A method for encoding oligonucleotide spatial coordinates and a microfluidic device thereof

Abstract

The present invention relates to an oligonucleotide spatial coordinate encoding method and a microfluidic device thereof, and belongs to the technical field of molecular biology. The present invention provides an oligonucleotide spatial coordinate encoding method, wherein the full oligonucleotide sequence to be encoded is preset to be formed by connecting n+i segments of oligonucleotide sequence fragments, and according to this preset, n groups of different oligonucleotide sequence fragments X and i groups of different oligonucleotide sequence fragments Y are synthesized; an oligonucleotide synthesis array formed by orthogonal arrangement of an X flow channel and a Y flow channel is set, so that the intersection of the X flow channel and the Y flow channel forms a coding region for the connection of the oligonucleotide sequence fragments; oligonucleotide sequence fragments X and oligonucleotide sequence fragments Y are applied to each X flow channel and Y flow channel of the oligonucleotide synthesis array in turn, so that the oligonucleotide sequence fragments X and the oligonucleotide sequence fragments Y are gradually connected in the coding region to obtain the full oligonucleotide sequence to be encoded. The method greatly reduces the synthesis cost of oligonucleotides.

Description

Technical Field

[0001] The invention relates to an oligonucleotide spatial coordinate encoding method and a microfluidic device thereof, belonging to the technical field of molecular biology. Background Art

[0002] The analysis of spatial bioinformatics of cells in tissues is crucial to disciplines such as oncology, immunology, neuroscience, genetic development, and pathology. For example, tumor heterogeneity, tumor microenvironment, and tumor metastasis in oncology; embryonic development, organ development maps in genetic development, and the various cell layers of the brain in neuroscience, as well as the anatomical characteristics of normal and abnormal parts of the brain. Spatial bioinformatics analysis can be achieved with the help of spatial coding, that is, constructing a unique code at each point in two-dimensional space, marking the sample to be tested through coding, and then decoding to achieve spatial bioinformatics analysis.

[0003] Oligonucleotides are composed of nucleotides carrying four bases of ATCG. The sequence of the bases can be combined to achieve up to 4 n There are coding combinations that can be used for spatial coding. At present, thanks to the progress of DNA artificial synthesis technology, high-throughput and low-cost in vitro synthesis of oligonucleotides has been achieved. However, it is still technically difficult to construct oligonucleotide arrays of known sequences in two-dimensional space. At present, the main strategies for constructing oligonucleotide arrays of known sequences in two-dimensional space and their existing defects are as follows:

[0004] 1. Synthesize first and then fix: that is, first synthesize a large number of oligonucleotide fragments with known sequences, then introduce the oligonucleotide fragments with known sequences into the target positions of the substrate in sequence according to the required spatial arrangement, and then connect and fix them to form an oligonucleotide array; this method is limited by the size of the spotting droplets, the spatial resolution is generally greater than 50 microns, and the cost increases significantly as the number of coding points increases;

[0005] 2. In situ synthesis: that is, the required oligonucleotide array is chemically synthesized in situ on a two-dimensional substrate; the key technology of this method is the selective introduction of ATCG raw materials, which can be achieved through photolithography, inkjet printing, movable type printing and other technologies. It has the advantage of high spatial resolution (10-60 microns), but is limited by the chemical reaction efficiency of DNA synthesis. The length of the code connected by this method is limited (generally not more than 20bp, the maximum length is 60bp), and the density and purity of the oligonucleotides in the coding point are low;

[0006] 3. Random fixation and sequencing: that is, first synthesize all the required coding sequences, mix them to form a primer pool, then add them randomly and connect them on a two-dimensional substrate at one time, and then read the coding information by in situ sequencing to determine the coding sequence information connected to each spatial position; although this method can construct an oligo array with high spatial resolution and long coding sequences, both the initial primer pool synthesis and the subsequent sequencing result in high costs and difficulty in mass production.

[0007] Therefore, there is an urgent need to find oligonucleotide synthesis technology with high spatial resolution, long coding sequence and low cost to construct oligonucleotide arrays of known sequence in two-dimensional space, thereby promoting the further development of spatial coding technology. Summary of the invention

[0008] To solve the above problems, the present invention provides an oligonucleotide spatial coordinate encoding method, the method comprising the following steps:

[0009] Step 1: presuppose that the full oligonucleotide sequence to be encoded is composed of n+i oligonucleotide sequence fragments connected, and based on this presupposition, synthesize n groups of different oligonucleotide sequence fragments X and i groups of different oligonucleotide sequence fragments Y;

[0010] Step 2: setting an oligonucleotide synthesis array formed by orthogonally setting an X channel and a Y channel, so that the intersection of the X channel and the Y channel forms a coding region for connecting the oligonucleotide sequence fragments;

[0011] Step 3: applying oligonucleotide sequence fragment X and oligonucleotide sequence fragment Y to each X channel and Y channel of the oligonucleotide synthesis array in turn, respectively, so that the oligonucleotide sequence fragment X and the oligonucleotide sequence fragment Y are gradually connected in the coding region to obtain the full sequence of the oligonucleotide to be encoded;

[0012] The number of X channels is n; the number of Y channels is i; when applying oligonucleotide sequence fragment X and oligonucleotide sequence fragment Y in rounds, the same oligonucleotide sequence fragment is applied to the coding region in the same channel, and different oligonucleotide sequence fragments are applied to the coding region in different channels, so that multiple rows can be encoded in each round.

[0013] The present invention also provides a microfluidic device for oligonucleotide synthesis, the microfluidic device comprising a first microfluidic chip and a second microfluidic chip; the first microfluidic chip is provided with a plurality of X flow channels; the second microfluidic chip is provided with a plurality of Y flow channels; the X flow channels and the Y flow channels are orthogonally arranged; the intersection of the X flow channels and the Y flow channels forms a coding region.

[0014] In one embodiment of the present invention, the microfluidic device includes a first microfluidic module and a second microfluidic module; the first microfluidic module is provided with a first substrate, a first encoding chip, a first microfluidic chip, a first injection adapter plate and a first upper fixed plate in order from bottom to top; the first microfluidic chip is provided with a plurality of first injection ports and a plurality of first outlet ports; the first injection ports are arranged in pairs, and a pair of first injection ports are connected through an X flow channel; the first outlet ports are arranged in pairs, and a pair of first outlet ports are connected through an X flow channel; the first injection adapter plate is provided with a plurality of first sample inlets and a plurality of first sample outlets; the first sample inlet corresponds to the first injection port one-to-one; the first sample outlet corresponds to the first outlet one-to-one; the first upper fixed plate is provided with a plurality of first openings; the first opening is at least connected to one first sample inlet or one first sample outlet The first microfluidic module is provided with a second substrate, a second coding chip, a second microfluidic chip, a second injection adapter plate and a second upper fixed plate from bottom to top; the second microfluidic chip is provided with a plurality of second injection ports and a plurality of second outlet ports; the second injection ports are arranged in pairs, and a pair of second injection ports are connected through a Y flow channel; the second outlet ports are arranged in pairs, and a pair of second outlet ports are connected through a Y flow channel; the second injection adapter plate is provided with a plurality of second sample inlets and a plurality of second sample outlets; the second sample inlets correspond to the second injection ports one-to-one; the second sample outlet corresponds to the second outlet one-to-one; the second upper fixed plate is provided with a plurality of second openings; the second opening is connected with at least one second sample inlet or second sample outlet; the second opening is provided with a second sealing cover plate.

[0015] In one embodiment of the present invention, a coding photographing area is provided on the first coding chip and / or the second coding chip.

[0016] In one embodiment of the present invention, the coding photographing area is arranged at the center position of the first coding chip and / or the second coding chip.

[0017] In one embodiment of the present invention, a first sealing ring is provided between the first sealing cover plate and the first opening.

[0018] In one embodiment of the present invention, a second sealing ring is provided between the second sealing cover plate and the second opening.

[0019] In one embodiment of the present invention, the first base and the first upper fixing plate are fixed by bolts.

[0020] In one embodiment of the present invention, the second base and the second upper fixing plate are fixed by bolts.

[0021] In one embodiment of the present invention, the first microfluidic chip, the first injection adapter plate, the first upper fixing plate, the second microfluidic chip, the second injection adapter plate and the second upper fixing plate are made of light-transmitting materials.

[0022] In one embodiment of the present invention, the first microfluidic chip, the first injection adapter plate, the first upper fixing plate, the second microfluidic chip, the second injection adapter plate and the second upper fixing plate are made of flexible light-transmitting materials.

[0023] The present invention also provides a method for synthesizing oligonucleotides, wherein the method uses the above oligonucleotide spatial coordinate encoding method to synthesize oligonucleotides on the above microfluidic device for oligonucleotide synthesis.

[0024] The present invention also provides the application of the above oligonucleotide spatial coordinate encoding method or the above microfluidic device for oligonucleotide synthesis or the above method for synthesizing oligonucleotide in oligonucleotide synthesis.

[0025] The technical solution of the present invention has the following advantages:

[0026] 1. The present invention provides an oligonucleotide spatial coordinate encoding method, the method comprising: first presetting the full oligonucleotide sequence to be encoded as being formed by connecting n+i oligonucleotide sequence fragments, and synthesizing n groups of different oligonucleotide sequence fragments X and i groups of different oligonucleotide sequence fragments Y according to the presetting, and then setting an oligonucleotide synthesis array formed by orthogonally setting an X flow channel and a Y flow channel, so that the intersection of the X flow channel and the Y flow channel forms a coding region for connecting the oligonucleotide sequence fragments, and finally applying the oligonucleotide sequence fragment X and the oligonucleotide sequence fragment Y to each X flow channel and the Y flow channel of the oligonucleotide synthesis array in rounds, respectively, so that the oligonucleotide sequence fragment X and the oligonucleotide sequence fragment Y are gradually connected in the coding region to obtain the full oligonucleotide sequence to be encoded, wherein the number of X flow channels is n, the number of Y flow channels is i, and when applying the oligonucleotide sequence fragment X and the oligonucleotide sequence fragment Y in rounds, the same oligonucleotide sequence fragment is applied to the coding region in the same flow channel, and different oligonucleotide sequence fragments are applied to the coding region in different flow channels, so that multiple rows can be encoded in each round. The method splits a full sequence of oligonucleotides to be encoded into multiple segments for synthesis and connection. Through multiple microfluidic selection area connection reactions, it is ensured that at least one segment of the coding sequence in each coding region is different, thereby ensuring that the coding sequence of each site of the final combined coding sequence is different. The method uses a parallel linear microfluidic channel array to locate the coding region. The same channel applies the same oligonucleotide sequence fragment to the flow-through area, and different channels apply different oligonucleotide sequence fragments. Each round can encode multiple rows. In order to complete the dot matrix encoding, the method will perform multiple rounds of encoding application and connection through the microfluidic channel. The direction or angle of each round of microfluidic channels is different, ensuring that for different coding regions, the applied oligonucleotide sequence fragments are different in at least one round. Therefore, assuming that the number of encoding rounds is q, the number of microfluidics in each round is p (that is, the number of coding sequences applied in each round is p), it is only necessary to synthesize p×q oligonucleotide sequence fragments to complete p. q ×4 m Compared with the traditional coding method, the number of synthesized oligonucleotide sequence fragments required to achieve the same coding number is reduced by p q-1 / q times, greatly reducing the synthesis cost of oligonucleotides.

[0027] 2. The present invention provides a microfluidic device for oligonucleotide synthesis, the microfluidic device comprising a first microfluidic chip and a second microfluidic chip, the first microfluidic chip is provided with a plurality of X channels, the second microfluidic chip is provided with a plurality of X channels, the X channels and the Y channels are arranged orthogonally, and the intersection of the X channels and the Y channels forms a coding region. The microfluidic device adopts an independent parallel microfluidic channel design (X channel + Y channel), combined with a detachable pressure-sealed assembly module (substrate + coding chip + microfluidic chip + injection adapter plate + upper fixed plate), which can realize parallel addition of oligonucleotide sequence fragments, as well as multiple addition, positioning and connection of oligonucleotide sequence fragments. The microfluidic device can regulate the density of the oligonucleotide coding array through the microfluidic channel size design. The upper fixed plate, injection adapter plate, and microfluidic chip of the microfluidic device must all be made of light-transmitting materials, so as to facilitate optical photography in the coding photographing area of ​​the coding chip and obtain optical information. The sample injection adapter plate and the microfluidic chip of the microfluidic device are both made of flexible light-transmitting materials such as PDMS, which is conducive to improving the sealing effect of the detachable pressure sealing assembly module.

[0028] 3. The present invention provides a method for synthesizing oligonucleotides, wherein the method uses the above-mentioned oligonucleotide spatial coordinate encoding method to synthesize oligonucleotides on the above-mentioned microfluidic device for oligonucleotide synthesis. The method adopts a stepwise connection method, first preparing the required oligonucleotide sequence fragments and modifications by a standard oligonucleotide synthesis method, and then sequentially connecting the required oligonucleotide sequence fragments to the target position by chemical connection and enzyme connection and other connection methods combined with a microfluidic device to obtain a sequence-determined oligonucleotide encoding array, and the obtained oligonucleotide sequence is long in length and high in purity. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 : Schematic diagram of the process of oligonucleotide synthesis.

[0030] Figure 2 : Schematic diagram of the flow channel structure of the first microfluidic chip and the second microfluidic chip in the microfluidic device.

[0031] Figure 3 : Cross-sectional view of the first microfluidic module and the second microfluidic module in the microfluidic device.

[0032] Figure 4 : Schematic diagram of the overall structure of the first microfluidic module and the second microfluidic module in the microfluidic device.

[0033] Figure 5 : Top view of the first microfluidic chip in the microfluidic device.

[0034] Figure 6 : Top view of the second microfluidic chip in the microfluidic device.

[0035] Figure 7 : Top view of the first encoding chip and the second encoding chip in the microfluidic device.

[0036] Figure 8 : A top view of the first injection adapter plate and the second injection adapter plate in the microfluidic device.

[0037] Fig. 9 : A top view of the first microfluidic module and the second microfluidic module in the microfluidic device.

[0038] Fig.10 : Schematic diagram of the overall structure of the first upper fixing plate and the second upper fixing plate in the microfluidic device.

[0039] Fig.11 : Schematic diagram of the overall structure of the first sealing ring and the second sealing ring in the microfluidic device.

[0040] Fig.12 : Schematic diagram of the overall structure of the first sealing cover plate and the second sealing cover plate in the microfluidic device.

[0041] Fig.13 :The synthesis process of oligonucleotides.

[0042] Fig.14 : Results of oligonucleotide synthesis of local coding regions.

[0043] Figure 2 to Figure 12 In the figure, the first microfluidic module 1, the second microfluidic module 2, the first substrate 3, the first coding chip 4, the first microfluidic chip 5, the first injection adapter plate 6, the first upper fixed plate 7, the first injection port 8, the first sample outlet 9, the X flow channel 10, the first sample inlet 11, the first sample outlet 12, the first opening 13, the first sealing cover plate 14, the second substrate 15, the second coding chip 16, the second microfluidic chip 17, the second injection adapter plate 18, the second upper fixed plate 19, the second injection port 20, the second sample outlet 21, the Y flow channel 22, the coding area 23, the second sample inlet 24, the second sample outlet 25, the second opening 26, the second sealing cover plate 27, the coding photographing area 28, the first sealing ring 29 and the second sealing ring 30. DETAILED DESCRIPTION

[0044] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0045] If no specific experimental steps or conditions are specified in the following examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be purchased commercially.

[0046] Example 1: A method for encoding oligonucleotide spatial coordinates

[0047] This embodiment provides a method for encoding oligonucleotide spatial coordinates (the process of synthesizing oligonucleotides using this method is shown in Figure 1 ), the method comprising the steps of:

[0048] Step 1: presuppose that the full oligonucleotide sequence to be encoded is composed of n+i oligonucleotide sequence fragments connected, and based on this presupposition, synthesize n groups of different oligonucleotide sequence fragments X and i groups of different oligonucleotide sequence fragments Y;

[0049] Step 2: setting an oligonucleotide synthesis array formed by orthogonally setting an X channel and a Y channel, so that the intersection of the X channel and the Y channel forms a coding region for connecting the oligonucleotide sequence fragments;

[0050] Step 3: applying oligonucleotide sequence fragment X and oligonucleotide sequence fragment Y to each X channel and Y channel of the oligonucleotide synthesis array in turn, respectively, so that the oligonucleotide sequence fragment X and the oligonucleotide sequence fragment Y are gradually connected in the coding region to obtain the full sequence of the oligonucleotide to be encoded;

[0051] The number of X channels is n; the number of Y channels is i; when applying oligonucleotide sequence fragment X and oligonucleotide sequence fragment Y in rounds, the same oligonucleotide sequence fragment is applied to the coding region in the same channel, and different oligonucleotide sequence fragments are applied to the coding region in different channels, so that multiple rows can be encoded in each round.

[0052] Example 2: A microfluidic device

[0053] like Figure 2 to Figure 12 As shown, this embodiment provides a microfluidic device for implementing the oligonucleotide spatial coordinate encoding method described in Example 1 (the process of synthesizing oligonucleotides using this device is shown in Figure 1), the microfluidic device is composed of a first microfluidic module 1 and a second microfluidic module 2; the first microfluidic module 1 is provided with a first substrate 3, a first encoding chip 4, a first microfluidic chip 5, a first injection adapter plate 6 and a first upper fixing plate 7 from bottom to top; the first microfluidic chip 5 is provided with a plurality of first injection ports 8, a plurality of first outlet ports 9 and a plurality of X flow channels 10; the first injection ports 9 are arranged in pairs, and a pair of first injection ports 9 are connected through the X flow channel 10; the first outlet ports 9 are arranged in pairs, and a pair of first outlet ports 9 are connected through the X flow channel 10; the first injection adapter plate 6 is provided with a plurality of first sample inlets 11 and a plurality of first sample outlets 12; the first sample inlet 11 and the first injection port 8 are connected to each other; One-to-one correspondence; the first sample outlet 12 corresponds to the first sample outlet 9 one-to-one; a plurality of first openings 13 are provided on the first upper fixed plate 7; the first opening 13 is connected to at least one first sample inlet 11 or the first sample outlet 12; a first sealing cover plate 14 is provided on the first opening 13; the second microfluidic module 2 is provided with a second substrate 15, a second encoding chip 16, a second microfluidic chip 17, a second injection adapter plate 18 and a second upper fixed plate 19 from bottom to top; the second microfluidic chip 17 is provided with a plurality of second injection ports 20, a plurality of second sample outlets 21 and a plurality of Y flow channels 22; the second injection ports 20 are arranged in pairs, and a pair of second injection ports 20 are connected through a Y flow channel 22; the second sample outlet The ports 21 are arranged in pairs, and a pair of second sample outlets 21 are connected through a Y channel 22; the X channel 10 and the Y channel 22 are arranged orthogonally; the intersection of the X channel 10 and the Y channel 22 forms a coding area 23; the second sample inlet adapter plate 18 is provided with a plurality of second sample inlets 24 and a plurality of second sample outlets 25; the second sample inlets 24 correspond to the second sample inlets 20 one by one; the second sample outlets 25 correspond to the second sample outlets 21 one by one; the second upper fixing plate 19 is provided with a plurality of second openings 26; the second openings 26 are connected to at least one second sample inlet 24 or the second sample outlet 25; a second sealing cover plate 27 is provided on the second opening 26; the first coding chip 4 and the second coding chip 1 6 is provided with a coding photographing area 28; the coding photographing area 28 is arranged at the center of the first coding chip 4 and the second coding chip 16; a first sealing ring 29 is provided between the first sealing cover plate 14 and the first opening 13; a second sealing ring 30 is provided between the second sealing cover plate 27 and the second opening 26; the first substrate 3 and the first upper fixing plate 7 are fixed by bolts (such as M3, M4, etc.); the second substrate 15 and the second upper fixing plate 19 are fixed by bolts; the first microfluidic chip 5, the first sample injection adapter plate 6, the first upper fixing plate 7, the second microfluidic chip 17, the second sample injection adapter plate 18 and the second upper fixing plate 19 are made of flexible light-transmitting materials (such as fluororubber, chloroprene rubber, PDMS, etc.).

[0054] Preferably, the width of the X flow channel and the Y flow channel is 2 μm to 200 μm; the center distance between the X flow channel and the Y flow channel is 4 μm to 500 μm; the height of the X flow channel and the Y flow channel is 2 μm to 200 μm; the number of the first inlet, the first outlet, the first sample inlet, the first sample outlet, the second inlet, the second outlet, the second sample inlet and the second sample outlet is 12 to 240, and the aperture is 0.5 mm to 5.0 mm; the length of the bolt is 3 mm to 12 mm.

[0055] Example 3: A method for synthesizing oligonucleotides

[0056] The present embodiment provides a method for synthesizing oligonucleotides, wherein the method uses the oligonucleotide spatial coordinate encoding method of embodiment 1 to synthesize oligonucleotides on the microfluidic device for oligonucleotide synthesis of embodiment 2, wherein the synthesis target is an oligonucleotide with a nucleotide sequence such as that shown in SEQ ID NO:1 (AAGCAGTGGTATCAACGCAGAGTACGTCTCTTTCCCTACACACGACGCTCTTCCGATCTNNNNNNNNNNNNGAGTGATTGCTTGTGACGCCTTNNNNNNNNNNNNNNNNNNNNNNNNT30VN), and firstly, according to the oligonucleotide spatial coordinate encoding method of embodiment 1, an oligonucleotide with a nucleotide sequence such as that shown in SEQ ID NO:1 is prepared by connecting oligo1, oligo2 and oligo3, wherein oligo1 is a nucleotide sequence such as that shown in SEQ ID NO:1. NO:2 (TTAAGCAGTGGTATCAACGCAGAGTACGTCTCTTTCCCTACAC), oligo2 and oligo3 are coding sequences, respectively including 4 groups (i.e., n=4) of different oligonucleotide sequence fragments X and 4 groups (i.e., i=4) of different oligonucleotide sequence fragments Y, and according to this preset, 4 groups of different oligonucleotide sequence fragments X1-X4 (nucleotide sequences are shown in SEQ ID NO:3-SEQ ID NO:6, ACGACGCTCTTCCGATCTGCTTACGCAGGAGTGATTGC, ACGACGCTCTTCCGATCTCTACAGAGCGGAGTGATTGC, ACGACGCTCTTCCGATCTGATCTGGTCCGAGTGATTGC, ACGACGCTCTTCCGATCTTACAGCGTTAGAGTGATTGC) and 4 groups of different oligonucleotide sequence fragments Y1-Y4 (nucleotide sequences are shown in SEQ ID NO:7-SEQ ID NO:10, TTGTGACGCCTTCCGATTGGATNNNNNNNNNNNNT30VN, TTGTGACGCCTTAGGCCTCATANNNNNNNNNNNNNNT30VN, TTGTGACGCCTTTTGTACGGCCNNNNNNNNNNNNNT30VN, TTGTGACGCCTTTACTATCGGANNNNNNNNNNNNNNT30VN), and then the microfluidic device for oligonucleotide synthesis of Example 2 was used to connect the oligonucleotides (the connection process is shown in Fig.13 ), the specific steps are as follows:

[0057] 1. Prepare the substrate, perform surface treatment on the substrate, and then connect the universal head sequence Oligo1;

[0058] 2. Constructing X-direction microfluidic channels on the substrate;

[0059] 3. Apply Oligo2 coding sequence by pumping the microchannel in the X direction with a positive pressure pump, and connect the oligonucleotide sequence fragment X1 to the head sequence through a ligation reaction;

[0060] 4. Dismantle the X-direction microfluidic channel and reconstruct a new Y-direction microfluidic channel. The fluid direction of the new microfluidic channel is arranged in an orthogonal direction to the previous microfluidic channel (the first microfluidic module and the second microfluidic module share a substrate, and the X-direction microfluidic channel and the Y-direction microfluidic channel are dismantled and reconstructed on the same substrate by bolts);

[0061] 5. Apply the Oligo3 coding sequence through the microfluidic channel, and connect the oligonucleotide sequence fragment Y1 to the oligonucleotide sequence fragment X1 through a ligation reaction;

[0062] 6. Repeat steps 4 and 5 until the required number of encoding rounds is reached, and then disassemble the microchannel to obtain the Oligo encoding array on the substrate;

[0063] Among them, Oligo1, Oligo2 and Oligo3 were commissioned to be synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. The reagent used for oligonucleotide ligation was T4 DNALigase (Novozyme, Cat. No. N103-01), and the oligonucleotide ligation was performed at room temperature (25°C);

[0064] The specific parameters of the microfluidic device for oligonucleotide synthesis of Example 2 are as follows: the width of the X flow channel and the Y flow channel is 50 μm; the center distance between the X flow channel and the Y flow channel is 100 μm; the height of the X flow channel and the Y flow channel is 50 μm; the number of the first inlet, the first outlet, the first sample inlet, the first sample outlet, the second inlet, the second outlet, the second sample inlet and the second sample outlet is 48, and the aperture is 1.0 mm; the first microfluidic chip, the first injection adapter plate, the first upper fixing plate, the second microfluidic chip, the second injection adapter plate and the second upper fixing plate are made of PDMS material; the bolts are M4, and the length is 8 mm.

[0065] During the synthesis of oligonucleotides, four oligonucleotide sequence fragments X and four oligonucleotide sequence fragments Y are passed through the X channel and the Y channel respectively. Theoretically, there are 16 hybridization points with clear boundaries. Therefore, after the fluorescent hybridization probe is passed through the Y channel, the local coding photographing area after the oligonucleotide synthesis (i.e., one-half coding photographing area) is photographed by confocal microscope. The observation results are shown in Fig.14 .Depend on Fig.14 It can be seen that the confocal microscope captured 8 hybridization points with clear boundaries in the local coding photographing area after oligonucleotide synthesis, and the results were in line with expectations.

[0066] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention. Sequence Listing <110> Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences <120> A method for encoding oligonucleotide spatial coordinates and a microfluidic device thereof <160> 10 <170> PatentIn version 3.3 <210> 1 <211> 145 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (60)..(69) <223> n is a, c, g, or t <220> <221> misc_feature <222> (92)..(113) <223> n is a, c, g, or t <220> <221> misc_feature <222> (145)..(145) <223> n is a, c, g, or t <400> 1 aagcagtggt atcaacgcag agtacgtctc tttccctaca cacgacgctc ttccgatctn 60 nnnnnnnnng agtgattgct tgtgacgcct tnnnnnnnnnn nnnnnnnnnn nnnttttttt 120 tttttttttt tttttttttt tttvn 145 <210> 2 <211> 43 <212> DNA <213> Artificial sequence <400> 2 ttaagcagtg gtatcaacgc agagtacgtc tctttcccta cac 43 <210> 3 <211> 38 <212> DNA <213> Artificial sequence <400> 3 acgacgctct tccgatctgc ttacgcagga gtgattgc 38 <210> 4 <211> 38 <212> DNA <213> Artificial sequence <400> 4 acgacgctct tccgatctct acagagcgga gtgattgc 38 <210> 5 <211> 38 <212> DNA <213> Artificial sequence <400> 5 acgacgctct tccgatctga tctggtccga gtgattgc 38 <210> 6 <211> 38 <212> DNA <213> Artificial sequence <400> 6 acgacgctct tccgatctta cagcgttaga gtgattgc 38 <210> 7 <211> 66 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (23)..(34) <223> n is a, c, g, or t <220> <221> misc_feature <222> (66)..(66) <223> n is a, c, g, or t <400> 7 ttgtgacgcc ttccgattgg atnnnnnnnn nnnntttttt tttttttttt tttttttttt 60 ttttvn 66 <210> 8 <211> 66 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (23)..(34) <223> n is a, c, g, or t <220> <221> misc_feature <222> (66)..(66) <223> n is a, c, g, or t <400> 8 ttgtgacgcc ttaggcctca tannnnnnnn nnnntttttt tttttttttt tttttttttt 60 ttttvn 66 <210> 9 <211> 66 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (23)..(34) <223> n is a, c, g, or t <220> <221> misc_feature <222> (66)..(66) <223> n is a, c, g, or t <400> 9 ttgtgacgcc ttttgtacgg ccnnnnnnnn nnnntttttt tttttttttt tttttttttt 60 ttttvn 66 <210> 10 <211> 66 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (23)..(34) <223> n is a, c, g, or t <220> <221> misc_feature <222> (66)..(66) <223> n is a, c, g, or t <400> 10 ttgtgacgcc tttactatcg gannnnnnnn nnnntttttt tttttttttt tttttttttt 60 ttttvn 66

Claims

1. A microfluidic device for oligonucleotide synthesis, characterized in that: The microfluidic device comprises a first microfluidic module and a second microfluidic module; the first microfluidic module is provided with a first substrate, a first coding chip, a first microfluidic chip, a first injection adapter plate and a first upper fixed plate in order from bottom to top; the first microfluidic chip is provided with a plurality of X flow channels, a plurality of first injection ports and a plurality of first outlet ports; the first injection ports are arranged in pairs, and a pair of first injection ports are connected through the X flow channels; the first outlet ports are arranged in pairs, and a pair of first outlet ports are connected through the X flow channels; the first injection adapter plate is provided with a plurality of first sample inlets and a plurality of first sample outlets; the first sample inlets correspond to the first injection ports one by one; the first sample outlet corresponds to the first outlet one by one; the first upper fixed plate is provided with a plurality of first openings; the first opening is connected to at least one first sample inlet or first sample outlet; the first opening is provided with a first sealing cover plate; the second The microfluidic module is provided with a second substrate, a second coding chip, a second microfluidic chip, a second injection adapter plate and a second upper fixed plate in sequence from bottom to top; the second microfluidic chip is provided with a plurality of Y flow channels, a plurality of second injection ports and a plurality of second outlet ports; the second injection ports are arranged in pairs, and a pair of second injection ports are connected through the Y flow channel; the second outlet ports are arranged in pairs, and a pair of second outlet ports are connected through the Y flow channel; the second injection adapter plate is provided with a plurality of second sample inlets and a plurality of second sample outlets; the second sample inlets correspond to the second injection ports one by one; the second sample outlet corresponds to the second outlet port one by one; the second upper fixed plate is provided with a plurality of second openings; the second opening is communicated with at least one second sample inlet or second sample outlet; a second sealing cover plate is provided on the second opening; the X flow channel and the Y flow channel are arranged orthogonally; the intersection of the X flow channel and the Y flow channel forms a coding area.

2. The microfluidic device for oligonucleotide synthesis according to claim 1, characterized in that The first coding chip and / or the second coding chip is provided with a coding photographing area.

3. The microfluidic device for oligonucleotide synthesis according to claim 2, characterized in that The coding photographing area is arranged at the center position of the first coding chip and / or the second coding chip.

4. The microfluidic device for oligonucleotide synthesis according to any one of claims 1 to 3, characterized in that: A first sealing ring is provided between the first sealing cover plate and the first opening; and a second sealing ring is provided between the second sealing cover plate and the second opening.

5. The microfluidic device for oligonucleotide synthesis according to any one of claims 1 to 3, characterized in that: The first base and the first upper fixing plate are fixed by bolts; the second base and the second upper fixing plate are fixed by bolts.

6. The microfluidic device for oligonucleotide synthesis according to any one of claims 1 to 3, characterized in that: The first microfluidic chip, the first sample injection adapter plate, the first upper fixing plate, the second microfluidic chip, the second sample injection adapter plate and the second upper fixing plate are made of light-transmitting materials.

7. A method for synthesizing oligonucleotides, characterized in that: The method uses an oligonucleotide spatial coordinate encoding method to synthesize oligonucleotides on a microfluidic device for oligonucleotide synthesis as described in any one of claims 1 to 6; The oligonucleotide spatial coordinate encoding method comprises the following steps: Step 1: presuppose that the full oligonucleotide sequence to be encoded is composed of n+i oligonucleotide sequence fragments connected, and based on this presupposition, synthesize n groups of different oligonucleotide sequence fragments X and i groups of different oligonucleotide sequence fragments Y; Step 2: setting an oligonucleotide synthesis array formed by orthogonally setting an X channel and a Y channel, so that the intersection of the X channel and the Y channel forms a coding region for connecting the oligonucleotide sequence fragments; Step 3: applying oligonucleotide sequence fragment X and oligonucleotide sequence fragment Y to each X channel and Y channel of the oligonucleotide synthesis array in turn, respectively, so that the oligonucleotide sequence fragment X and the oligonucleotide sequence fragment Y are gradually connected in the coding region to obtain the full sequence of the oligonucleotide to be encoded; The number of X channels is n; the number of Y channels is i; when applying oligonucleotide sequence fragment X and oligonucleotide sequence fragment Y in rounds, the same oligonucleotide sequence fragment is applied to the coding region in the same channel, and different oligonucleotide sequence fragments are applied to the coding region in different channels, so that multiple rows can be encoded in each round.

8. Use of the microfluidic device for oligonucleotide synthesis according to any one of claims 1 to 6 or the method for synthesizing oligonucleotide according to claim 7 in oligonucleotide synthesis.

Images