5 μL. PCR reaction procedure: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 58°C for 10 s, extension at 72°C for 15 s, 35 cycles; complete extension at 72°C for 5 min. 1% agarose gel electrophoresis to detect band size.

[0081] The target editing comparison results of clms1l1 mutants are shown in Figure 4 , where clms1l1-1 lacks 218bp at the Target1 target site, and clms1l1-2 lacks 4bp at the Target2 target site.

[0082] Example 5 Phenotypic observation of ClMS1L1 gene-edited plants

[0083] The phenotypic observation is illustrated using clms1l1-1 as an example.

[0084] The edited plants clms1l1-1 and clms1l1-2 were planted in a solar greenhouse and managed normally. After the male flowers opened, their phenotypes were observed. Compared with the wild type, there was no obvious difference in the plant morphology and female flower development of clms1l1-1. The mutant female flowers could be pollinated normally and produce fertile seeds. During the reproductive growth stage, most of the mutant male flower buds did not open, only a few buds opened, and the anthers were small. In the later stage, the anthers did not crack and no pollen was produced. Further staining with Alexander stain revealed that the mutant male flowers had no pollen ( Figure 5 ).

[0085] The phenotype of the edited plant clms1l1-1 is consistent with that of clms1l1-2 and will not be described again here.

[0086] In summary, the present invention provides a method for creating new watermelon male sterile germplasm through gene editing technology. By editing the male sterility regulatory gene ClMS1L1, a recessive nuclear male complete abortion line can be quickly obtained, which has important application potential in the utilization of watermelon hybrid vigor and population improvement.

[0087] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for creating watermelon male sterile germplasm by gene editing ClMSL1, characterized in that: The specific steps are as follows: (1) Two targets were designed on the third exon of ClMS1L1 based on the genomic DNA sequence of ClMS1L1 and named Target1 and Target2; The ClMS1L1 genomic DNA sequence is shown in SEQ ID NO.1; The target Target1 and Target2 sequences are as follows: Target1 sequence: 5'-GTTGAGCATGAAATGGAGG-3'; SEQ ID NO.2; Target2 sequence: 5'-TATTTATATCGGCGATACA-3'; SEQ ID NO.3 (2) Construction of CRISPR / Cas9 dual-target knockout vector; ① Use restriction endonuclease BsaI-HF to digest the CRISPR / Cas9 vector pBSE402, and recover the digested vector pBSE402; ②Using the intermediate vector pCBC-DT1T2 as a template, PCR amplification was performed using primers Target1-F / Target2-R to recover the target fragment; ③ Perform homologous recombination between the vector pBSE402 digested in step ① and the target fragment recovered in step ② to transform DH5α competent cells; ④ Identify the colonies obtained in step ③ and inoculate the colonies with the correct band size, shake the bacteria, extract the recombinant plasmid for sequencing, and transform the recombinant plasmid with the correct sequencing into Agrobacterium EHA105 competent cells; (3) Genetic transformation of watermelon; After the stages of immersion, co-cultivation, recovery culture, selection culture, bud elongation culture and rooting culture, gene-edited plants were obtained and phenotypic observations were carried out.

2. A method for creating watermelon male sterile germplasm by gene editing ClMS1L1 according to claim 1, characterized in that: The sequences of the primers Target1-F / Target2-R are as follows: Target1-F: 5'-TCGAAGTAGTGATTG GTTGAGCATGAAATGGAGG GTTTTAGAGC TAGAAATAGC-3';SEQ ID NO.4; Target2-R: 5’-TTCTAGCTCTAAAAC TGTATCGCCGATATAAATA CAATCTCTTA GTCGA-3’;SEQ ID NO.5。 3. Application of the method for creating watermelon male sterile germplasm by gene editing ClMS1L1 as described in any one of claims 1-2 in creating male sterile watermelon.

Images