Method for producing nucleic acid oligomer

Abstract

The present invention provides an efficient method for preparing a nucleic acid oligomer, in particular, a method for efficiently deprotecting the protecting group of the hydroxyl group of ribose in a nucleic acid oligomer. Specifically, the present invention also provides a method for producing a nucleic acid oligomer represented by formula (4), which comprises contacting a nucleic acid oligomer represented by formula (3) with fluoride ions in an inert gas atmosphere with an oxygen concentration of 15% or less (the definition of each group in formula (3) and formula (4) is the same as that in the specification).

Description

Technical Field

[0001] This patent application claims priority and benefits under the Paris Convention based on Japanese Patent Application No. 2019-187930 (filed on October 11, 2019), and all the contents described in the above application are incorporated into this specification by reference.

[0002] The present invention relates to a method for producing a nucleic acid oligomer containing ribose, and more particularly, to a method for deprotecting a protective group of a hydroxyl group of ribose contained in a nucleic acid oligomer. Background Art

[0003] RNA, which is a nucleic acid oligomer containing ribose, can be used as an RNA probe, antisense RNA, ribozyme, siRNA, aptamer, etc., and is a useful material.

[0004] Nucleic acid oligomers can be synthesized by solid phase synthesis, in which phosphoramidites of nucleosides (hereinafter referred to as "amides") are used as raw materials. The nucleic acid oligomer synthesized by extending the nucleic acid on a solid phase support is cut out from the solid phase support, and then, for the nucleic acid oligomer containing ribose, the protecting group of the hydroxyl group at the 2' position of the ribose is deprotected and removed to prepare the target nucleic acid oligomer. Since the nucleic acid oligomers are subjected to multiple steps such as the extension reaction step of the nucleic acid on the solid phase support, the step of cutting out from the solid phase support, and the step of deprotecting each protecting group, the purity of the nucleic acid oligomers synthesized in this way is not always satisfactory, and the synthesis is not efficient (Patent Documents 1, 2).

[0005] Prior art literature

[0006] Patent Literature

[0007] Patent Document 1: International Publication No. 2006 / 022323

[0008] Patent Document 2: International Publication No. 2013 / 027843 Summary of the invention

[0009] Problems to be solved by the invention

[0010] The object of the present invention is to provide an efficient method for preparing nucleic acid oligomers.

[0011] Means for solving problems

[0012] The inventors of the present application have repeatedly conducted earnest studies to achieve the above-mentioned purpose, and as a result, have obtained the following insight: by bringing fluoride ions into contact with a nucleic acid oligomer in an inert gas atmosphere with an oxygen concentration below a certain level, the protecting group of the hydroxyl group of the ribose contained in the nucleic acid oligomer can be efficiently deprotected, and as a result, an efficient method for preparing nucleic acid oligomers can be provided.

[0013] The present invention has been completed based on the above findings, and the present invention includes the following aspects, but is not limited thereto.

[0014] Item 1. A method for producing a nucleic acid oligomer represented by formula (4) (hereinafter referred to as "the production method of the present invention" in this specification), characterized in that a nucleic acid oligomer represented by formula (3) is brought into contact with fluoride ions in an inert gas atmosphere having an oxygen concentration of 15% or less,

[0015] [Chemical formula 1]

[0016]

[0017] (In formula (3),

[0018] G 4 represents a protecting group for a hydrogen atom or a hydroxyl group,

[0019] G 5 represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion or a hydroxyalkylammonium ion,

[0020] B C Each independently represents the same or different nucleic acid bases,

[0021] R are the same or different from each other, and each independently represents a hydrogen atom, a fluorine atom or an OQ group,

[0022] Q are the same or different and each independently represents a tert-butyldimethylsilyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, an ethylidene group bonded to the carbon atom at the 4' position of ribose, or a protecting group of formula (1),

[0023] [Chemical formula 2]

[0024]

[0025] (In formula (1),

[0026] R a and R b are the same or different from each other, representing a methyl group, an ethyl group or a hydrogen atom,

[0027] The bond marked with * indicates the bond with the oxygen atom of the OQ group.

[0028] n represents any integer from 1 to 5.

[0029] Among them, R a and R b Not representing hydrogen atoms at the same time)

[0030] Y are the same or different from each other and each independently represents an oxygen atom or a sulfur atom,

[0031] m represents any integer from 2 to 200,

[0032] W and X are defined by either (a) or (b) below,

[0033] (a) When W is a hydroxyl group, X has the same meaning as the above R group.

[0034] (b) When X is a hydroxyl group, W represents an OV group,

[0035] V represents a tert-butyldimethylsilyl group or a group of the above formula (1).

[0036] wherein at least one of the aforementioned R, W and X represents a hydroxyl group protected by the protecting group of the aforementioned formula (1).

[0037] When m is an integer greater than 3, the nucleic acid oligomer represented by formula (3) is a nucleic acid oligomer in which a non-nucleotide linker is incorporated to replace p nucleotides (wherein p is a positive integer satisfying the formula: m-1>p) between the nucleotides at each 5' end and 3' end.

[0038] [Chemical formula 1]

[0039]

[0040] (In formula (4),

[0041] R' is the same as or different from each other, and each independently represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group,

[0042] Q' are the same or different from each other, and each independently represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position, or an ethylidene group bonded to the carbon atom at the 4' position,

[0043] The substituent G of formula (4) 4 , G 5 , Y, B c and m are defined as in the above formula (3),

[0044] W0 is a hydroxyl group,

[0045] X0 is the same as defined above for the R' group.

[0046] Furthermore, when m is an integer greater than or equal to 3, the nucleic acid oligomer represented by formula (4) is a nucleic acid oligomer in which a non-nucleotide linker is incorporated to replace p nucleotides (where p is a positive integer satisfying the formula: m-1>p) between the nucleotides at each 5' end and the 3' end.

[0047] Item 2. The production method according to Item 1 above, wherein the non-nucleotide linker is a linker comprising an amino acid backbone.

[0048] Item 3. The production method according to Item 2 above, wherein the linker comprising an amino acid backbone is a linker having a structure of the following formula (A14-1), (A14-2) or (A14-3).

[0049] [Chemical formula 4]

[0050]

[0051] (In formulas (A14-1), (A14-2), and (A14-3), 5' and 3' represent the 5' terminal side and 3' terminal side of the nucleic acid oligomer, respectively)

[0052] Item 4. The production method according to any one of Items 1 to 3, wherein W is a hydroxyl group, X is an R group, W0 is a hydroxyl group, and X0 is an R' group.

[0053] Item 5. The production method according to any one of Items 1 to 4, wherein the fluoride ion source is tetraalkylammonium fluoride.

[0054] Item 6. The production method according to any one of Items 1 to 5, wherein the tetraalkylammonium fluoride is tetra-n-butylammonium fluoride (TBAF).

[0055] Item 7. The production method according to any one of Items 1 to 6, wherein the reaction is carried out in an inert gas atmosphere having an oxygen concentration of 10% or less.

[0056] Item 8. The production method according to any one of Items 1 to 6, wherein the reaction is carried out in an inert gas atmosphere having an oxygen concentration of 5% or less.

[0057] Item 9. The production method according to any one of Items 1 to 6, wherein the reaction is performed in an inert gas atmosphere having an oxygen concentration of 0%.

[0058] Item 10. The production method according to any one of Items 1 to 9, wherein the time required to add the entire amount of fluoride ions to the nucleic acid oligomer represented by formula (3) is 30 minutes or more.

[0059] Item 11. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 5% or more.

[0060] Item 12. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 10% or more.

[0061] Item 13. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 20% or more.

[0062] Item 14. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 30% or more.

[0063] Item 15. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 40% or more.

[0064] Item 16. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 50% or more.

[0065] Item 17. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 60% or more.

[0066] Item 18. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 70% or more.

[0067] Item 19. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 80% or more.

[0068] Item 20. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 90% or more.

[0069] Item 21. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 95% or more.

[0070] Item 22. The production method according to any one of Items 1 to 10, wherein the ratio of the protecting group of the formula (1) among R, W and X in the nucleic acid oligomer represented by formula (3) is 100%.

[0071] Effects of the Invention

[0072] The present invention provides an efficient method for preparing a nucleic acid oligomer, and it is expected that the purity of the prepared nucleic acid oligomer can be improved. DETAILED DESCRIPTION

[0073] A method for producing a nucleic acid oligomer represented by formula (4) in which the protecting group of formula (1) is deprotected by contacting a nucleic acid oligomer represented by the following formula (3) with fluoride ions in an inert gas atmosphere having an oxygen concentration of 15% or less is described.

[0074] In formula (1), R a and R b can be methyl, ethyl or hydrogen atoms, preferably R a is methyl or ethyl, R b is hydrogen, more preferably R a Methyl, R b n is preferably an integer of 1 to 4, more preferably an integer of 1 to 3, further preferably 1 or 2, and particularly preferably 1.

[0075] At least one of R, W and X in formula (3) represents a hydroxyl group protected by a protecting group of the aforementioned formula (1). Among R, W and X, the proportion of formula (1) may be 1% or more, more preferably 5% or more, more preferably 10% or more, more preferably 20% or more, more preferably 30% or more, more preferably 40% or more, more preferably 50% or more, more preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, and even more preferably 95% or more.

[0076] In the contact reaction between the nucleic acid oligomer shown in formula (3) and the fluoride ion, the fluoride ion can also be added to the nucleic acid oligomer shown in formula (3), and vice versa, the nucleic acid oligomer shown in formula (3) can also be added to the fluoride ion, and both can be added simultaneously. Preferably, the method of adding the fluoride ion to the nucleic acid oligomer shown in formula (3) is used. As for the time required to add the total amount of fluoride ions to the nucleic acid oligomer shown in formula (3), it is preferably added dropwise over 5 minutes, more preferably over 10 minutes, more preferably over 15 minutes, more preferably over 30 minutes, and further preferably over 1 hour.

[0077] The addition is preferably performed dropwise onto the liquid surface or into the liquid of the solution containing the nucleic acid oligomer represented by formula (3) over 5 minutes or more, more preferably over 10 minutes or more, more preferably over 15 minutes or more, more preferably over 30 minutes or more, and further preferably over 1 hour or more.

[0078] In the step of deprotecting the protective group of the hydroxyl group represented by the formula (1), tetraalkylammonium fluoride is typically used as a fluoride ion source.

[0079] Examples of tetraalkylammonium fluorides include tetrabutylammonium fluoride and tetramethylammonium fluoride. Among them, tetrabutylammonium fluoride (TBAF) is more preferred.

[0080] The amount of fluoride ions used is usually 1 to 1000 mol, preferably 1 to 500 mol, more preferably 2 to 200 mol, and further preferably 4 to 100 mol, based on 1 mol of the protecting group to be removed.

[0081] In this step, an organic solvent that is inert to the reaction is usually used. Specifically, for example, a sulfoxide solvent, a nitrile solvent, an ether solvent, an amide solvent, a ketone solvent, an aliphatic hydrocarbon solvent, an ester solvent, an aromatic solvent, or a mixed solvent of two or more of the above can be cited. Among these solvents, a sulfoxide solvent is preferred. As a sulfoxide solvent, dimethyl sulfoxide and the like can be cited. As a nitrile solvent, acetonitrile and propionitrile and the like can be cited. As an ether solvent, tetrahydrofuran and the like can be cited. As an amide solvent, N-methyl-2-pyrrolidone and the like can be cited. As a ketone solvent, acetone and methyl ethyl ketone and the like can be cited. As an aliphatic hydrocarbon solvent, hexane and heptane and the like can be cited. As an ester solvent, methyl acetate and ethyl acetate and the like can be cited. As an aromatic solvent, toluene and pyridine and the like can be cited. Among them, dimethyl sulfoxide or a mixed solvent of dimethyl sulfoxide and acetonitrile is preferred.

[0082] The fluoride ion source as a reagent used in the step of removing the protecting group of the hydroxyl group represented by formula (1) is usually used after being dissolved in a solvent and then dehydrated. Examples of the dehydrating agent include molecular sieves and sulfates, and molecular sieves 4A are preferably used.

[0083] The amount of the solvent used is usually 5 to 8,000 L, preferably 50 to 2,000 L, and more preferably 100 to 1,600 L, based on 1 mol of the nucleic acid oligomer subjected to the deprotection step.

[0084] If necessary, a compound that reacts with the nitrile compound shown in the following formula (2) as a by-product in this step to capture the nitrile compound can be added. Examples of the compound to be captured include nitroalkanes, alkylamines, amidines, thiols, thiol derivatives, or mixtures of two or more of the above. As "nitroalkanes", for example, nitromethane can be mentioned. As "alkylamines", for example, linear alkylamines having 1 to 6 carbon atoms and cyclic amines having 1 to 8 carbon atoms can be mentioned. Specifically, for example, methylamine, ethylamine, n-propylamine, n-butylamine, n-pentylamine, n-hexylamine, morpholine, and piperidine can be mentioned. As "amidines", for example, benzamidine and formamidine can be mentioned. As "thiols", for example, linear thiols having 1 to 6 carbon atoms can be mentioned. Specifically, for example, methyl mercaptan, ethyl mercaptan, 1-propanethiol, 1-butanethiol, 1-pentanethiol, and 1-hexanethiol can be mentioned. Examples of "thiol derivatives" include alcohols or ethers having the same or different linear alkylthiol groups having 1 to 6 carbon atoms. Specifically, examples include 2-mercaptoethanol, 4-mercapto-1-butanol, 6-mercapto-1-hexanol, mercaptomethyl ether, 2-mercaptoethyl ether, 3-mercaptopropyl ether, 4-mercaptobutyl ether, 5-mercaptopentyl ether, and 6-mercaptohexyl ether. As the compound to be captured, nitromethane is more preferably used.

[0085] The compound represented by formula (2):

[0086] [Chemical formula 5]

[0087]

[0088] (In formula (2), R a and R b are the same or different from each other, and represent a methyl group, an ethyl group or a hydrogen atom. a and R b It does not represent a hydrogen atom at the same time. ).

[0089] The amount of the compound used to capture the compound represented by formula (2) as a by-product can be 0.1 to 100.0 mol %, preferably 1.0 to 50.0 mol %, preferably 2.0 to 40.0 mol %, and more preferably 3.0 to 30.0 mol % relative to the fluoride ion source for removing the protecting group of the hydroxyl group represented by formula (1).

[0090] The temperature of the deprotection reaction of the protective group of the hydroxyl group represented by formula (1) varies depending on the type of the deprotecting agent used, but is usually 0°C to 80°C, preferably 10°C to 45°C, and more preferably 15°C to 35°C.

[0091] The deprotection reaction time varies depending on the type of deprotecting agent used and the reaction temperature, but is generally 1 to 100 hours, preferably 1 to 24 hours, more preferably 2 to 12 hours, more preferably 3 to 10 hours, more preferably 3 to 8 hours, and even more preferably 3 to 6 hours.

[0092] The reaction temperature may be changed at any time, and a deprotecting agent for deprotecting the protective group of the hydroxyl group represented by formula (1) may be added at any time.

[0093] For an inert gas atmosphere with an oxygen concentration of 15% or less, for example, an inert gas with an oxygen concentration below the above-specified concentration is prepared and supplied to the reaction system, and the oxygen concentration in the gas phase can be adjusted by measuring and confirming that it is within the above-specified concentration range. Specifically, the adjustment can be made by circulating a high-purity inert gas such as argon or nitrogen, or an inert gas whose oxygen concentration has been adjusted to a specified concentration, in the gas phase of the reaction system; or, replacing the gas phase atmosphere of the reaction system with the above-specified inert gas or an inert gas whose concentration has been adjusted.

[0094] Here, the inert gas used in the production method of the present invention includes nitrogen, argon, helium, and carbon dioxide, but is not limited thereto. Preferably, nitrogen or argon is used.

[0095] The reaction system atmosphere replacement method may be reduced pressure replacement, pressurized replacement, flow replacement, replacement based on bubbling, or replacement based on freeze degassing, and ultrasonic waves may be applied or heating may be performed. More preferred methods are flow replacement and reduced pressure replacement.

[0096] The oxygen concentration is preferably 15% or less, more preferably 10% or less, more preferably 5% or less, and even more preferably 0%.

[0097] During the removal reaction of the protecting group, although stirring of the reaction system is not necessary, it is usually performed at a stirring power Pv of 0.0 to 0.5 kW / m 3 Stirring is performed within a range of 0.1 to 0.3 kW / m 3 of stirring.

[0098] The separation and purification means from the reaction mixture of the nucleic acid oligomer generated after the reaction can be carried out by conventional methods, such as extraction, concentration, neutralization, filtration, centrifugation, recrystallization, silica gel column chromatography, thin layer chromatography, reverse phase column chromatography, ion exchange column chromatography, gel filtration column chromatography, hydrophobic interaction chromatography, hydrophilic interaction chromatography, precipitation (for example, precipitation of nucleic acid oligomers using ethanol, isopropanol, methanol or polyethylene glycol), dialysis, ultrafiltration, etc., to remove the protection brought by the formula (1) as a protecting group for the hydroxyl group at the 2' or 3' position. The purified nucleic acid oligomer can be separated. The separated nucleic acid oligomer is usually obtained in the form of a nucleic acid oligomer whose hydroxyl group at its 5' end has been protected.

[0099] The reaction for obtaining the nucleic acid oligomer represented by the following formula (4) by deprotecting the protecting group represented by the formula (1) from the nucleic acid oligomer represented by the formula (3) is as follows: (Scheme 1).

[0100] [Chemical formula 6]

[0101]

[0102] In formula (3) or formula (4), when R represents an OQ group and R' represents an OQ' group, the structure of ribose is represented by the following formula (LNA-1), (LNA-2) or (LNA-3).

[0103] [Chemical formula 7]

[0104]

[0105] (In the formula, Base represents a nucleic acid base)

[0106] Examples of nucleosides (ribose and deoxyribose) contained in the nucleic acid oligomer used in the present invention include DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the aforementioned LNA, but the aforementioned nucleosides are not limited thereto.

[0107] The nucleic acid oligomer represented by formula (3) can be obtained, for example, as shown in Scheme 2, by excising the nucleic acid oligomer represented by formula (5) prepared by solid phase synthesis from a solid phase support.

[0108] [Chemical formula 8]

[0109]

[0110] In the nucleic acid oligomer of formula (5) synthesized on the solid phase carrier,

[0111] In the formula,

[0112] Substituent B aEach independently represents the same or different protectable nucleic acid bases,

[0113] G 4 and Y is as defined in the above formula (3),

[0114] G 2 Each independently represents the same or different protecting groups of phosphoric acid,

[0115] When X1 represents OZ, W1 represents OV base,

[0116] V represents a tert-butyldimethylsilyl group or a group of the above formula (1).

[0117] When X1 represents an R group, W1 represents a group represented by OZ,

[0118] Z represents a group formed by a solid phase carrier and a linker connecting the solid phase carrier to the oxygen atom of the hydroxyl group at the 2'-position or 3'-position of the ribose at the 3'-terminus of the nucleic acid oligomer.

[0119] More specifically, Z represents a structure represented by the following formula (6),

[0120] [Chemical formula 9]

[0121]

[0122] In formula (6), Sp represents a spacer group.

[0123] Examples of the spacer (Sp) include groups having the structural formula shown in the following formula (7).

[0124] [Chemical formula 10]

[0125]

[0126] Linker may have the structure shown in the following formulas (8-1), (8-2), (8-3), (8-4), (8-5), (8-6), (8-7), and (8-8), for example.

[0127] As solid supports, inorganic porous supports, organic resin supports, etc. can be cited. For example, inorganic porous supports include controlled pore glass (CPG) and zeolite. For example, organic resin supports include supports made of polystyrene.

[0128] [Chemical formula 11]

[0129]

[0130] [Chemical formula 12]

[0131]

[0132] (In the formula, A may be a hydroxyl group, an alkoxy group, or an alkyl group. Examples of the alkoxy group include a methoxy group and an ethoxy group. Examples of the alkyl group include a methyl group, an ethyl group, an isopropyl group, and an n-propyl group. It represents the oxygen bonding of Si to the hydroxyl group on the surface of the carrier)

[0133] The compound of the formula (5) can be produced, for example, by an amide method using an amide compound of the following formula (A13).

[0134] [Chemical formula 13]

[0135]

[0136] (In formula (A13),

[0137] R represents a hydrogen atom, a fluorine atom, or an OQ group,

[0138] Q represents tert-butyldimethylsilyl, methyl, 2-methoxyethyl, a methylene group bonded to the carbon atom at 4', an ethylene group bonded to the carbon atom at 4', an ethylidene group bonded to the carbon atom at 4', or a protecting group represented by the above formula (1),

[0139] B a represents a protectable nucleic acid base,

[0140] G 1 represents a protecting group for a hydroxyl group,

[0141] G 2 represents the protecting group of phosphate,

[0142] G 3 represents an alkyl group, or they are bonded to each other at their ends to form a cyclic structure)

[0143] B a The nucleic acid base in is not particularly limited. As the nucleic acid base, adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, 1-methylpseudouracil, etc. can be enumerated. In addition, the nucleic acid base can also be substituted by a substituent. As such a substituent, for example, a halogen atom such as a fluoro group, a chloro group, a bromo group, and an iodo group, an acyl group such as an acetyl group, an alkyl group such as a methyl group and an ethyl group, an aralkyl group such as a benzyl group, an alkoxy group such as a methoxy group, an alkoxyalkyl group such as a methoxyethyl group, a cyanoalkyl group such as a cyanoethyl group, a hydroxyl group, a hydroxyalkyl group, an acyloxymethyl group, an amino group, a monoalkylamino group, a dialkylamino group, a carboxyl group, a cyano group, a nitro group, etc., and a combination of two or more substituents in the above-mentioned can be enumerated.

[0144] When the nucleic acid base has an amino group outside the ring, there is no particular limitation on the protecting group of the amino group, and known protecting groups used in nucleic acid chemistry can be used. Examples of such protecting groups include benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, (dimethylamino)methylene, and the like, as well as combinations of two or more of the above protecting groups.

[0145] B a More specifically, it represents a group represented by any one of the following formulae,

[0146] [Chemical formula 14]

[0147]

[0148] (In the above formula,

[0149] R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group or a benzoyl group,

[0150] R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group or a benzoyl group,

[0151] R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group or an isobutyryl group,

[0152] R 7 represents 2-cyanoethyl,

[0153] R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group or a 4-methylbenzoyl group,

[0154] R 9 represents dimethylaminomethylene).

[0155] As G 1 Any group can be used without particular limitation as long as it can function as a protecting group, and a wide range of known protecting groups used for amide compounds can be used.

[0156] As G 1 , preferably the following groups.

[0157] [Chemical formula 15]

[0158]

[0159] (Where R 1 , R2 and R 3 are the same or different from each other, representing hydrogen or alkoxy)

[0160] R 1 , R 2 and R 3 Preferably, one of the alkoxy groups is a hydrogen atom, and the remaining two alkoxy groups are the same or different (preferably the same) from each other. The alkoxy group is particularly preferably a methoxy group.

[0161] As G 2 As long as it can function as a protecting group, it can be used without particular limitation, and a wide range of known protecting groups used in amide compounds can be used. 2 , for example, alkyl, alkenyl, alkynyl, cycloalkyl, haloalkyl, aryl, heteroaryl, aralkyl, cycloalkenyl, cycloalkylalkyl, cycloalkyl, hydroxyalkyl, aminoalkyl, alkoxyalkyl, heterocyclylalkenyl, heterocyclylalkyl, heteroaralkyl, silyl, siloxyalkyl, monoalkylsilyl, dialkylsilyl or trialkylsilyl, monoalkylsiloxyalkyl, dialkylsiloxyalkyl or trialkylsiloxyalkyl, and they may be substituted with one or more electron withdrawing groups.

[0162] G 2 An alkyl group substituted with an electron-withdrawing group is preferred. Examples of the electron-withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group, and a cyano group is preferred.

[0163] As G 2 , the following groups are particularly preferred.

[0164] [Chemical formula 16]

[0165]

[0166] For G 3 For example, 2G 3 Bonded to each other to form a ring structure. 3 , preferably both are isopropyl.

[0167] The aforementioned R 1 , R 2 , R 3 and G 2 The alkyl group in the definition of may be either linear or branched, preferably an alkyl group having 1 to 12 carbon atoms, and more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl. The alkyl part constituting the alkoxy group in the definition of the above substituent has the same definition as the definition of the alkyl group herein.

[0168] G 4 represents a protecting group for a hydrogen atom or a hydroxyl group. When a protecting group is represented, it represents the same 1 The same protecting group. 4 During deprotection, the nucleotide compound is a hydrogen atom, and the nucleotide compound at this time is also used in a series of nucleic acid extension reaction steps.

[0169] G 5 " represents ammonium ion, alkylammonium ion, alkali metal ion, hydrogen ion or hydroxyalkylammonium ion. As alkylammonium ion, as specific examples of alkyl, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl and hexyl can be cited, and more specifically, for example, diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion and dibutylammonium ion can be cited. In addition, as alkali metal ion, for example, sodium ion and lithium ion can be cited. In addition, as hydroxyalkylammonium ion, as specific examples of hydroxyalkyl part, for example, hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxy-isopropyl, hydroxy-n-butyl and trihydroxymethyl can be cited, and as more specific examples of hydroxyalkylammonium ion, trihydroxymethylammonium ion can be cited.

[0170] In this specification, a nucleic acid base means a group having a natural or non-natural nucleic acid base backbone. The aforementioned nucleic acid base also includes a modified form of a natural or non-natural nucleic acid base backbone. C More specifically, the nucleic acid base represented by the formula (a) can be exemplified by the following structures.

[0171] [Chemical formula 17]

[0172]

[0173] (In the above formula,

[0174] R 4’ represents a hydrogen atom or a methyl group,

[0175] R 5’ represents a hydrogen atom or an acetyl group,

[0176] R 6’ represents a hydrogen atom,

[0177] R 8’ represents hydrogen atom, methyl group)

[0178] B a Indicates B C The nucleic acid base represented by or the nucleic acid base protected by a protecting group.

[0179] Next, a method for producing a nucleoside comprising a ribose in which a hydroxyl group is protected by a protecting group represented by formula (1) and an amide compound thereof will be described.

[0180] The amide compound in which the 2′-hydroxyl group of ribose is protected by a protecting group represented by formula (1) can be prepared, for example, according to the following routes 3 and 4 described in International Publication No. 2019 / 208571, Japanese Patent Application No. 2018-083148, and PCT / JP2019 / 017249.

[0181] [Chemical formula 18]

[0182]

[0183] [Chemical formula 19]

[0184]

[0185] (Where,

[0186] R a and R b are the same or different from each other, representing a methyl group, an ethyl group or a hydrogen atom, wherein R a and R b It does not represent hydrogen atoms at the same time;

[0187] R c is methyl or ethyl,

[0188] B a represents a protectable nucleic acid base,

[0189] n represents any integer from 1 to 5,

[0190] G represents a protecting group for the hydroxyl group shown in the formula,

[0191] G 1 and G 2 are the same or different from each other, each independently representing a protecting group for a hydroxyl group, and G 3 are the same or different from each other, representing an alkyl group. )

[0192] The above-mentioned routes 3 and 4 are summarized.

[0193] First, as shown in Scheme 3, compound 1 The 3-hydroxyalkyl nitrile compound 2 is reacted with cyanide ions. Next, the compound 2 is reacted with bis(alkyl methylthio) ether to obtain an ether compound 3 .

[0194] Next, as shown in Scheme 4, compound 4 In the presence of an oxidant 5(which is prepared according to the method described in Scheme 3) to obtain the compound 6 (The 2'-hydroxyl group of ribose is protected by a protecting group represented by formula (1)). 6 Deprotection was performed to obtain compound 7 . Selectively use the protecting group G 1 Protect the compound 7 The hydroxyl group of 8 In addition, the compound 8 The desired amide compound 10 is prepared by reacting with a phosphorodiamidite compound 9.

[0195] Route 3

[0196] In the reaction of route 3,

[0197] As the cyanide ion, for example, cyanide ions derived from sodium cyanide, potassium cyanide, copper cyanide, trimethylsilyl cyanide, or the like can be used.

[0198] When trimethylsilyl cyanide is used, it is preferred to add a base.

[0199] Examples of the base in this reaction include alkali metal hydroxides, alkaline earth metal hydroxides, ammonium hydroxide, and combinations of two or more thereof. In the present invention, lithium hydroxide and lithium hydroxide monohydrate are preferably used. 1 The amount of the base is usually 0.01 to 1 equivalent, preferably 0.1 to 0.3 equivalent.

[0200] Relative to compound 1 The amount of cyanide ion is generally 0.3 to 2 equivalents, preferably 0.6 to 0.8 equivalents.

[0201] In this specification, unless otherwise specified, the term "equivalent" means "molar equivalent".

[0202] The reaction temperature of the present reaction is usually -20 to 40° C., preferably 0 to 35° C. The reaction time of the present reaction is usually 0.5 to 24 hours, preferably 1 to 5 hours.

[0203] The ether compound 3 can be prepared, for example, by reacting bis(alkyl methylthio) ether or bis(phenyl methylthio) ether with 3-hydroxy-3-alkylpropionitrile in a solvent in the presence of an oxidizing agent and an acid.

[0204] [Chemical formula 20]

[0205]

[0206] Bis(alkylmethylthio)ether or bis(phenylmethylthio)ether can be obtained, for example, by reacting bis(chloromethyl)ether or bis(aryloxymethyl)ether with the corresponding alkylthiol or phenylthiol as shown in the following formula. Examples of bis(aryloxymethyl)ether include bis(2,4,6-trichlorophenyloxymethyl)ether.

[0207] [Chemical formula 21]

[0208]

[0209] Alternatively, the compound may be produced based on the methods described in the Examples below or by appropriately modifying these methods as needed.

[0210] As the oxidizing agent, for example, N-halosuccinimides such as N-chlorosuccinimide, N-bromosuccinimide, and N-iodosuccinimide, N-halohydantoins such as 1,3-diiodo-5,5-dimethylhydantoin, and halogens such as chlorine, bromine, and iodine, and combinations of two or more thereof can be cited. In the present invention, N-halosuccinimide is preferably used, and N-iodosuccinimide is more preferably used.

[0211] In this reaction, an acid may be used in addition to the oxidant. The acid is not particularly limited, and examples thereof include perfluoroalkyl carboxylic acids and salts thereof, perfluoroalkyl sulfonic acids and salts thereof, and alkyl sulfonic acids and salts thereof, and combinations of two or more thereof. Examples of salts include copper salts and silver salts. Specifically, examples of acids include methanesulfonic acid, p-toluenesulfonic acid, camphorsulfonic acid, trifluoromethanesulfonic acid, and silver trifluoromethanesulfonate, and combinations of two or more thereof. In the present invention, trifluoromethanesulfonic acid is preferably used.

[0212] Examples of the solvent include tetrahydrofuran, 2-methyltetrahydrofuran, cyclopentyl methyl ether, dioxane, dichloromethane, toluene, and combinations of two or more thereof. In the present invention, tetrahydrofuran is preferably used.

[0213] The amount of 3-hydroxyalkyl nitrile is usually 0.5 to 2.0 equivalents, preferably 0.8 to 1.5 equivalents, relative to bis(alkyl methylthio) ether or bis(phenyl methylthio) ether. The amount of the oxidant is usually 0.5 to 2 equivalents, preferably 0.7 to 1.2 equivalents, relative to bis(alkyl methylthio) ether or bis(phenyl methylthio) ether. The amount of the acid is usually 0.001 to 2.0 equivalents, preferably 0.01 to 0.1 equivalents, relative to bis(alkyl methylthio) ether or bis(phenyl methylthio) ether.

[0214] The reaction temperature of the present reaction is usually -80°C to 0°C, preferably -50°C to -30°C. The reaction time of the present reaction is usually 1 to 24 hours, preferably 2 to 6 hours.

[0215] The completion of the reaction can be confirmed, for example, by sampling a portion of the reaction material and using an analytical method such as GC, TLC, or LC. After the reaction is completed, a base such as triethylamine can be added to the reaction material to terminate the reaction. The reaction material is poured into water and subjected to conventional post-treatment operations such as organic solvent extraction, washing, and concentration, thereby obtaining a product containing an ether compound. 6 The residue is subjected to purification operations such as distillation and column chromatography to obtain a high-purity ether compound. 3 .

[0216] Route 4

[0217] In the reaction of route 4,

[0218] Step 1 (Etherification Step)

[0219] Preparation of compounds 6 The process can make the compound 4 With compound 5 The reaction is usually carried out by adding an oxidant. The oxidant used in this step is not particularly limited, but is preferably at least one selected from the group consisting of N-chlorosuccinimide, N-bromosuccinimide, N-iodosuccinimide, iodine, 1,3-diiodo-5,5'-dimethylhydantoin, bromine and chlorine.

[0220] In this step, an acid may be added. The acid to be used is not particularly limited, but is preferably at least one selected from the group consisting of perfluoroalkyl carboxylic acids, perfluoroalkyl sulfonic acids, alkyl sulfonic acids, and salts thereof.

[0221] The reaction solvent used in this step is not particularly limited, and for example, ether, THF (tetrahydrofuran), 2-methyltetrahydrofuran, tetrahydropyran, 4-methyltetrahydropyran, dimethoxyethane, diglyme, cyclopentyl methyl ether, ethers such as dioxane, nitriles such as acetonitrile, toluene, chlorobenzene, aromatic hydrocarbons such as dichlorobenzene, dichloromethane, etc., and a combination of two or more of the above-mentioned solvents can be cited. As a preferred solvent, ether, THF (tetrahydrofuran), 2-methyltetrahydrofuran, tetrahydropyran, 4-methyltetrahydropyran, dimethoxyethane, diglyme, cyclopentyl methyl ether, ethers such as dioxane can be cited. More preferred solvents include tetrahydropyran and 4-methyltetrahydropyran.

[0222] In this step, the reaction time is not particularly limited, and is, for example, 10 minutes to 12 hours, and preferably 10 minutes to 6 hours.

[0223] In this step, the reaction temperature is not particularly limited, and is, for example, -80 to 30°C, preferably -60 to 10°C.

[0224] In this step, the ether compound5 The concentration is not particularly limited and can be set appropriately.

[0225] In this process, relative to the compound 4 In terms of molar number, ether compounds 5 The molar number of is, for example, 0.5 to 2 times, preferably 0.8 to 1.5 times.

[0226] In this step, relative to the compound 4 In terms of the molar number of the oxidizing agent, the molar number of the oxidizing agent is, for example, 0.5 to 10 times, preferably 0.8 to 6 times.

[0227] Step 2 (deprotection step)

[0228] The compound obtained in the above step 1 6 Can be used for deprotection reaction to convert into compounds 7 The deprotection step can be carried out by a known method. Typically, the deprotection can be carried out by reacting hydrofluoric acid / triethylamine or hydrofluoric acid / pyridine in a solvent.

[0229] Step 3 (5' hydroxyl group protection step)

[0230] The compound obtained in the above process 7 The protective group can be introduced into the protecting step by a known method. Typically, 4,4'-dimethoxytrityl chloride can be reacted with a compound in pyridine. 7 Reaction to introduce protective groups and prepare compounds 8 .

[0231] Step 4 (amidation step)

[0232] This process can be performed by making the compound 9 The compound obtained in the above process 8 Typically, in the presence of diisopropyl ammonium tetrazolide, a compound 9 The amide compound is prepared by reacting 2-cyanoethyl-N,N,N',N'-tetraisopropylphosphorodiamidite. 10 The amidation can also be carried out according to the method described in Examples 2 to 5 of Japanese Patent No. 5554881.

[0233] The non-nucleotide linker that can be introduced to replace p nucleotides (where p is a positive integer satisfying the formula: m-1>p) between the nucleotides at the 5' end and the 3' end of the nucleic acid oligomer of formula (3) and formula (4) is described.

[0234] As a non-nucleotide linker, a linker comprising an amino acid backbone (e.g., a linker comprising an amino acid backbone described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881) can be exemplified. Specifically, as a non-limiting example, for example, a linker represented by formula (A14-1), (A14-2) or (A14-3) (described in, for example, Japanese Patent No. 5555346 or Japanese Patent No. 5876890) can be exemplified. In addition to the above-mentioned linker, a linker described in International Publication No. 2012 / 005368, International Publication No. 2018 / 182008 or International Publication No. 2019 / 074110 can be exemplified.

[0235] [Chemical formula 22]

[0236]

[0237] Nucleotides and amides in which the R group in formula (3) and the R' group in formula (4) are substituents other than hydroxyl groups can also be prepared from nucleosides synthesized using known methods described in Japanese Patent No. 3745226, International Publication No. 2001 / 053528 or Japanese Patent Application Publication No. 2014-221817 and known methods cited therein. In addition, substances that can be purchased as commercial products can be prepared based on the methods described in the examples described later or by methods that appropriately modify these methods.

[0238] Cutting out the nucleic acid oligomer (hereinafter also referred to as oligonucleotide) from the solid phase support

[0239] The excision step is performed for a nucleic acid oligomer of a desired chain length using concentrated ammonia water as an excision agent.

[0240] The phosphoramidite method generally performs a nucleic acid extension reaction by repeating a deprotection step, a condensation step, and an oxidation step according to a known method (for example, the method described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881).

[0241] (Nucleic acid extension reaction)

[0242] In this specification, "nucleic acid extension reaction" means a reaction in which nucleotides are sequentially bonded via a phosphodiester bond to extend an oligonucleotide. The nucleic acid extension reaction can be carried out according to the steps of a conventional phosphoramidite method. The nucleic acid extension reaction can also be carried out using a nucleic acid automatic synthesis device using the phosphoramidite method, etc.

[0243] The chain length of the nucleic acid oligomer may be, for example, 2 to 200 mer, 10 to 150 mer, or 15 to 110 mer.

[0244] The 5' deprotection step is a step of deprotecting the protecting group of the 5' hydroxyl group at the end of the RNA chain supported on the solid phase carrier. As common protecting groups, 4,4'-dimethoxytrityl (DMTr group), 4-monomethoxytrityl, 4,4',4"-trimethoxytrityl can be used. Deprotection can be carried out using an acid. Examples of the acid used for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, p-toluenesulfonic acid, and the like.

[0245] The condensation step is a reaction in which the nucleoside phosphoramidite represented by formula (A13) is bonded to the 5' hydroxyl group at the end of the oligonucleotide chain deprotected by the aforementioned deprotection step. It should be noted that as the phosphoramidite used in nucleic acid extension, an amide compound represented by formula (A13) or (A12) is used. In addition, as other usable phosphoramidites, 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-H, 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, etc. can be cited. As the aforementioned nucleoside phosphoramidite, a nucleoside phosphoramidite in which the 5' hydroxyl group is protected by a protecting group (e.g., a DMTr group) is used. The condensation step can be carried out using an activator that activates the aforementioned nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazolium (BTT), 1H-tetrazolium, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazolium (ETT), N-methylbenzimidazolium trifluoromethanesulfonate (N-MeBIT), benzimidazolium trifluoromethanesulfonate (BIT), N-phenylimidazolium trifluoromethanesulfonate (N-PhIMT), imidazolium trifluoromethanesulfonate (IMT), 5-nitrobenzimidazolium trifluoromethanesulfonate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazolium.

[0246] After the condensation step, the unreacted 5' hydroxyl group may be capped as appropriate. Capping can be performed using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0247] The oxidation step is a step of converting the phosphite group formed in the above-mentioned condensation step into a phosphate group or a phosphorothioate group. This step is a reaction in which trivalent phosphorus is converted into pentavalent phosphorus using an oxidizing agent, and can be carried out by allowing the oxidizing agent to act on the oligonucleic acid derivative supported on the solid phase carrier.

[0248] When the phosphite group is converted into a phosphate group, as an "oxidant", for example, iodine, or peroxy acids such as tert-butyl hydroperoxide, hydrogen peroxide, or 10-camphorsulfur oxazine (CSO) can be used. The oxidant can be diluted with a suitable solvent in a concentration of 0.005 to 2M and used. As the solvent used in the reaction, as long as it does not hinder the reaction, it is not particularly limited, and pyridine, THF, water, acetonitrile, 1-methylimidazole (NMI) or any mixed solvent of two or more of the above can be cited. For example, iodine / water / pyridine / acetonitrile, or iodine / water / pyridine, or iodine / water / pyridine / acetonitrile / NMI, or iodine / water / pyridine / THF, or iodine / water / pyridine / THF / NMI, or CSO / acetonitrile, or iodine / pyridine-acetic acid, peroxy acid (tert-butyl hydroperoxide / dichloromethane) can be used.

[0249] When converting a phosphite group into a thiophosphoric acid group, as the "oxidant", for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazol-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylene)amino]-3H-1,2,4-dithiazoline-3-thione ([(N,N-Dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione) (DDTT), or phenylacetyl disulfide (PADS) can be used. The oxidant can be used by diluting it with a suitable solvent so as to have a concentration of 0.01 to 2M. The solvent used in the reaction is not particularly limited as long as it does not participate in the reaction, and examples thereof include dichloromethane, acetonitrile, pyridine, or any mixed solvent thereof. The oxidation step may be performed after the aforementioned capping operation, or vice versa, the capping operation may be performed after the oxidation step, and the order is not limited.

[0250] The step of deprotecting the phosphate protecting group is to allow amines to act after the synthesis of the nucleic acid having the desired sequence is completed to deprotect the protecting group of the phosphate moiety. Examples of the amines include diethylamine described in Japanese Patent No. 4705716.

[0251] The protecting group of the 5' hydroxyl group of the nucleoside introduced at the end of the extension can be used for column purification using the 5' protecting group as a tag after cleavage from the solid phase support and deprotection of the protecting group as described below, or the protecting group of the 5' hydroxyl group can be deprotected after column purification.

[0252] Furthermore, using ammonia water or amines, the oligonucleotide chain is cleaved from the solid support and recovered, for example, as shown in the above-mentioned Scheme 2. Examples of amines include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0253] Examples of nucleic acid oligomers that can be prepared by the preparation method of the present invention include, but are not limited to, nucleic acid oligomers in which nucleosides contained in the nucleic acid oligomer are RNA, DNA, 2'-O-MOE, 2'-O-Me, 2'-F RNA, and LNA.

[0254] For example, various examples of nucleosides are described in Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600 by Xiulong, Shen et al. and Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 by Daniel O'Reilly et al.

[0255] As nucleic acid oligomers that can be prepared using the preparation method of the present invention, examples include, but are not limited to, nucleic acid oligomers in which the nucleosides contained in the nucleic acid oligomers are RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, 2'-F, and LNA. For example, various examples of nucleosides described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 can be cited.

[0256] Typical examples of the nucleic acid oligomer that can be used in the production method of the present invention include the following examples in addition to the examples described in the Examples, but are not limited thereto.

[0257] In the following description of sequences, U represents uridine, C represents cytidine, A represents adenosine, or G represents guanosine.

[0258] Examples include nucleic acid oligomers having the following sequences (B) and (C) described in International Publication No. 2019 / 060442.

[0259] Sequence (B): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (antisense) (SEQ ID NO: 3) 21mer

[0260] Sequence (C): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (positive sense) (SEQ ID NO: 4) 21mer

[0261] In sequences (B) and (C), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, and dT represents thymidine.

[0262] Examples include the nucleic acid oligomers described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, pp. 546-558 (see page 553). As a typical example, a nucleic acid oligomer having the following sequence (D) can be mentioned.

[0263] Sequence (D): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (SEQ ID NO: 5) 36mer

[0264] Examples include nucleic acid oligomers described in JP4965745. As a typical example, a nucleic acid oligomer having the following sequence (E) can be mentioned.

[0265] Sequence (E): 5'-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3'49mer. CCAUGAGAAGUAUGACAACAGCC (SEQ ID NO: 6), GGCUGUUGUCAUACUUCUCAUGGUU (SEQ ID NO: 7).

[0266] In the sequence (E), "P" is represented by the partial structure divided by wavy lines in the following formula (A5).

[0267] Examples include a nucleic acid oligomer having the following sequence (F) described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547.

[0268] Sequence (F): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (SEQ ID NO: 8) 67mer

[0269] Examples include a nucleic acid oligomer having the following sequence (G) described in JP 2015-523856, page 173.

[0270] Sequence (G): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (SEQ ID NO: 9) 94mer

[0271] Examples include nucleic acid oligomers described in JP 2017-537626. Typical examples include nucleic acid oligomers having the following sequences (F), (G), (H), and (J).

[0272] Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 10) 100mer

[0273] Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (SEQ ID NO: 11) 113mer

[0274] Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUUUUU-3' (serial number 12) 113mer

[0275] In the sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine.

[0276] Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsUmsU-3' (SEQ ID NO: 13) 113mer

[0277] In sequence (J), Um represents 2'-O-methyluridine, Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents phosphorothioate modification.

[0278] Example

[0279] Hereinafter, the present invention will be described in more detail using examples, but the present invention is not limited thereto.

[0280] Determination method

[0281] The respective measurement methods used in the following experiments are as follows.

[0282] (Measurement method 1: Method for measuring the purity of oligonucleotide)

[0283] The purity of the crude oligonucleotide product after solid phase synthesis was determined by HPLC. The crude product was separated into components by HPLC (wavelength 260 nm, chromatographic column ACQUITY UPLC Oligonucleotide BEH C18, 2.1 mm×100 mm, 1.7 μm), and the purity of the oligonucleotide was calculated based on the area value of the main product in the total area value of the obtained chromatogram.

[0284] The HPLC measurement conditions are shown in Table 1 below.

[0285] [Table 1]

[0286]

[0287] (Measurement method 2: measurement of oligonucleotide yield)

[0288] Determine the OD of the crude product 260 OD 260 It indicates the absorbance at UV260nm per 10mm pathlength in 1mL solution (pH=7.5). Generally, it is known that 1OD=40μg in RNA, so based on the above OD 260 The yield was calculated from the measured value of . Furthermore, the yield per unit volume of the solid phase carrier was calculated. For Examples 1 to 5 and Comparative Examples 1 and 2, the relative yield relative to the yield of Example 1 was determined.

[0289] (Measurement method 3: Measurement of oxygen concentration)

[0290] The oxygen concentration of the atmosphere (gas phase) of the reaction system was measured using PACKKEEPER (Residual Oxygen Meter) manufactured by IIJIMA ELECTRONICS CORP. Before measuring the oxygen concentration, the device was calibrated by measuring the oxygen concentration in air and pure nitrogen, and then the needle attached to the device was inserted into a container such as a flask covered with a septum to measure the oxygen concentration of the gas phase in the system. The measured value of the oxygen concentration was displayed in real time, and the value when the measured value was stable was taken as the oxygen concentration of the atmosphere.

[0291] Solid phase synthesis of oligonucleotides

[0292] Sequence (I): 5'-AGCAGAGUACACACAGCAUAUACC-P-GGUAUAUGCUGUGUGUACUCUGCUUC-PG-3' (SEQ ID NOs. 1, 2) 53mer

[0293] In the aforementioned sequence (I), "A" is represented by a local structure divided by a wavy line in the following formula (A1). "C" is represented by a local structure divided by a wavy line in the following formula (A2). "G" is represented by a local structure divided by a wavy line in the following formula (A3). U is represented by a local structure divided by a wavy line in the following formula (A4). "P" is represented by a local structure divided by a wavy line in the following formula (A5). It should be noted that the "A" at the 5' end is represented by a local structure divided by a wavy line in the following formula (A6). In addition, the "G" at the 3' end is represented by a local structure divided by a wavy line in the following formula (A7). Among them, the phosphate group in the structural formula can also be a salt.

[0294] AGCAGAGUAC ACACAGCAUA UACC (serial number 1)

[0295] GGUAUAUGCU GUGUGUACUC UGCUUC (serial number 2)

[0296] [Chemical formula 23]

[0297]

[0298] [Chemical formula 24]

[0299]

[0300] [Chemical formula 25]

[0301]

[0302] [Chemical formula 26]

[0303]

[0304] [Chemical formula 27]

[0305]

[0306] [Chemical formula 28]

[0307]

[0308] [Chemical formula 29]

[0309]

[0310] Using controlled porous glass (Controlled Pore Glass (CPG)) as a solid phase carrier, using AKTAoligopilot plus100 (manufactured by GE Healthcare) as a nucleic acid synthesizer, using phosphoramidite solid phase synthesis, an oligonucleotide consisting of the above sequence (I) is synthesized from the 3' end to the 5' end. The synthesis is implemented on a 78.20 μmol scale. In addition, adenosine PMM amide (compound (A8)), cytidine PMM amide (compound (A9)), guanosine PMM amide (compound (A10)), uridine PMM amide (compound (A11)) and compound (A12) recorded in International Publication No. 2017 / 188042 are used in the synthesis, and a high-purity trichloroacetic acid toluene solution is used as a deprotection solution, 5-benzylmercapto-1H-tetrazole is used as a condensing agent, an iodine solution is used as an oxidant, and a phenoxyacetic anhydride solution and an N-methylimidazole solution are used as a capping solution. After the nucleic acid extension is completed, a diethylamine solution is allowed to act on the nucleic acid on the carrier, thereby selectively deprotecting the cyanoethyl protecting group of the phosphate moiety. Here, PMM is an abbreviation for (((1-cyanopropane-2-yl)oxy)methoxy)methyl.

[0311] [Chemical formula 30]

[0312]

[0313] [Chemical formula 31]

[0314]

[0315] [Chemical formula 32]

[0316]

[0317] [Chemical formula 33]

[0318]

[0319] [Chemical formula 34]

[0320]

[0321] Next, a specific example of preparing an oligonucleotide (nucleic acid oligomer) prepared by the preparation method of the present invention is shown. Here, the oligonucleotide prepared by the preparation method of the present invention in the following examples is an oligonucleotide having the sequence (I) shown in the above sequence numbers 1 and 2.

[0322] The guanosine derivatives described in the following Examples and Comparative Examples are compounds represented by the following structural formula: The circle shown in the following structural formula schematically represents CPG.

[0323] [Chemical formula 35]

[0324]

[0325] (Example 1)

[0326] Using CPG loaded with 78.20 μmol of guanosine derivatives and amides shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), solid phase synthesis of sequence (I) was performed using AKTA oligopilot plus100. Then, a CPG carrier loaded with 16.46 μmol of oligonucleotide was collected, and the oligonucleotide was freed from the solid phase carrier using ammonia water. Next, the free oligonucleotide was dissolved in 6.6 mL of dimethyl sulfoxide, and then 1.97 μmol of the solution was collected in a 100 mL, 29 mm diameter eggplant-shaped flask, and 10.6 μL of nitromethane and a 15 mm diameter stirring bar were further added thereto, and then covered and sealed with a 29 mm diameter diaphragm. Further, the needle for spraying nitrogen from the nitrogen bottle into the system, the needle for removing the nitrogen sprayed into, and the measuring needle of Oxygen Meter are pierced into the diaphragm to circulate nitrogen, thereby replacing the system with nitrogen, and the oxygen concentration in the gas phase is set to 0%. Here, the oxygen concentration in the gas phase is measured by the method described in the aforementioned measuring method 3. Further, using the syringe pump of KDScientific company, under the stirring based on the stirrer, 1.10mL of dimethyl sulfoxide solution of 1M tetra-n-butylammonium fluoride (TBAF) (with respect to each 1 mol of protecting group, the amount of TBAF is 10.2 mol) of dehydration treatment was added dropwise to the surface of the oligonucleotide solution at 33°C for 1 hour, and the mixture was kept warm for 4 hours, thereby removing the protection of the 2'-PMM protecting group. The crude product was obtained by precipitation operation. The yield was 14.1mg, and the purity was 62%. The purity of the oligonucleotide of the obtained crude product was measured by the method described in the above-mentioned measurement method 1, and the yield of the oligonucleotide was measured by the method described in the above-mentioned measurement method 2.

[0327] (Example 2)

[0328] Using CPG loaded with 78.20 μmol of guanosine derivatives and amides shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), solid phase synthesis of sequence (I) was performed using AKTA oligopilot plus100. Then, a CPG carrier loaded with 19.91 μmol of oligonucleotide was collected, and the oligonucleotide was freed from the solid phase carrier using ammonia water. Next, the free oligonucleotide was dissolved in 8.0 mL of dimethyl sulfoxide, and then 3.03 μmol of the solution was collected in a 100 mL, 29 mm diameter eggplant-shaped flask, and 15.9 μL of nitromethane and a 15 mm diameter stirring bar were further added thereto, and then covered and sealed with a 29 mm diameter diaphragm. Further, the needle for spraying nitrogen from the nitrogen bottle into the system, the needle for removing the nitrogen sprayed into, and the measuring needle of Oxygen Meter are inserted into the diaphragm to circulate nitrogen, thereby replacing the system with nitrogen, and the oxygen concentration in the gas phase is set to 0%. The oxygen concentration in the gas phase is confirmed by measuring in the same manner as in Example 1. Further, using a syringe, 1.66mL of dimethyl sulfoxide solution of 1M tetra-n-butylammonium fluoride (TBAF) (with respect to 10.0 moles of TBAF per 1 mole of protecting group) of dehydration treatment was flowed into the surface of the oligonucleotide solution at 33°C under stirring based on a stirrer, and the mixture was kept warm for 4 hours, thereby removing the protection of the 2'-PMM protecting group. The crude product was obtained by precipitation operation. The yield was 21.7mg, and the purity was 60%. For the crude product obtained, the purity and yield of the oligonucleotide were measured in the same manner as in Example 1.

[0329] (Example 3)

[0330] Using CPG loaded with 78.20 μmol of guanosine derivatives and amides shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), solid phase synthesis of sequence (I) was performed using AKTA oligopilot plus100. Then, a CPG carrier loaded with 16.46 μmol of oligonucleotide was collected, and the oligonucleotide was freed from the solid phase carrier using ammonia water. Next, the free oligonucleotide was dissolved in 6.6 mL of dimethyl sulfoxide, and then 1.00 μmol of the solution was collected in a 100 mL eggplant flask with a diameter of 29 mm, and 5.3 μL of nitromethane and a stirrer with a diameter of 15 mm were further added thereto, and then covered and sealed with a 29 mm diaphragm. Further, the needle for spraying nitrogen from the nitrogen bottle into the system, the needle for removing the nitrogen sprayed into, and the measuring needle of Oxygen Meter are inserted into the diaphragm to circulate nitrogen, thereby replacing the system with nitrogen, and the oxygen concentration in the gas phase is set to 5%. The oxygen concentration in the gas phase is confirmed by measuring in the same manner as in Example 1. Further, using a syringe, 0.56mL of a dimethyl sulfoxide solution of 1M tetra-n-butylammonium fluoride (TBAF) (with respect to 10.2 moles of TBAF per 1 mole of protecting group) of dehydration treatment was flowed into the surface of the oligonucleotide solution at 33°C under stirring based on a stirrer, and the mixture was kept warm for 4 hours, thereby removing the protection of the 2'-PMM protecting group. The crude product was obtained by precipitation operation. The yield was 7.1mg, and the purity was 60%. For the crude product obtained, the purity and yield of the oligonucleotide were measured in the same manner as in Example 1.

[0331] (Example 4)

[0332] Using CPG loaded with 78.20 μmol of guanosine derivatives and amides shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), solid phase synthesis of sequence (I) was performed using AKTA oligopilot plus100. Then, a CPG carrier loaded with 16.46 μmol of oligonucleotide was collected, and the oligonucleotide was freed from the solid phase carrier using ammonia water. Next, the free oligonucleotide was dissolved in 6.6 mL of dimethyl sulfoxide, and then 0.98 μmol of the solution was collected in a 100 mL eggplant flask with a diameter of 29 mm. After further adding 5.3 μL of nitromethane and a stirring bar with a diameter of 15 mm, it was covered and sealed with a 29 mm diaphragm. Further, the needle for spraying nitrogen from the nitrogen bottle into the system, the needle for removing the nitrogen sprayed into, and the measuring needle of Oxygen Meter are inserted into the diaphragm to circulate nitrogen, thereby replacing the system with nitrogen, and the oxygen concentration in the gas phase is set to 10%. The oxygen concentration in the gas phase is confirmed by measuring in the same manner as in Example 1. Further, using a syringe, 0.56mL of a dimethyl sulfoxide solution of 1M tetra-n-butylammonium fluoride (TBAF) (with respect to 10.4 moles of TBAF per 1 mole of protecting group) of dehydration treatment was flowed into the surface of the oligonucleotide solution at 33°C under stirring based on a stirrer, and the mixture was kept warm for 4 hours, thereby removing the protection of the 2'-PMM protecting group. The crude product was obtained by precipitation operation. The yield was 6.9mg and the purity was 54%. For the crude product obtained, the purity and yield of the oligonucleotide were measured in the same manner as in Example 1.

[0333] (Example 5)

[0334] Using CPG loaded with 78.20 μmol of guanosine derivatives and amides shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), solid phase synthesis of sequence (I) was performed using AKTA oligopilot plus100. Then, a CPG carrier loaded with 16.46 μmol of oligonucleotide was collected, and the oligonucleotide was freed from the solid phase carrier using ammonia water. Next, the free oligonucleotide was dissolved in 6.6 mL of dimethyl sulfoxide, and then 1.00 μmol of the solution was collected in a 100 mL eggplant flask with a diameter of 29 mm, and 5.3 μL of nitromethane and a stirrer with a diameter of 15 mm were further added thereto, and then covered and sealed with a 29 mm diaphragm. Further, the needle for spraying nitrogen from the nitrogen bottle into the system, the needle for removing the nitrogen sprayed into, and the measuring needle of Oxygen Meter are inserted into the diaphragm to circulate nitrogen, thereby replacing the system with nitrogen, and the oxygen concentration in the gas phase is set to 15%. The oxygen concentration in the gas phase is confirmed by measuring in the same manner as in Example 1. Further, using a syringe, 0.56mL of a dimethyl sulfoxide solution of 1M tetra-n-butylammonium fluoride (TBAF) (with respect to 10.2 moles of TBAF per 1 mole of protecting group) of dehydration treatment was flowed into the surface of the oligonucleotide solution at 33°C under stirring based on a stirrer, and the mixture was kept warm for 4 hours, thereby removing the protection of the 2'-PMM protecting group. The crude product was obtained by precipitation operation. The yield was 7.1mg and the purity was 46%. For the crude product obtained, the purity and yield of the oligonucleotide were measured in the same manner as in Example 1.

[0335] (Reference Example 1)

[0336] Using CPG loaded with 78.20 μmol of guanosine derivatives and amides shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), solid phase synthesis of sequence (I) was performed using AKTA oligopilot plus100. Then, 19.91 μmol of the components were collected and the oligonucleotides were freed from the solid phase carrier using aqueous ammonia. Next, the free oligonucleotides were dissolved in 8.0 mL of dimethyl sulfoxide, and then 1.01 μmol of the components were collected in a 100 mL eggplant-shaped flask with a diameter of 29 mm. After further adding 5.3 μL of nitromethane and a stirring bar with a diameter of 15 mm, the mixture was covered and sealed with a 29 mm diaphragm. The measuring needle of the Oxygen Meter was inserted into the diaphragm, and the oxygen concentration in the gas phase in the system was measured in the same manner as in Example 1. The oxygen concentration was 21%. Further, using a syringe, under stirring based on a stirrer, 0.56 mL of a dimethyl sulfoxide solution of 1M tetra-n-butylammonium fluoride (TBAF) dehydrated using molecular sieve 4A was flowed into the surface of the oligonucleotide solution within 1 minute at 33°C (the amount of TBAF was 10.1 moles per 1 mole of protecting group), and the mixture was kept warm for 4 hours to thereby deprotect the 2'-PMM protecting group. A crude product was obtained by precipitation operation. The yield was 7.2 mg and the purity was 41%. For the crude product obtained, the purity and yield of the oligonucleotide were measured in the same manner as in Example 1.

[0337] (Reference Example 2)

[0338] Using CPG loaded with 78.20 μmol of guanosine derivatives and amides shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), solid phase synthesis of sequence (I) was performed using AKTA oligopilot plus100. Then, a CPG carrier loaded with 16.46 μmol of oligonucleotide was collected, and the oligonucleotide was freed from the solid phase carrier using aqueous ammonia. Next, the free oligonucleotide was dissolved in 6.6 mL of dimethyl sulfoxide, and then 1.96 μmol of the solution was collected in a 100 mL eggplant-shaped flask with a diameter of 29 mm. After further adding 10.6 μL of nitromethane and a stirring bar with a diameter of 15 mm, it was covered and sealed with a 29 mm diaphragm. The measuring needle of the Oxygen Meter was inserted into the diaphragm, and the oxygen concentration in the gas phase in the system was measured in the same manner as in Example 1. The result showed that the oxygen concentration was 21%. Further, using a syringe pump from KDScientific, 1.10 mL of a dimethyl sulfoxide solution of 1M tetra-n-butylammonium fluoride (TBAF) dehydrated using molecular sieve 4A was added dropwise to the surface of the oligonucleotide solution at 33°C under stirring with a stirrer for 1 hour (10.2 mol of TBAF per 1 mol of protecting group), and the mixture was incubated for 4 hours to remove the 2'-PMM protecting group. A crude product was obtained by precipitation operation. The yield was 14.2 mg and the purity was 47%. For the crude product obtained, the purity and yield of the oligonucleotide were measured in the same manner as in Example 1.

[0339] The measurement results are shown in Table 2 below.

[0340] [Table 2]

[0341]

[0342] As shown in Table 2 above, the deprotection reaction of the protecting group of the hydroxyl group of ribose contained in the oligonucleotide described in the specification was carried out in an inert gas atmosphere with an oxygen concentration of 15% or less. Compared with the case where the deprotection reaction was carried out at an oxygen concentration higher than 15%, the deprotection reaction was more efficiently carried out. Furthermore, by setting the time required for adding TBAF to 30 minutes or more, the deprotection reaction was further efficiently carried out. As a result, it can be seen that the purity of the generated deprotected oligonucleotide is high.

[0343] (Reference example)

[0344] Preparation of PMM amide

[0345] 1) Preparation of 3-hydroxybutyronitrile

[0346] [Chemical formula 36]

[0347]

[0348] Lithium hydroxide monohydrate (1.8 g, 42.8 mmol) was added to propylene oxide (12.4 g, 0.21 mol), cooled to 4°C, and trimethylsilyl cyanide (15.5 g, 0.15 mol) was slowly added dropwise. After the addition was completed and several tens of minutes had passed, the internal temperature rose to 35°C. Stir directly in an ice bath (internal temperature 5°C) for 30 minutes, stir at 10-15°C for 1 hour, and further stir at room temperature (25°C) for 30 minutes. Water (15 mL) was added to the reaction solution and stirred at room temperature for 30 minutes. Then, extraction with ether (50 mL × 3 times), washing with saturated brine, drying over anhydrous sodium sulfate, and distilling to remove the solvent, resulted in 10.6 g (yield 84%) of crude 3-hydroxybutyronitrile as a colorless transparent liquid.

[0349] 2) Preparation of PMM agent

[0350] [Chemical formula 37]

[0351]

[0352] Dissolve bis(methyl methylthio) ether (32.41 g, 0.234 mol, 2.0 eq.) in anhydrous THF (300 mL), add molecular sieve 4A (32 g) and stir for 10 minutes. The mixture is cooled to -50°C, trifluoromethanesulfonic acid (TfOH) (0.88 mL, 5.85 mmol, 0.05 eq.) and N-iodosuccinimide (NIS) (31.5 g, 0.140 mol, 1.2 eq.) are added, and crude 3-hydroxybutyronitrile (10 g, 0.117 mol) is added dropwise thereto, and stirred at -50 to -45°C for 2 hours. Saturated aqueous sodium sulfite solution (150 mL), saturated sodium bicarbonate (150 mL) and ethyl acetate (300 mL) are added to the reaction solution, and stirred at 0 to 10°C for 10 minutes. After separation, the organic layer was washed with saturated brine (150 mL), dried over anhydrous magnesium sulfate, and then distilled under reduced pressure to remove the solvent. The residue was purified by silica gel chromatography (hexane / AcOEt=10 / 1-5 / 1, silica 800 mL) to obtain 5.9 g (yield 28%) of a yellow liquid PMM agent. Purity analysis was performed using GC / FID, and the purity was 97.2%.

[0353] PMM agent

[0354] [Chemical formula 38]

[0355]

[0356] Light yellow transparent liquid

[0357] 1H-NMR(CDCl3): δ4.93-4.84(m,2H)4.75(s,2H)4.06-4.00(m,1H)2.57(t,2H),2.17(s,3H)1.35(d,3H)

[0358] In addition, the production method of bis(methylthiomethyl)ether is referred to JP-A-2016-50203.

[0359] 3) Preparation of PMM agent

[0360] [Chemical formula 39]

[0361]

[0362] Bismethylthiomethyl ether (7.45 g, 53.9 mmol), molecular sieve 4A (7.5 g) and THF (111 mL) were mixed and cooled (-60 to -55°C), and N-iodosuccinimide (NIS) (14.4 g, 1.19 eq), trifluoromethanesulfonic acid (TfOH) (143 μL, 0.030 eq) and 3-hydroxybutyronitrile (5.0 g, 1.09 eq) were added. After stirring at -50 to -45°C for 4 hours, triethylamine (5.1 mL) was added dropwise. The reaction vessel was immersed in a water bath to raise the temperature of the reaction solution to about 10°C, and the reaction solution was injected into a pre-prepared 10°C aqueous solution (sodium thiosulfate pentahydrate 21.8 g, sodium bicarbonate 7.7 g and water 165 mL). Ethyl acetate (50 mL) was added, stirred at 10-15°C for 30 minutes, filtered through diatomaceous earth (7.5 g) and separated, the organic layer was washed with saturated brine (30 mL), dried over magnesium sulfate (3.8 g), and concentrated with a rotary evaporator to obtain 11.5 g of a crude product (11.5 g, GC purity 49.8%). Purification was performed using a silica gel column (silica gel 300 mL, hexane / ethyl acetate = 10 / 1) to obtain 3-((methylthiomethoxy)methoxy)butyronitrile (light yellow transparent liquid, 5.32 g, yield 56%, purity 99.5%).

[0363] 4) Preparation of amide

[0364] The following is an example of producing PMM amide U in which the nucleic acid base portion is uracil. PMM amides having a nucleic acid base other than uracil can also be produced by the same method.

[0365] [Chemical formula 40]

[0366]

[0367] TIPS-U (20.0 g), THF (40 ml) and toluene (60 ml) were added to the container, concentrated to 74 ml and dehydrated. The reaction solution was cooled to -50°C, and a PMM agent (10.80 g), TfOH (12.48 g), and NIS (12.4 g) / THF (26 ml) solution were added dropwise. After stirring at -50°C for 2 hours, the reaction solution was poured into an ice-cooled sodium bicarbonate (7.0 g)·sodium thiosulfate (20.0 g) / water (130 ml) solution and separated at room temperature. Then, it was washed with a sodium bicarbonate (3.5 g)·sodium thiosulfate (10.0 g) / water (65 ml) solution. The organic layer was concentrated to obtain a crude product containing the target compound. Exact mass: 613.3, Actual mass: 612.3 (ESI (-))

[0368] [Chemical formula 41]

[0369]

[0370] The crude PMM-U-1 was dissolved in acetone (40 mL), triethylamine trihydrofluoride (7.28 g) was added and stirred at 20°C for 18 hours. The reaction solution was added to tert-butyl methyl ether (200 ml) and stirred for 30 minutes. The reaction solution was filtered, and the solid remaining on the filter paper was washed with tert-butyl methyl ether (40 ml). The obtained precipitate was filtered and dried under reduced pressure to obtain a crude product containing the target compound (14.56 g). Exact mass: 371.1, actual mass: 370.2 (ESI (-))

[0371] [Chemical formula 42]

[0372]

[0373] Add the aforementioned crude PMM-U-2 (14.5 g), pyridine (72.5 ml), acetonitrile (29 ml) and toluene (72.5 ml) and ice-cool. Add 4,4'-dimethoxytrityl chloride (15.86 g) to the mixture and stir at room temperature for 4 hours. Then, add methanol (7.2 ml) and toluene (29 ml), wash twice with 5% aqueous sodium bicarbonate solution (43.5 ml) and once with 10% aqueous sodium chloride solution (43.5 ml). Then, concentrate the organic layer. Purify the concentrate by silica gel column chromatography to obtain the target substance (21.12 g). Exact mass: 673.3, actual mass: 672.3 (ESI (-))

[0374] [Chemical formula 43]

[0375]

[0376] PMM-U-3 (20.0 g), acetonitrile (60 ml), diisopropylammonium tetrazolium salt (5.88 g), and 2-cyanoethyl-N,N,N',N'-tetraisopropylphosphorodiamidite (10.75 g) were added and stirred at 35°C for 4 hours. Toluene (200 ml) was added to the reaction solution, and the mixture was washed once with a 5% sodium bicarbonate aqueous solution (100 ml), washed 5 times with a 50% DMF aqueous solution (200 ml), washed twice with water (100 ml), and washed once with a 10% sodium chloride aqueous solution (100 ml). Then, the organic layer was concentrated and purified by silica gel column chromatography to obtain the target substance (22.72 g).

[0377] The present invention provides a method for producing an efficient nucleic acid oligomer. It is expected that the purity of the nucleic acid oligomer prepared by the method for producing a nucleic acid oligomer will be improved.

[0378] [Sequence Listing Free Text]

[0379] Sequence numbers 1 to 13 in the sequence listing represent base sequences of oligonucleotides prepared according to the production method of the present invention.

Claims

1. A method for producing a nucleic acid oligomer represented by formula (4), characterized in that: In an inert gas atmosphere having an oxygen concentration of 10% or less, the nucleic acid oligomer represented by formula (3) is brought into contact with fluoride ions, In formula (3), G 4 represents a protecting group for a hydrogen atom or a hydroxyl group, G 5 represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion or a hydroxyalkylammonium ion, B C are the same or different from each other, and each independently represents the following structure, In the above formula, R 4’ represents a hydrogen atom or a methyl group, R 5’ represents a hydrogen atom or an acetyl group, R 6’ represents a hydrogen atom, R 8’ represents a hydrogen atom or a methyl group, R is the same or different from each other and each independently represents a hydrogen atom, a fluorine atom or an OQ group; Q is the same or different from each other and each independently represents a tert-butyldimethylsilyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, an ethylidene group bonded to the carbon atom at the 4' position of ribose, or a protecting group of formula (1); In formula (1), R a and R b are the same or different from each other, representing a methyl group, an ethyl group or a hydrogen atom, The bond marked with * indicates the bond with the oxygen atom of the OQ group. n represents 1, Among them, R a and R b Not all hydrogen atoms are represented at the same time. Y are the same or different from each other and each independently represents an oxygen atom or a sulfur atom, m represents any integer from 2 to 200, W is a hydroxyl group, X is an R group, At least one of R and X represents a hydroxyl group protected by a protecting group of formula (1), and When m is an integer greater than 3, the nucleic acid oligomer represented by formula (3) is a nucleic acid oligomer in which a non-nucleotide linker is incorporated instead of p nucleotides between the nucleotides at the 5' end and the 3' end, wherein p is a positive integer satisfying the formula: m-1>p; In formula (4), R' is the same as or different from each other, and each independently represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, Q' are the same or different from each other, and each independently represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position, or an ethylidene group bonded to the carbon atom at the 4' position, The substituent G of formula (4) 4 , G 5 , Y, B c and m are defined as in formula (3), W0 is a hydroxyl group, X0 is the same as the definition of the R' group, When m is an integer greater than 3, the nucleic acid oligomer represented by formula (4) is a nucleic acid oligomer in which a non-nucleotide linker is incorporated instead of p nucleotides between the nucleotides at the 5' end and the 3' end, wherein p is a positive integer satisfying the formula: m-1>p, The reaction temperature of the reaction of bringing the nucleic acid oligomer represented by formula (3) into contact with fluoride ions is 10° C. to 45° C., The inert gas is at least one of nitrogen, argon, helium or carbon dioxide. The non-nucleotide linker is a linker having a structure of the following formula (A14-1), (A14-2) or (A14-3), In formula (A14-1), (A14-2), and (A14-3), 5' and 3' represent the 5' terminal side and 3' terminal side of the nucleic acid oligomer, respectively. The fluoride ion source of the fluoride ion is tetraalkylammonium fluoride, and the tetraalkylammonium fluoride is tetra-n-butylammonium fluoride (TBAF).

2. The manufacturing method according to claim 1, wherein: The reaction is carried out in an inert gas atmosphere having an oxygen concentration of 5% or less.

3. The manufacturing method according to claim 1, wherein: The reaction was carried out in an inert gas atmosphere with an oxygen concentration of 0%.

4. The manufacturing method according to claim 1, wherein: The time required to add the entire amount of fluoride ions to the nucleic acid oligomer represented by formula (3) is 30 minutes or more.

5. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 5% or more.

6. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 10% or more.

7. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 20% or more.

8. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 30% or more.

9. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 40% or more.

10. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 50% or more.

11. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 60% or more.

12. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 70% or more.

13. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 80% or more.

14. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 90% or more.

15. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 95% or more.

16. The manufacturing method according to claim 1, wherein: Among R and X in the nucleic acid oligomer represented by formula (3), the ratio of the protecting group of formula (1) is 100%.

Images