Analysis method for screening fetal trisomy 21 syndrome and application

Abstract

The invention provides an analysis method for screening fetus trisomy 21 syndrome, and belongs to the technical field of inspection and detection.According to the method, methylated HLCS, C21orf25 and RASSF1A genes from placenta are detected at the same time, and the method comprises the following steps that methylation sensitive restriction enzyme cutting is conducted, specifically, after maternal peripheral blood is collected, DNA is extracted, and unmethylated CGCG loci are selectively cut through BstUI; light-driven amplification: carrying out isothermal amplification under the irradiation of an external coaxial reflection LED light source by utilizing a photosensitizer Bi2MoO6 (at) NiS, and initiating a multiple light-driven LAMP reaction by taking placenta-derived methylated HLCS, C21orf25 and RASSF1A genes in maternal peripheral blood as templates respectively, so as to obtain a double-chain structure DNA amplification product; detecting by using photo-thermal test paper: modifying Bi2MoO6 (at) NiS by using three nucleic acid chains to obtain three photo-thermal signal probes; and mixing the amplification product with a photo-thermal signal probe, and carrying out photo-thermal temperature change detection to obtain a photo-thermal temperature change signal positively correlated with the content of the amplification product. According to the analysis method disclosed by the invention, the simultaneous amplification and efficient detection of the HLCS, C21orf25 and RASSF1A genes of the placenta specific genes, namely the highly methylated CGCG site are realized.

Description

Technical Field

[0001] The present invention relates to the screening of fetal trisomy 21 syndrome, and in particular to an analytical method for screening fetal trisomy 21 syndrome, belonging to the technical field of inspection and detection. Background Art

[0002] Trisomy 21, also known as Down syndrome (DS), is a disease caused by an abnormality of chromosome 21 and is one of the most common birth defects in clinical practice. According to its different mechanisms of occurrence, DS can be divided into three types: standard type, translocation type and mosaic type. Among them, the standard type is the most common. The number of chromosomes in the somatic cells of children with this type is 47, one more chromosome 21 than normal people. Children with DS are generally physically deformed, develop slowly, have intellectual disabilities, and are very likely to die prematurely. There is no effective treatment for DS in clinical practice. Once a child is born, it will inevitably bring a heavy psychological and economic burden to the family and society. Therefore, it is particularly important to conduct accurate prenatal screening and prenatal diagnosis during pregnancy, and then determine whether it is necessary to avoid the birth of a trisomic fetus through artificial termination of pregnancy.

[0003] Among the prenatal screening technologies currently used in clinical practice, serological screening has a high false positive rate, many factors that affect risk assessment, and difficult quality control; ultrasound screening has a low detection rate and has high requirements for equipment and doctor diagnostic skills; non-invasive DNA testing is safe and non-invasive with high accuracy. The selective amplification method in non-invasive DNA testing technology is lower in cost and shorter in cycle than the sequencing method, and is suitable for rapid analysis results. The amplification of placenta-specific genes - HLCS, C21orf25 and RASSF1A at highly methylated CGCG sites - can significantly distinguish placental from maternal genes.

[0004] Light-driven amplification, by adding various photothermal nanomaterials or photosensitizers into the amplification system, using light-emitting diodes (LEDs) or lasers as light sources, the photosensitizers are evenly dispersed in the amplification system, and are excited by LEDs to provide energy supply for nucleic acid amplification. Light-driven amplification can significantly improve amplification efficiency and is a promising on-site detection platform. Currently, there are no reports on the simultaneous amplification of multiple chromosome sites using light-driven amplification technology.

[0005] There are significant differences between the external coaxial reflective LED light source and other LED light sources in many aspects, mainly reflected in the structural design, light characteristics, application scenarios and optical efficiency. The external coaxial reflective LED light source is mainly composed of a lateral light source and a beam splitter. The light emitted by the light source first passes through the beam splitter and then is reflected parallel to the object to be measured. Other LED light sources such as ring light sources, strip light sources, and linear light sources have different structural designs, but usually do not include a beam splitter component. For example, the ring light source directly illuminates the top of the object to be measured, while the strip light source provides a variety of illumination effects such as direct, oblique and photometric. Due to the use of a beam splitter design, the light of the external coaxial reflective LED light source can be evenly illuminated on the surface of the object after passing through the beam splitter, reducing the interference caused by shadows and reflections. At the same time, this light source usually has high brightness and uniformity, which can highlight the contour features of the object. Although other LED light sources also have their own light characteristics, such as the ring light source can solve the problem of diagonal illumination shadows, and the strip light source can adjust the illumination angle and installation at will, but in comparison, the external coaxial reflective LED light source has more advantages in light uniformity and reducing shadows. The external coaxial reflection LED light source beam splitter design reduces light loss and thus improves optical efficiency.

[0006] So far, there has been no report on the use of external coaxial reflection LED light source excitation-light-driven multiple LAMP amplification combined with photothermal test paper technology to screen for fetal trisomy 21 syndrome. Summary of the invention

[0007] In view of the above problems, the present invention provides an analytical method and application for screening fetal trisomy 21 syndrome, so as to achieve simultaneous amplification and efficient detection of placenta-specific genes - HLCS, C21orf25 and RASSF1A at highly methylated CGCG sites.

[0008] To achieve the above object, the technical solution of the present invention is:

[0009] A method using photosensitizer Bi 2 MoO 6 @NiS and photothermal test paper realize the method of light-driven LAMP and detection of methylated HLCS, C21orf25 and RASSF1A from placenta. The method includes three steps: methylation-sensitive restriction enzyme cleavage, light-driven amplification and photothermal test paper detection. First, BstUI is used to selectively cleave the unmethylated CGCG site to avoid the amplification of HLCS, C21orf25 and RASSF1A from maternal blood cells; then, an 808nm external coaxial reflection LED light source is used to irradiate the amplification system to excite the photosensitizer Bi in the amplification system. 2 MoO 6@NiS generates photoelectrons and heat to provide energy for LAMP, so that the methylated HLCS, C21orf25 and RASSF1A genes from the placenta are used as templates to initiate amplification reactions, and a large number of double-stranded DNA amplification products are obtained; finally, the amplification products and signal probes are captured in a sandwich form by photothermal test paper, giving a photothermal temperature change signal that is positively correlated with the content of the amplification product, thereby achieving quantitative detection of the target gene. The isothermal amplification system includes the following components: primer set, photosensitizer Bi 2 MoO 6 @NiS, DNA template and other necessary ingredients. The specific steps include the following:

[0010] Methylation-sensitive restriction enzyme cleavage: DNA is extracted from maternal peripheral blood, and BstUI is used to selectively cleave unmethylated CGCG sites, but not methylated CGCG sites, so that the HLCS, C21orf25, and RASSF1A genes derived from maternal blood cells in the sample are cleaved to avoid amplification, while the methylated HLCS, C21orf25, and RASSF1A genes derived from the placenta are retained;

[0011] Light-driven amplification: using the photosensitizer Bi 2 MoO 6 @NiS isothermal amplification was performed under the irradiation of an external coaxial reflective LED light source. The methylated HLCS, C21orf25 and RASSF1A genes from the placenta in maternal peripheral blood were used as templates to trigger multiple light-driven LAMP reactions to obtain double-stranded DNA amplification products.

[0012] Photothermal test strip detection: Bi modified with three nucleic acid chains 2 MoO 6 @NiS obtains three photothermal signal probes; takes the amplified product and mixes it with the photothermal signal probe, performs photothermal temperature change detection, and obtains a photothermal temperature change signal that is positively correlated with the content of the amplified product. The detection area of ​​the photothermal test paper captures the amplified product and the photothermal signal probe in a sandwich form, and gives a photothermal temperature change signal that is positively correlated with the content of the amplified product. The target gene in the sample is further quantified based on the temperature change signal.

[0013] Furthermore, the photosensitizer Bi 2 MoO 6 The preparation method of @NiS comprises the following steps: nickel nitrate and CH 4 N 2 S was dissolved in deionized water at a molar ratio of 1:4-1:5 and stirred for 1 hour. Then it was injected into Bi containing a molar concentration of 1 / 4-1 / 2 of nickel. 2 MoO 6The reaction mixture was heated in a reactor at 160-180°C for 1-2 hours. After the reaction, the product was centrifuged at 10,000 rpm for 10-15 minutes and washed with deionized water. After three centrifugal washes, the product was dried in an oven at 50°C for 24 hours.

[0014] Further, the specific steps of methylation-sensitive restriction enzyme cutting are:

[0015] 4-5 mL of peripheral blood was collected and placed in a sampling tube containing EDTA, and centrifuged at 3000 rpm for 10 minutes. Fetal free DNA (cffDNA) was extracted from 1.5-2.5 mL of plasma samples using a circulating nucleic acid kit. DNA samples not yet analyzed were stored at -80°C.

[0016] Digest placental DNA and maternal genomic DNA with BstUI, selectively cleave unmethylated CGCG sites, but not methylated CGCG sites. The total reaction volume is 30-40 mL, add 1x cleavage buffer, 30-40 U BstUI and 120-160 ng placental or genomic DNA template, and incubate at 50°C for 10 hours.

[0017] Furthermore, in the light-driven amplification step, the external coaxial reflective LED light source is a 808 nm light source, and the isothermal amplification system includes the following components: a primer set, a photosensitizer Bi 2 MoO 6 @NiS and DNA template, the device used for light-driven amplification includes a light source, an amplification system bracket, and a light-proof and heat-insulating shell; in the system of the multiple light-driven LAMP reaction, the concentration of each group of DNA templates is 4%-8% v / v, the primer group includes two external primers F3 and B3, the primer groups of HLCS are HLCS-F3 with the sequence CCGTGTGGCCAGAGGTG, and HLCS-B3 with the sequence AAAGGGCCAGGTCGGGA, the primer groups of C21orf25 are C21orf25-F3 with the sequence TTCTGTGCAACTTTCGCTTG, and C21orf25-B3 with the sequence CGTCTCTCACTCCCTGCACT, and the primer groups of RASSF1A are RASSF1A-F3 with the sequence AGCTGGCACCCGCTGG, and RASSF1A-B3 with the sequence GTGTGGGGTTGCACGCG.

[0018] Furthermore, the concentration of the two external primers F3 and B3 is 2%-6% v / v; the multiple light-driven LAMP reaction system also includes the following components: BSA, MgSO 4 , dNTPs, betaine, isothermal amplification buffer, Bst 3.0 DNA polymerase and ddH 2 O.

[0019] Furthermore, in the light-driven amplification step, the coaxial reflection LED light source is an 808nm light source, and the irradiation parameters of the 808nm outer coaxial reflection LED light source are power 4.5-6W and irradiation time 10-60min.

[0020] Furthermore, the device used in the photothermal test paper detection step includes a light source, photothermal test paper, a test paper holder, a smart phone with a temperature collection accessory, and a light-proof and heat-insulating shell.

[0021] Furthermore, the three nucleic acid chains described in the photothermal test paper detection step are TTTTTTTTTTAAAGGGCCAG, TTTTTTTTTTCGTCTCTCAC, and TTTTTTTTTTGTGTGGGGTT.

[0022] Furthermore, the photothermal test paper detection comprises the following steps:

[0023] The light-driven amplification products are characterized by the photothermal lateral flow chromatography nucleic acid test paper method. The complementary sequences of the modified parts of the three gene amplification products to be tested are fixed in sequence on the detection area (T area) of the test paper. One end of the modified chain of the amplified fragment is bound to the T probe, and the other end is bound to the signal probe. The sequence complementary to the signal probe is fixed on the quality control area (C area) of the test paper.

[0024] Furthermore, the complementary sequences of the modified parts of the three gene amplification products to be tested are T HLCS Probe: CCGTGTGGCC, T C21orf25 Probe: TTCTGTGCAA, T RASSF1A Probe: AGCTGGCACC; the sequence complementary to the signal probe is C probe: AAAAAAAAAA.

[0025] Application of an analytical method for screening fetal trisomy 21 syndrome, simultaneously quantifying the methylated HLCS, C21orf25 and RASSF1A gene content of placenta origin.

[0026] Furthermore, the methylated HLCS, C21orf25 and RASSF1A genes from the placenta were quantitatively analyzed based on the photothermal temperature change signals, as follows:

[0027] After performing multiple light-driven LAMP reactions and photothermal detection on three samples with unknown target gene concentrations, the photothermal temperature change signals of the three genes are substituted into the equation of the quantitative curve to calculate the corresponding concentrations of the three genes, thereby achieving quantitative analysis of the target genes;

[0028] Among them, the quantitative curves of the genes of the three items are as follows:

[0029] The quantitative curve of HLCS gene is: y = 4.38x + 0.28, R 2 =0.9979;

[0030] The quantitative curve of C21orf25 gene is: y=4.93x+0.38, R 2 =0.9989;

[0031] The quantitative curve of RASSF1A gene is: y=4.79x+0.34, R 2 =0.9977.

[0032] An analytical method for screening fetal trisomy 21 syndrome, comprising using a photosensitizer Bi 2 MoO 6 @NiS and photothermal test paper realize the light-driven LAMP and detection method of methylated HLCS, C21orf25 and RASSF1A from placenta, and use the device to detect multiple genes. The method includes the following steps:

[0033] (1) Primer sequence design: According to the LAMP principle, amplification primer sets were designed for the target gene HLCS, C21orf25 and RASSF1A sequences, respectively. The primer sets included two external primers (F3 and B3).

[0034] (2) Peripheral blood DNA extraction: Collect 4-5 mL of peripheral blood into a sampling tube containing EDTA and centrifuge at 3000 rpm for 10 minutes. Use a circulating nucleic acid kit to extract fetal free DNA (cffDNA) from 1.5-2.5 mL of plasma samples. DNA samples not yet analyzed were stored at -80°C.

[0035] (3) Photosensitizer Bi 2 MoO 6 @NiS preparation: Nickel nitrate and CH 4 N 2 S was dissolved in deionized water at a molar ratio of 1:4-1:5 and stirred for 1 hour. Then it was injected into Bi containing a molar concentration of 1 / 4-1 / 2 of nickel. 2 MoO 6 The reaction mixture was heated in a reactor at 160-180°C for 1-2 hours. After the reaction, the product was centrifuged at 10,000 rpm for 10-15 minutes and washed with deionized water. After three centrifugal washes, the product was dried in an oven at 50°C for 24 hours.

[0036] (4) Methylation-sensitive restriction enzyme cleavage: Digest placental DNA and maternal genomic DNA with BstUI, selectively cleave unmethylated CGCG sites, but not cleave methylated CGCG sites. The total reaction volume is 30-40 mL, add 1x cleavage buffer, 30-40 U BstUI and 120-160 ng placental or genomic DNA template, and incubate at 50°C for 10 h.

[0037] (5) Construction of light-driven multiple LAMP system: The methylated HLCS, C21orf25 and RASSF1A genes derived from the placenta in the DNA obtained in step (4) were used as templates to construct a light-driven LAMP system.

[0038] The amplification system comprises the following components: the primer set described in step (1), the photosensitizer Bi 2 MoO 6 @NiS (i.e., the photosensitizer Bi prepared in step (3) 2 MoO 6 @NiS solution), BSA, MgSO 4 , isothermal amplification buffer (Tris-HCl, (NH 4 ) 2 SO 4 ,KCl,MgSO 4 , Tween-20), dNTPs, betaine, Bst 3.0 DNA polymerase, ddH 2 O and the DNA template extracted in step (2).

[0039] As an optional embodiment, under the premise of maintaining the final volume at 25 μL, the concentrations of the components and the reaction volumes of the amplification system are shown in Table 1 below:

[0040] Table 1 Concentrations of components and reaction volumes of the light-driven multiple LAMP system of the present invention

[0041]

[0042]

[0043] (6) LED light source excitation: Use an 808nm external coaxial reflection LED to illuminate the amplification system to excite the photosensitizer in the amplification system and provide the energy required for multiple LAMP.

[0044] (7) Photothermal test paper construction and detection: Bi was modified with three nucleic acid chains TTTTTTTTTTAAAGGGCCAG, TTTTTTTTTTCGTCTCTCAC, and TTTTTTTTTTGTGTGGGGTT 2 MoO 6@NiS obtained three photothermal signal probes. The detection area of ​​the photothermal test paper captures the amplification product and the photothermal signal probe in a sandwich form, and gives a photothermal temperature change signal that is positively correlated with the content of the amplification product. The temperature signal is read by a smartphone for quantification.

[0045] The principle of the present invention is as follows Figure 1 This method is efficient, convenient and accurate, and is suitable for the screening of fetal trisomy 21.

[0046] The beneficial effects of the analysis method and application for screening fetal trisomy 21 of the present invention are:

[0047] Existing fetal trisomy 21 screening technologies have the following limitations: serological screening has a high false-positive rate and difficult quality control; ultrasound screening has a low detection rate and has high requirements for equipment and physician diagnostic skills; although the selective amplification method in non-invasive DNA testing is low-cost and short-cycle, it lacks simultaneous amplification and efficient detection technology for placenta-specific genes - HLCS, C21orf25 and RASSF1A at highly methylated CGCG sites; light-driven amplification technology has not yet been applied to the simultaneous amplification of multiple chromosomal sites; although the external coaxial reflective LED light source has the advantages of light uniformity and reduced shadows, it has not yet been combined with light-driven amplification and photothermal test paper technology for screening fetal trisomy 21.

[0048] The detection method provided by the present invention uses a photosensitizer Bi 2 MoO 6 The photoactivity of @NiS produces photoelectrons and photothermal effects, can quickly control the temperature and directly contact the amplification system at the molecular level, which is significantly more efficient than traditional water baths and metal baths. At the same time, the photosensitizer is used as a signal probe for photothermal test paper, providing a sensitive and quantifiable signal. The entire method can quickly achieve efficient amplification and detection of multiple target DNAs.

[0049] The detection method provided by the present invention utilizes an external coaxial reflection LED light source excitation-light driven multiple LAMP amplification combined with photothermal test paper technology to screen for fetal trisomy 21 syndrome. The external coaxial reflection LED light source is significantly different from other LED light sources in many aspects, mainly reflected in structural design, light characteristics, application scenarios and optical efficiency. The external coaxial reflection LED light source is mainly composed of a lateral light source and a beam splitter. The light emitted by the light source first passes through the beam splitter and then is reflected in parallel to the object to be tested; the external coaxial reflection LED light source adopts a beam splitter design, so the light can be evenly irradiated on the surface of the object after passing through the beam splitter, reducing the interference caused by shadows and reflections; at the same time, this light source usually has high brightness and uniformity, and can highlight the contour features of the object; the external coaxial reflection LED light source beam splitter design reduces light loss, thereby improving optical efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0051] Figure 1 It is a schematic diagram of the working process of the present invention;

[0052] Figure 2 The photothermal temperature rise of the photothermal material of the present invention;

[0053] Figure 3 It is the light-driven multiplex LAMP primer verification of the present invention;

[0054] Figure 4 The electrophoresis photos and photothermal test paper photos of the light-driven single and multiple LAMP products of the present invention;

[0055] Figure 5 The light-controlled LAMP of the present invention is combined with a lateral flow chromatography test paper for photothermal quantification;

[0056] Figure 6 The electrophoresis diagrams of the products of the present invention and the use of scattered light LED to perform light-controlled LAMP on HLCS respectively;

[0057] Figure 7 The electrophoretic diagram of the products of the LAMP method using a photosensitizer and water bath heating in the present invention. DETAILED DESCRIPTION

[0058] The technical scheme in the embodiment of the present invention is described clearly and completely below in conjunction with the accompanying drawings in the embodiment of the present invention. In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below.

[0059] An analytical method and application for screening fetal trisomy 21 syndrome, that is, a method for realizing a light-driven multiple LAMP system using the photothermal effect of a photosensitizer, that is, an analytical method for simultaneously detecting methylated HLCS, C21orf25 and RASSF1A genes derived from placenta, comprising the following steps:

[0060] (1) Primer sequence design:

[0061] According to the LAMP principle, taking a target gene sequence as an example, an amplification primer set is designed for six different regions of the target gene sequence, and the primer set includes two external primers (F3 and B3).

[0062] (2) Peripheral blood DNA extraction:

[0063] 4-5 mL of peripheral blood was collected and placed in a sampling tube containing EDTA, and centrifuged at 3000 rpm for 10 minutes. Fetal free DNA (cffDNA) was extracted from 1.5-2.5 mL of plasma samples using a circulating nucleic acid kit. DNA samples not yet analyzed were stored at -80°C.

[0064] (3) Photosensitizer Bi 2 MoO 6 @NiS Preparation:

[0065] Nickel nitrate and CH 4 N 2 S was dissolved in deionized water at a molar ratio of 1:4-1:5 and stirred for 1 hour. Then it was injected into Bi containing a molar concentration of 1 / 4-1 / 2 of nickel. 2 MoO 6 The reaction mixture was heated in a reactor at 160-180°C for 1-2 hours. After the reaction, the product was centrifuged at 10,000 rpm for 10-15 minutes and washed with deionized water. After three centrifugal washes, the product was dried in an oven at 50°C for 24 hours.

[0066] (4) Methylation-sensitive restriction enzyme cleavage:

[0067] Digest placental DNA and maternal genomic DNA with BstUI, selectively cleave unmethylated CGCG sites, but not methylated CGCG sites. The total reaction volume is 30-40 mL, add 1x cleavage buffer, 30-40 U BstUI and 120-160 ng placental or genomic DNA template, and incubate at 50°C for 10 hours.

[0068] (5) Construction of light-driven multiple LAMP system:

[0069] The methylated HLCS, C21orf25 and RASSF1A genes from the placenta in the DNA obtained in step (4) were used as templates to construct a light-driven multiple LAMP system. The amplification system includes the following components: a primer set, a photosensitizer Bi 2 MoO 6 @NiS (i.e., the photosensitizer Bi prepared in step (3) 2 MoO 6 @NiS solution), BSA, MgSO 4 , isothermal amplification buffer (Tris-HCl, (NH 4 ) 2 SO 4 ,KCl,MgSO 4 , Tween-20), dNTPs, betaine, Bst 3.0 DNA polymerase, ddH 2 O and DNA template.

[0070] in,

[0071] The gene sequence information of HLCS is as follows: NCBI GenBank: KR710982.1;

[0072] The gene sequence information of C21orf25 is as follows: NCBI GenBank: AB047785.1;

[0073] The gene sequence information of RASSF1A is as follows: NCBI Reference Sequence: NM_001243748.2.

[0074] (6) LED light source excitation:

[0075] The amplification system is illuminated by an 808nm external coaxial reflection LED to excite the photosensitizer in the amplification system and provide the energy required for multiple LAMP.

[0076] (7) Photothermal test paper detection:

[0077] Photothermal test paper construction and detection: Bi was modified with three nucleic acid chains TTTTTTTTTTAAAGGGCCAG, TTTTTTTTTTCGTCTCTCAC, TTTTTTTTTTGTGTGGGGTT 2 MoO 6 @NiS obtained three photothermal signal probes. The detection area of ​​the photothermal test paper captures the amplification product and the photothermal signal probe in a sandwich form, and gives a photothermal temperature change signal that is positively correlated with the content of the amplification product. The temperature signal is read by a smartphone for quantification. The linear range of quantitative detection of the photothermal test paper is: HLCS, C21orf25, RASSF1A are all in the range of 1 to 1×10 5 cpoies / μL, and the detection limit was 1 cpoies / μL.

[0078] The main body of the photothermal test paper is a nitrocellulose membrane, with a glass fiber sample pad and a water absorbent pad at both ends. The complementary sequences of the three amplification products to be tested are fixed in sequence on the detection area (T area) of the photothermal test paper (the complementary sequences of the modified parts of the three gene amplification products to be tested are T HLCS Probe: CCGTGTGGCC, T C21orf25 Probe: TTCTGTGCAA, T RASSF1A The quality control area (C area) of the test paper body is fixed with a sequence complementary to the signal probe (C probe: AAAAAAAAAA).

[0079] At the same time, the three corresponding photothermal signal probes can be mixed with the amplified product as in the above method (i.e., independent of the test paper body), or they can be dripped onto the binding pad and dried, and the binding pad is integrated onto the test paper, and the amplified product is directly loaded for sampling when used. During the detection process, one end of the amplified product binds to the T probe and the other end binds to the photothermal signal probe, thereby giving a photothermal temperature change signal that is positively correlated with the content of the amplified product, and the target gene is quantified accordingly.

[0080] The present invention can realize the efficient on-site amplification of HLCS, C21orf25 and RASSF1A genes, and excite the photosensitizer Bi with an 808nm external coaxial reflection LED. 2 MoO 6 @NiS photothermal effect driven amplification. The following examples use HLCS, C21orf25, and RASSF1A as examples of maternal and fetal differentially methylated genes to fully and in detail describe the entire amplification method.

[0081] Example 1

[0082] An analytical method and application for screening fetal trisomy 21 syndrome, that is, a method for realizing a light-driven multiple LAMP system using the photothermal effect of a photosensitizer, that is, an analytical method for simultaneously detecting methylated HLCS, C21orf25 and RASSF1A genes derived from placenta, comprising the following steps:

[0083] (1) Primer sequence design:

[0084] According to the LAMP principle, an amplification primer set was designed for the target gene HLCS, C21orf25 and RASSF1A sequences. The primer set includes two external primers (F3 and B3). The sequences of the external primers are shown in Table 2:

[0085] Table 2 Primer sequences of light-driven multiple LAMP of the present invention

[0086]

[0087] (2) Peripheral blood DNA extraction:

[0088] 5.0 mL of peripheral blood was collected and placed in a sampling tube containing EDTA, and centrifuged at 3000 rpm for 10 minutes. Fetal free DNA (cffDNA) was extracted from 1.5 mL of plasma sample using a circulating nucleic acid kit.

[0089] (3) Photosensitizer Bi 2 MoO 6 @NiS preparation and characterization:

[0090] Nickel nitrate and CH 4 N 2S was dissolved in deionized water at a molar ratio of 1:4 and stirred for 1 hour. Then it was injected into Bi containing 1 / 4 of the molar concentration of nickel. 2 MoO 6 The reaction mixture was heated at 160°C for 2 h in an autoclave. After the reaction, the product was centrifuged at 10,000 rpm for 15 min and washed with deionized water. After three centrifugal washes, the product was dried in an oven at 50°C for 24 h.

[0091] Irradiate the photosensitizer Bi with 808nm laser 2 MoO 6 @NiS solution (concentration of 0.1 mg / mL) and the same concentration of Bi 2 MoO 6 The photothermal heating curves of the NiS solution (with a concentration of 0.1 mg / mL) and the NiS solution (with a NiS solution containing deionized water and a NiS concentration of 0.5 mg / mL) are shown in Figure 2. Figure 2 As shown, it can be seen that Bi 2 MoO 6 @NiS complex has significantly higher heating efficiency than single substance, which is beneficial to improve its efficiency as a photosensitizer.

[0092] (4) Construction of light-driven multiple LAMP system: The amplification system includes the following components: primer set, photosensitizer Bi 2 MoO 6 @NiS (refers to the photosensitizer Bi prepared in step (3) 2 MoO 6 @NiS solution), BSA, MgSO 4 , isothermal amplification buffer (Tris-HCl, (NH4) 2 SO 4 ,KCl,MgSO 4 , Tween-20), dNTPs, betaine, Bst 3.0 DNA polymerase, ddH 2 O and DNA template.

[0093] The concentrations of the components and the reaction volumes of the amplification system are shown in Table 3 below.

[0094] Table 3 Concentrations of components and reaction volumes of the light-driven multiple LAMP system of the present invention

[0095]

[0096] (5)LED light source excitation:

[0097] The amplification system was irradiated with an 808nm external coaxial reflection LED to excite the photosensitizer in the amplification system to provide the energy required for multiple LAMPs. The excitation power was 4.5W and the excitation time was 20min.

[0098] (6) Electrophoresis analysis of amplification results:

[0099] Take 10 μL of amplified product, add 2 μL of electrophoresis loading buffer, mix and add to the gel electrophoresis loading tank, and characterize the product by 1% agarose gel electrophoresis (voltage: 100 V, time: 50 min). Figure 3 The electrophoresis photograph shows that only when the primers and template of the same gene coexist, the gel electrophoresis image shows diffuse bands. Figure 4 The electrophoresis photograph shows that the coexisting primers and templates do not interfere with the amplification of other target genes, and the test paper photograph shows that the test paper can specifically detect the amplification products of specific target genes in the multiple LAMP system in colorimetric and photothermal modes, respectively.

[0100] (7) Test strip construction and amplification result test strip analysis

[0101] Bi is modified with three nucleic acid chains TTTTTTTTTTAAAGGGCCAG, TTTTTTTTTTCGTCTCTCAC, TTTTTTTTTTGTGTGGGGTT 2 MoO 6 @NiS obtained three photothermal signal probes. The detection area of ​​the photothermal test paper captures the amplification product and the photothermal signal probe in a sandwich form, and gives a photothermal temperature change signal that is positively correlated with the content of the amplification product. The temperature signal is read by a smartphone for quantification. The linear range of quantitative detection of the photothermal test paper is: the linear range of HLCS, C21orf25, and RASSF1A is 1 to 1×10 5 copies / μL, and the detection limit was 1 copies / μL.

[0102] Among them, the complementary sequences of the modified parts of the three gene amplification products to be tested are T HLCS Probe: CCGTGTGGCC, T C21orf25 Probe: TTCTGTGCAA, T RASSF1A Probe: AGCTGGCACC; the sequence complementary to the signal probe is C probe: AAAAAAAAAA.

[0103] A mixture of target gene HLCS gene, C21orf25 gene, and RASSF1A gene with target gene copy numbers of 1, 10, 100, 1000, 10000, and 100000 was taken as a DNA template, and multiple light-driven LAMP amplification was performed according to the above method to obtain a corresponding amplification mixture;

[0104] Take 10 μL of the amplification mixture corresponding to the number of copies of each gene, mix it with 10 μL of each of the three photothermal signal probes and 60 μL of running buffer (4×SSC, 0.25% Tween-20), load it, and capture the amplification product and the photothermal signal probe in the detection area of ​​the photothermal test paper in a sandwich form. After loading for 10 minutes, air-dry the test paper and collect the photothermal temperature change signal of the detection area with a smartphone. Then, with the initial number of copies of the target gene as the horizontal axis and the corresponding photothermal temperature change signal as the vertical axis, draw the quantitative curve of the three genes. The results are as follows: Figure 5 shown.

[0105] Figure 5 It is a quantitative curve drawn for the three target genes based on the photothermal signal of the test paper. The above results verify that the present invention can successfully amplify and quantitatively detect the three target genes HLCS, C21orf25, and RASSF1A. Among them, the quantitative curves of the three genes are as follows:

[0106] The quantitative curve of HLCS gene is: y = 4.38x + 0.28, R 2 =0.9979;

[0107] The quantitative curve of C21orf25 gene is: y=4.93x+0.38, R 2 =0.9989;

[0108] The quantitative curve of RASSF1A gene is: y=4.79x+0.34, R 2 =0.9977.

[0109] When performing quantitative analysis on the three genes, three samples with unknown target gene concentrations are subjected to multiple light-driven LAMP reaction amplification and photothermal detection, and the photothermal temperature change signals of the three genes are substituted into the equation of the quantitative curve for calculation to obtain the corresponding concentrations of the three genes, thereby achieving quantitative analysis of the target genes.

[0110] In addition, the scattered light LED and the external coaxial reflection LED are used as the light control LAMP light source to compare their amplification effects. Figure 6 As shown, only the external coaxial reflection LED can give a bright diffuse band, that is, a high-efficiency amplification, while the scattered light LED does not induce effective amplification.

[0111] Comparative Example 1: Water Bath LAMP

[0112] In this embodiment, the photosensitizer Bi 2 MoO 6 @NiS The method of realizing light-driven multiple LAMP by photothermal effect was compared with the traditional water bath LAMP effect to verify the progressiveness of the method of the present invention in terms of amplification effect.

[0113] The water bath LAMP method includes the following steps:

[0114] (1) Primer sequence design:

[0115] Same as Example 1

[0116] (2) Peripheral blood DNA extraction:

[0117] Same as Example 1

[0118] (3) Construction of isothermal amplification system:

[0119] Construct a water bath LAMP system. The water bath LAMP system includes the following components: primer set, MgSO 4 , isothermal amplification buffer (Tris-HCl, (NH4) 2 SO 4 ,KCl,MgSO 4 , Tween-20), dNTPs, betaine, Bst 3.0 DNA polymerase, ddH2O and DNA template.

[0120] The concentrations of the components and the reaction volumes of the water bath LAMP system are shown in Table 4 below:

[0121] Table 4 Concentrations of components and reaction volumes of water bath LAMP system

[0122]

[0123] (4) Amplification process:

[0124] Add the components of the water bath LAMP system into a 1.5 mL centrifuge tube and place it in a 65 °C water bath for 60 min.

[0125] (5) Amplification product analysis:

[0126] The amplified products were analyzed by agarose gel electrophoresis.

[0127] Gel electrophoresis images such as Figure 7 As shown, the negative group image without template DNA only shows primers and no diffuse bands, while the image of the positive group with template DNA successfully amplified shows diffuse bands. At the same time, the water bath LAMP group of comparative example 1 only shows bright diffuse bands after 60 minutes of amplification, while the light-controlled LAMP group shows clear and bright diffuse bands at 20 minutes, indicating that the amplification efficiency of the light-controlled LAMP group is better than that of the water bath LAMP group.

[0128] Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

Claims

1. An analytical method for screening fetal trisomy 21, characterized in that: The analytical method simultaneously detects methylated HLCS, C21orf25 and RASSF1A genes derived from the placenta, and comprises the following specific steps: Methylation-sensitive restriction enzyme cleavage: DNA was extracted from maternal peripheral blood and BstUI was used to selectively cleave the unmethylated CGCG site; Light-driven amplification: Isothermal amplification was performed using the photosensitizer Bi2MoO6@NiS under the irradiation of an external coaxial reflective LED light source. The methylated HLCS, C21orf25, and RASSF1A genes derived from the placenta in maternal peripheral blood were used as templates to trigger multiple light-driven LAMP reactions to obtain double-stranded DNA amplification products. Photothermal test paper detection: Bi2MoO6@NiS was modified with three nucleic acid chains to obtain three photothermal signal probes. The above-mentioned amplified products were mixed with the photothermal signal probes, and photothermal temperature change detection was performed to obtain a photothermal temperature change signal that was positively correlated with the content of the amplified product.

2. The analytical method for screening fetal trisomy 21 according to claim 1, characterized in that: The preparation method of the photosensitizer Bi2MoO6@NiS includes the following steps: dissolving nickel nitrate and CH4N2S in deionized water, stirring, and then injecting into an aqueous solution of Bi2MoO6 containing nickel, heating in a reactor, centrifuging the product after the reaction is completed, washing it with deionized water, and finally drying it.

3. The analytical method for screening fetal trisomy 21 according to claim 1, characterized in that: The isothermal amplification system in the light-driven amplification step includes the following components: a primer set, a photosensitizer Bi2MoO6@NiS and a DNA template; in the multiple light-driven LAMP reaction system, the concentration of each group of DNA templates is 4%-8% v / v, and the multiple light-driven LAMP reaction system also includes the following components: BSA, MgSO4, dNTPs, betaine, isothermal amplification buffer, Bst 3.0 DNA polymerase and ddH2O.

4. The analytical method for screening fetal trisomy 21 according to claim 3, characterized in that: The primer set includes two external primers F3 and B3. The primer sets of gene HLCS include HLCS-F3 with the sequence CCGTGTGGCCAGAGGTG and HLCS-B3 with the sequence AAAGGGCCAGGTCGGGA. The primer sets of gene C21orf25 include C21orf25-F3 with the sequence TTCTGTGCAACTTTCGCTTG and C21orf25-B3 with the sequence CGTCTCTCACTCCCTGCACT. The primer sets of gene RASSF1A include RASSF1A-F3 with the sequence AGCTGGCACCCGCTGG and RASSF1A-B3 with the sequence GTGTGGGGTTGCACGCG. The concentrations of the two external primers F3 and B3 are 2%-6% v / v.

5. The analytical method for screening fetal trisomy 21 according to claim 1, characterized in that: In the light-driven amplification step, the coaxial reflection LED light source is an 808nm light source, and the irradiation parameters of the 808nm external coaxial reflection LED light source are power 4.5-6W and irradiation time 10-60min.

6. The analytical method for screening fetal trisomy 21 according to claim 1, characterized in that: The three nucleic acid chains described in the photothermal test paper detection step are TTTTTTTTTTAAAGGGCCAG, TTTTTTTTTTCGTCTCTCAC, and TTTTTTTTTTGTGTGGGGTT.

7. The analytical method for screening fetal trisomy 21 according to claim 1, characterized in that: The photothermal test paper detection comprises the following steps: The light-driven amplification products were characterized by the photothermal lateral flow chromatography nucleic acid test paper method. The complementary sequences of the modified parts of the three gene amplification products to be tested were fixed in sequence on the detection area (T area) of the test paper. One end of the modified chain of the amplified fragment was bound to the T probe, and the other end was bound to the signal probe. The sequence complementary to the signal probe was fixed on the quality control area (C area) of the test paper.

8. An analytical method for screening fetal trisomy 21 according to claim 7, characterized in that: The complementary sequences of the modified parts of the three gene amplification products to be tested are T HLCS Probe: CCGTGTGGCC, T C21orf25 Probe: TTCTGTGCAA, T RASSF1A Probe: AGCTGGCACC; the sequence complementary to the signal probe is C probe: AAAAAAAAAA.

9. Use of an analytical method for screening fetal trisomy 21 according to any one of claims 1 to 8, characterized in that: At the same time, the methylated HLCS, C21orf25 and RASSF1A gene contents derived from the placenta were quantitatively detected.

10. The use according to claim 9, characterized in that: The methylated HLCS, C21orf25 and RASSF1A genes from the placenta were quantitatively analyzed based on the photothermal temperature change signals, as follows: After performing multiple light-driven LAMP reactions and photothermal detection on three samples with unknown target gene concentrations, the photothermal temperature change signals of the three genes are substituted into the equation of the quantitative curve to calculate the corresponding concentrations of the three genes, thereby achieving quantitative analysis of the target genes; Among them, the quantitative curves of the genes of the three items are as follows: The quantitative curve of HLCS gene is: y = 4.38x + 0.28, R 2 =0.9979; The quantitative curve of C21orf25 gene is: y=4.93x+0.38, R 2 =0.9989; The quantitative curve of RASSF1A gene is: y=4.79x+0.34, R 2 =0.9977.

Images