L-methionine producing microorganisms introducing exogenous metZ gene encoding protein and method for producing L-methionine using the same

Abstract

The present application provides an L-methionine producing microorganism into which the metZ gene is introduced and a method for producing L-methionine using the microorganism.

Description

Background of the Invention

[0001] 1. Field of the Invention

[0002] The present application relates to an L-methionine producing microorganism, into which a protein encoded by an exogenous metZ gene is introduced, and a method for producing L-methionine using the microorganism.

[0003] 2. Description of Related Technology

[0004] L-methionine is one of the essential amino acids in the body and is used as feed, medical raw materials (e.g., synthetic raw materials for medical solutions, medical supplies, etc.), and food additives. Methionine is an important amino acid involved in methyl transfer reactions in the body and plays a role in sulfur supply.

[0005] In the chemical synthesis of methionine, a method of producing methionine in the form of a mixture of L-form and D-form by hydrolyzing 5-(β-methylmercaptoethyl)-hydantoin is mainly used. However, this chemical synthesis produces a mixed form of L-form and D-form.

[0006] Meanwhile, L-methionine can also be produced by biological methods. More specifically, a method of using microorganisms to produce L-methionine is to use O-acylhomoserine (O-acetylhomoserine or O-succinylhomoserine) and hydrogen sulfide as substrates to produce methionine by direct sulfhydrylation. For example, it is known that the enzyme encoded by the metY gene in Corynebacterium performs the direct sulfhydrylation function. Another method of producing L-methionine by microorganisms is to use O-acylhomoserine (O-acetylhomoserine or O-succinylhomoserine) and cysteine ​​as substrates to produce methionine by transsulfurization. For example, it is known that the enzyme encoded by the metB gene in Corynebacterium performs the transsulfurization function. However, there are disadvantages that the enzyme encoded by metB produces many by-products and the metY gene is subject to feedback inhibition, so it is difficult to apply it to the industrial large-scale production of L-methionine (Kromer JO et al., J Bacteriol 188(2):609–618, 2006; Yeom HJ et al., J Microbiol Biotechnol 14(2):373–378, 2004; etc.).

[0007] The inventors of the present application have made great efforts to develop alternative proteins and found that L-methionine can be produced in high yield by introducing the protein encoded by the metZ gene into microorganisms, thereby completing the present application. Summary of the invention

[0008] An object of the present invention is to provide an L-methionine producing microorganism, into which a protein encoded by an exogenous metZ gene is introduced.

[0009] Another object of the present invention is to provide a method for producing L-methionine, which comprises culturing a microorganism in a medium containing thiosulfate.

[0010] Another object of the present invention is to provide a composition for producing L-methionine, which comprises a microorganism and thiosulfate. Sequence Listing <110> CJ CheilJedang Corporation <120> L-methionine producing microorganisms introducing exogenous metZ gene encoding protein and method for producing L-methionine using the same <130> OPA20069 <150> KR 10-2019-0134797 <151> 2019-10-28 <160> 81 <170> KoPatentIn 3.0 <210> 1 <211> 2642 <212> DNA <213> Corynebacterium glutamicum <400> 1 ctcccgcgca ctgctgcaat ccgcaccgtg cccaatgatg gtggttcgcc cacctgagaa 60 gattaagaag tagtttcttt taagtttcga tgccccggtt tcctgatttt gtgcaggggag 120 gccggggcat tggtgtttgc gggttagttc gggccattcg aaagggagaa accaagggca 180 gccagacaga cgtgccaaga atctggattt ccgccaggtt ttggcacgcc cgtctggttt 240 aggcaatgag ataccgaaca cacgtgccaa aagttcggct ttttcgccga tcttgtcacg 300 cctgcctggt ttgtcttgta aagagtgatt tcatggccga gactcctaaa agtttgacct 360 cacaggattg cttctaaggg cctctccaat ctccactgag gtacttaatc cttccgggga 420 attcgggcgc ttaaatcgag aaattaggcc atcacctttt aataacaata caatgaataa 480 ttggaatagg tcgacacctt tggagcggag ccggttaaaa ttggcagcat tcaccgaaag 540 aaaaggagaa ccacatgctt gccctaggtt ggattacatg gatcattatt ggtggtctag 600 ctggttggat tgcctccaag attaaaggca ctgatgctca gcaaggaatt ttgctgaaca 660 tagtcgtcgg tattatcggt ggtttgttag gcggctggct gcttggaatc ttcggagtgg 720 atgttgccgg tggcggcttg atcttcagct tcatcacatg tctgattggt gctgtcattt 780 tgctgacgat cgtgcagttc ttcactcgga agaagtaatc tgctttaaat ccgtagggcc 840 tgttgatatt tcgatatcaa caggcctttt ggtcattttg gggtggaaaa agcgctagac 900 ttgcctgtgg attaaaacta tacgaaccgg tttgtctata ttggtgttag acagttcgtc 960 gtatcttgaa acagaccaac ccgaaaggac gtggccgaac gtggctgcta gcgcttcagg 1020 caagatgaa acaagtgccg gggcaaaccg tcgtcgcaat cgaccaagcc cccgacagcg 1080 tctcctcgat agcgcaacca accttttcac cacagaaggt attcgcgtca tcggtattga 1140 tcgtatcctc cgtgaagctg acgtggcgaa ggcgagcctc tattcccttt tcggatcgaa 1200 ggacgccttg gttattgcat acctggagaa cctcgatcag ctgtggcgtg aagcgtggcg 1260 tgagcgcacc gtcggtatga aggatccgga agataaaatc atcgcgttct ttgatcagtg 1320 1380 gtaccctcgc cccgaaactg atagcgaaaa gggcattgtt gcagcagtgt tagagcaccg 1440 cgagtggtgt cataagactc tgactgattt gctcactgag aagaacggct acccaggcac 1500 cacccaggcg aatcagctgt tggtgttcct tgatggtgga cttgctggat ctcgattggt 1560 ccacaacatc agtcctcttg agacggctcg cgatttggct cggcagttgt tgtcggctcc 1620 acctgcggac tactcaattt agtttcttca ttttccgaag gggtatcttc gttgggggag 1680 gcgtcgataa gccccttctt tttagcttta acctcagcgc gacgctgctt taagcgctgc 1740 atggcggcgc ggttcatttc acgttgcgtt tcgcgcctct tgttcgcgat ttctttgcgg 1800 gcctgttttg cttcgttgat ttcggcagta cgggttttgg tgagttccac gtttgttgcg 1860 tgaagcgttg aggcgttcca tggggtgaga atcatcaggg cgcggttttt gcgtcgtgtc 1920 cacaggaaga tgcgcttttc tttttgtttt gcgcggtaga tgtcgcgctg ctctaggtgg 1980 tgcactttga aatcgtcggt aagtgggtat ttgcgttcca aaatgaccat catgatgatt 2040 gtttggagga gcgtccacag gttgttgctg acccaataga gtgcgattgc tgtggggaat 2100 ggtcctgtga ggccaaggga cagtgggaag atcggcgcga ggatcgacat cacgatcatg 2160 aacttcagca tgccgttaga gaatccggat gcgtaatcgt tggtttggaa gctgcggtac 2220 atggacatcg ccatgttgat tgcggtgagg attgcggctg tgatgaacag tggcaaaacg 2280 aaactaagaa cttccgcctg cgtggtgctc aaatatttta gctgctcagt gggcatcgaa 2340 acataagcgg gcagaggcac attgctcacg cgaccagcga ggaaagattc cacttcctca 2400 ggagttagga agccgatcga ctggaagacg ggattttcca aaccaccttc agggcgagcc 2460 atgcggagaa gtgccccagta aagaccaagg acaatcggta tctggatcag cccaggcaca 2520 caacctgcca gcgggttaat gccgtattcc ttattcaaat cattctggcg cttctgcaac 2580 tcccgaatgg acgcttcatc gtactttccc ttgtattctt cccggagcgc agcgcggtga 2640 gg 2642 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 2 tcgagctcgg tacccctgcc tggtttgtct tgta 34 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 3 cggaaaatga agaaagttcg gccacgtcctttcgg 35 <210> 4 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 4 aggacgtggc cgaactttct tcattttccg aaggg 35 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 5 ctctagagga tccccgtttc gatgcccact gagca 35 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 6 aatctggatt tccgccaggt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 7 cttcctaact cctgaggaag 20 <210> 8 <211> 3311 <212> DNA <213> Corynebacterium glutamicum <400> 8 ctcattccag cgtcacgacg ttccgaaggt actggttacc tggcattggg cactaccgtt 60 tctgcagcac ttggaccagc cctagcactt tttgtcctag gaacatttga ttacgacatg 120 ctgtttatcg tggtcttggc aacctcggtc atctctttga tcgccgtcgt gttcatgtac 180 tttaagacca gcgaccctga gccttctggg gaaccagcca agttcagctt caaatctatt 240 atgaacccaa agatcatccc catcggcatc tttatcttgc ttatttgctt tgctactct 300 ggcgtcattg cctacatcaa cgcatttgct gaagaacgcg atctgattac gggtgctgga 360 ttgttcttca ttgcctacgc agtatcaatg tttgtgatgc gcagcttcct tggcaaactg 420 caggaccgtc gcggagacaa cgtcgttatt tactttggat tgttcttctt cgttatttcc 480 ttgacgattt tgtcctttgc cacttccaac tggcacgttg tgttgtccgg agtcattgca 540 ggtctgggat acggcacttt gatgccagca gtgcagtcca tcgctgttgg tgtagtagac 600 aaaaccgaat tcggtacggc cttctccact ttgttcctgt ttgtggactt aggttttggc 660 tttggaccta ttatcctggg agcagtttct gcggcaattg gtttcggacc tatgtatgca 720 gcactggcag gtgtgggtgt gattgccgga atcttctacc tgttcacaca cgctcgcacc 780 gatcgagcta agaatggctt tgttaaacac ccagagcctg tcgctttagt tagctagttc 840 tttcagcttt ccctcccgat cagcgtaaac cggcccttcc ggttttgggg tacatcacag 900 aacctgggct agcggtgtag acccgaaaat aaacgagcct tttgtcaggg ttaaggttta 960 ggtatctaag ctaaccaaac accaacaaaa ggctctaccc atgaagtcta ccggcaacat 1020 catcgctgac accatctgcc gcactgcgga actaggactc accatcaccg gcgcttccga 1080 tgcaggtgat tacaccctga tcgaagcaga cgcactcgac tacacctcca cctgcccaga 1140 atgctcccaa cctggggtgt ttcgtcatca cacccaccgg atgctcattg atttacccat 1200 cgtcgggttt cccaccaaac tgtttatccg tctacctcgc taccgctgca ccaaccccac 1260 atgtaagcaa aagtatttcc aagcagaact aagctgcgct gaccacggta aaaaggtcac 1320 ccaccgggtc acccgctgga ttttacaacg ccttgctatt gaccggatga gtgttcacgc 1380 aaccgcgaaa gcacttgggc tagggtggga tttaacctgc caactagccc tcgatatgtg 1440 ccgtgagctg gtctataacg atcctcacca tcttgatgga gtgtatgtca ttggggtgga 1500 tgagcataag tggtcacata atagggctaa gcatggtgat gggtttgtca ccgtgattgt 1560 cgatatgacc gggcatcggt atgactcacg gtgtcctgcc cggttattag atgtcgtccc 1620 aggtcgtagt gctgatgctt tacggtcctg gcttggctcc cgcggtgaac agttccgcaa 1680 tcagatacgg atcgtgtcca tggatggatt ccaaggctac gccacagcaa gtaaagaact 1740 cattccttct gctcgtcgcg tgatggatcc attccatgtt gtgcggcttg ctggtgacaa 1800 gctcaccgcc tgccggcaac gcctccagcg ggagaatac cagcgtcgtg gtttaagcca 1860 ggatccgttg tataaaaacc ggaagacctt gttgaccacg cacaagtggt tgagtcctcg 1920 tcagcaagaa agcttggagc agttgtgggc gtatgacaaa gactacgggg cgttaaagct 1980 tgcgtggctt gcgtatcagg cgattattga ttgttatcag atgggtaata agcgtgaagc 2040 gaagaaa atgcggacca ttattgatca gcttcgggtg ttgaaggggc cgaataagga 2100 actcgcgcag ttgggtcgta gtttgtttaa acgacttggt gatgtgttgg cgtatttcga 2160 tgttggtgtc tccaacggtc cggtcgaagc gatcaacgga cggttggagc atttgcgtgg 2220 gattgctcta ggtttccgta atttgaacca ctacattctg cggtgcctta tccattcagg 2280 gcagttggtc cataagatca atgcactcta aaacaggaag agcccgtaaa cctctgacta 2340 gcgtcaccct ctgattaagg cgaccgcgga tttaagagca gaggctgcca cgagcgcatc 2400 ttcacggctg tgtgttgtac taaaagtaca gcgcacagcc gttcgtgctt gatcctcctc 2460 aagccccaac gccagcaaca catgggatac ctctccggaa ccacaggcag aaccagggga 2520 gcacacaatg ccttggcgtt ccaattccag aagaacagtt tcagatccta tgctgtcgaa 2580 gagaaaagat gcgtgtccat caatgcgcat cctaggatgt ccagtcaggt gtgctcccgg 2640 gatagtgaga acttcctcga tgaattcgcc aagatctgga taggattccg ccctggccaa 2700 ttccaaggca gtggcaaagg cgatagcccc cgcaacgttt tccgtgccac tacgccgccc 2760 tttttcctgg ccgccgccat ggattaccgg ctccagggga agctttgacc ataacactcc 2820 aatcccttta ggcgcaccga atttatgacc cgacaaactt aacgcgtcaa ctcccaagtc 2880 aaaggttaaa tgtgcagctt gcactgcatc ggtgtgaaaa ggcgtactgc ttaccgccgc 2940 caactcagct atcggctgaa tggttcccac ctcattgttg gcataaccaa tgctgatcaa 3000 tgtggtgtcc ggcctgactg ctttgcggag accctccggg gagatcagcc cagtgtgatc 3060 gggggatagg taggtgatct cgaaatcatg aaacctttca agataagcag cagtttctag 3120 gacactgtca tgctcgatcg gggtggtgat gaggtgccgg ccacgaggat tagctaagca 3180 cgctcctttg atagcgaggt tgttggcttc tgatccaccc gacgtaaacg tcacctgtgt 3240 ggggcgtcct ccgataatgc gggccacccg agttcgagca tcctccagcc ccgcagaggc 3300 gagtcttccc a 3311 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primer <400> 9 acccggggat cctctagaat gtttgtgatg cgcag 35 <210> 10 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primer <400> 10 gtcagagagt acttacgctg atcgggaggg aaagc 35 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 11 atcagcgtaa gtactctctg actagcgtca ccctc 35 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 12 ctgcaggtcg actctagaaa agggattgga gtgtt 35 <210> 13 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 13 atcaaaacag atatcatggc atccgacgcg ccgca 35 <210> 14 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 14 cgctagtcag agagtttagt caaggccccg caaca 35 <210> 15 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 15 atcaaaacag atatcatggc ggatgcaccc ggcgg 35 <210> 16 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 16 cgctagtcag agagttcaca agctgttaag cgaag 35 <210> 17 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 17 atcaaaacag atatcatgac gaaggactgg aagac 35 <210> 18 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 18 cgctagtcag agagttcaga tcaccgcgag cgcct 35 <210> 19 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 19 ccgatcagcg taagtggcgc ttcatgtcaa caatc 35 <210> 20 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 20 cgcgtcggat gccatgatat ctgttttgat ctcct 35 <210> twenty one <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> twenty one gggtgcatcc gccatgatat ctgttttgat ctcct 35 <210> twenty two <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> twenty two ccagtccttc gtcatgatat ctgttttgat ctcct 35 <210> twenty three <211> 18 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> twenty three aatggtccag gagctcat 18 <210> twenty four <211> 18 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> twenty four gatcacctac ctatcccc 18 <210> 25 <211> 3161 <212> DNA <213> Corynebacterium glutamicum <400> 25 cggtggacga tgagggaaaa cgtttcctcg ccgccccacag aatcataaaa attttctgag 60 gttgtcatgg gtaccagtct aagccctggc cttacgccag taaggtgtta cccatgcgcg 120 aactagcact caacatggcc ggcgtcaccg tgcggcgcgg cgagaaattg cttctcgacg 180 atatctccct ctcaattccg caagggtcgc actgggccgt acttggtcca aatggcgccg 240 gtaaaaccac catgctgaag atcgcagcca ccttgctgta cccatcggaa ggcaccgtgg 300 acatcctggg gcatcgcttt ggtcgggtgg atactcgtga gctgcggaaa acaatcggcc 360 tggtggaccc gaagcaaaga tttaccaacc tgccggccca cgaaattgtg ctgtcggggt 420 taaccgcctc caacgggttg ttgccacggt ggtcggcttc ggcttcggag ttggagcggt 480 gcgctttgat gttggagttg gtgggcatga cagcgcgtgc cgatcgttac tgggccgata 540 tgagccaggg cgaaaaagcc cgcaccctga ttgctcgtgc gctgattatc tcaccgaccc 600 tactgctgct tgatgaaccc accaccggcc ttgacctgcc cggacgtgaa actttgctca 660 gtgtgattga tggtttgcga gccgctcttc ctggtctgac gacagtgatg atcacccacc 720 acgtcgaaga gatcgccgcc tccacgacag atatcctcat gatcaaggac gcccgcatac 780 tggcttcggg gactgtttca gaagtgatga ctcctgaaaa tttgggcgcg ctgtatgaca 840 tgtcggtgtc gttggaaact gtgcgcagcc ggtggttcgc gttcgatgct ctgcattaaa 900 aggggctagt tttacaaa agtggacagc ttggtctatc attgccagaa gaccggtcct 960 tttagggcca tagaattctg attacaggag ttgatctacc ttgtcttttg acccaaacac 1020 ccagggtttc tccactgcat cgattcacgc tgggtatgag ccagacgact actacggttc 1080 gattaacacc ccaatctatg cctccaccac cttcgcgcag aacgctccaa acgaactgcg 1140 caaaggctac ggtacaccc gtgtgggcaa ccccaccatc gtggcattag agcagaccgt 1200 cgcagcactc gaaggcgcaa agtatggccg cgcattctcc tccggcatgg ctgcaaccga 1260 catcctgttc cgcatcatcc tcaagccggg cgatcacatc gtcctcggca acgatgctta 1320 cggcggaacc taccgcctga tcgacaccgt attcaccgca tggggcgtcg aatacaccgt 1380 tgttgatacc tccgtcgtgg aagaggtcaa ggcagcgatc aaggacaaca ccaagctgat 1440 ctgggtggaa accccaacca acccagcact tggcatcacc gacatcgaag cagatagcaaa 1500 gctcaccgaa ggcaccaacg ccaagctgggt tgttgacaac accttcgcat ccccatacct 1560 gcagcagcca ctaaaactcg gcgcacacgc agtcctgcac tccaccacca agtacatcgg 1620 aggacactcc gacgttgttg gcggccttgt ggttaccaac gaccaggaaa tggacgaaga 1680 actgctgttc atgcagggcg gcatcggacc gatcccatca gttttcgatg catacctgac 1740 cgcccgtggc ctcaagaccc ttgcagtgcg catggatcgc cactgcgaca acgcagaaaa 1800 gatcggggaa ttcctggact cccgcccaga ggtctccacc gtgctctacc caggtctgaa 1860 gaaccaccca ggccacgaag tcgcagcgaa gcagatgaag cgcttcggcg gcatgatctc 1920 cgtccgtttc gcaggcggcg aagaagcagc taagaagttc tgtacctcca ccaaactgat 1980 ctgtctggcc gagtccctcg gtggcgtgga atccctcctg gagcacccag caaccatgac 2040 ccaccagtca gctgccggct ctcagctcga ggttccccgc gacctcgtgc gcatctccat 2100 tggtattgaa gacattgaag acctgctcgc agatgtcgag caggccctca ataaccttta 2160 gaaactattt ggcggcaagc agcttttcaa tataagcaat gcgagcctcc accatgtagc 2220 cgaagagttc gtcagaagtt gagacggact cttcgactgc tttacgggtc agtggcgctt 2280 ccacatctgg gttctcatca agccatggct taggaaccgg agcaaacaca tccgggtttt 2340 cgccctctgg acgattgtca aaggtgtagt cagaagtcag ggtgaagctg aagacatcag 2400 ccatcatcat ctcccggatg atggttgctt ccttgaggga cagcccgata tcagtcaaga 2460 acttcaagga ctcctccgca cccgcgattc gcagtgggga agtgccctga gtagagatct 2520 gttcatccag cgcgaccaga agaacacgtg gagtctcacg gaattggtcg cgcaatgagc 2580 tccacagcgt atgaatagat tgccgccaat tgtccggatc aagatcgggc accttgatat 2640 catcgatgat gcgcacccag acgcgatcaa tgatttcttg acgatttagc acatggttat 2700 acagtgcgcg aggggtgaca cccatgtctc gggcgaggcg gttcatggtc acggcagcga 2760 atccttcgcg gccggcaatg tttaaagtgc gctccactat ggattcgacg gaaggatac 2820 gttgggtggg gcgtccagga cgacgtcccg tggaagtggc cgccagagtt gacgctacgg 2880 ctggtttcat agtttcgta ggcatgttat atgacgttac gccttttct acaagacaac 2940 cagcgttttc agcgagatac tggacatatc aactaaaatc cctgaataaa acatctaaca 3000 tgggttttat acagaaaatt catacgaaag gttgatcatg aagaagaaga ttgcggtcgt 3060 taccggagcg accggaggca tgggaattga gatcgtcaaa gacctctccc gcgaccacat 3120 tgtctacgcc ttgggccgaa atccagagca tctggcagct c 3161 <210> 26 <211> 3314 <212> DNA <213> Corynebacterium glutamicum <400> 26 gataccggca gctccaccga ccgtgcccat ttcatcacga accatctggc caagtgagcg 60 tccacgccta cgagtagaca cccacagcac taggtagtcc tgcactgcac cggcgaaaat 120 cacaccgagg ataatccaca aggtgcctgg caggtagccc atctgcgcgg ccatgacagg 180 tccaaccaat ggaccggcac ctgcaatagc tgcaaagtgg tggccaaaaa gcacacgacg 240 atccgttggg acatagtcct tgccgtcatt aacgtattcc gccggggttg ctcgctgatc 300 tttcggctta acaactttgt attcaatcag tcgggcatag aaagaaaacg caatgatata 360 ggaaccaact gccgccaaaa ccagccacac agagttgatt gtttcgccac gggagaaagc 420 gattgctccc caacccaccg ccgcgataac cccaagaca aggagaccaa cgcggcggt 480 cggtgacatt taggggact tctcacgcc tactgagg tcagtagcgt tgctgtacac 540 caaatcatcg tcattgatgt tgtcagtctg tttatgtc acgatcttta ctgttttctc 600 ttcgggtcgt ttcaaagcca ctatgcgtag aacagcggg cagaaactgt gtgcagaaat 660 gcatgcagaa aaaggaaagt tcggccagat gggtgtttct gtatgccgat gatcggatct 720 ttgacagctg ggtatgcgac aaatcaccga gagttgttaa ttcttacaa tggaaagta 780 acattgagag atgatttata ccatcctgca ccatttagag tggggctagt cataccccca 840 taaccctagc tgtacgcaat cgatttcaa tcagttggaa aaagtcaaga aattacccg 900 agaataaatt tataccacac agtctattgc atagaccaa gctgttcagt agggtgcatg 960 ggagaagaat ttcctataa aaactcttaa ggacctccaa atgccaagt acgacaatc 1020 caatgctgac cagtggggct ttgaacccg ctccattcac gcaggccagt cagtagacgc 1080 acagaccagc gcacgaaacc ttccgatcta ccaatccacc gcttcgtgt tcgactccgc 1140 tgagcacgcc aagcagcgtt tcgcacttga ggatctaggc cctgtttact cccgcctcac 1200 caacccaacc gttgaggctt tggaaaaccg catcgcttcc ctcgaaggtg gcgtccacgc 1260 tgtagcgttc tcctccggac aggccgcaac caccaacgcc attttgaacc tggcaggagc 1320 gggcgaccac atcgtcacct ccccacgcct ctacggtggc accgagactc tattccttat 1380 cactcttaac cgcctgggta tcgatgtttc cttcgtggaa aaccccgacg accctgagtc 1440 ctggcaggca gccgttcagc caaacaccaa agcattcttc ggcgagactt tcgccaaccc 1500 acaggcagac gtcctggata ttcctgcggt ggctgaagtt gcgcaccgca acagcgttcc 1560 actgatcatc gacaacacca tcgctaccgc agcgctcgtg cgcccgctcg agctcggcgc 1620 agacgttgtc gtcgcttccc tcaccaagtt ctacaccggc aacggctccg gactgggcgg 1680 cgtgcttatc gacggcggaa agttcgattg gactgtcgaa aaggatggaa agccagtatt 1740 cccctacttc gtcactccag atgctgctta ccacggattg aagtacgcag accttggtgc 1800 accagccttc ggcctcaagg ttcgcgttgg ccttctacgc gacaccggct ccaccctctc 1860 cgcattcaac gcatgggctg cagtccaggg catcgacacc ctttccctgc gcctggagcg 1920 ccacaacgaa aacgccatca aggttgcaga attcctcaac aaccacgaga aggtggaaaa 1980 ggttaacttc gcaggcctga aggattcccc ttggtacgca accaaggaaa agcttggcct 2040 gaagtacacc ggctccgttc tcaccttcga gatcaagggc ggcaaggatg aggcttgggc 2100 atttatcgac gccctgaagc tacactccaa ccttgcaaac atcggcgatg ttcgctccct 2160 cgttgttcac ccagcaacca ccacccattc acagtccgac gaagctggcc tggcacgcgc 2220 gggcgttacc cagtccaccg tccgcctgtc cgttggcatc gagaccattg atgatatcat 2280 cgctgacctc gaaggcggct ttgctgcaat ctagctttaa atagactcac cccagtgctt 2340 aaagcgctgg gtttttcttt ttcagactcg tgagaatgca aactagacta gacagagctg 2400 tccatataca ctggacgaag ttttagtctt gtccacccag aacaggcggt tattttcatg 2460 cccaccctcg cgccttcagg tcaacttgaa atccaagcga tcggtgatgt ctccaccgaa 2520 gccggagcaa tcattacaaa cgctgaaatc gcctatcacc gctggggtga ataccgcgta 2580 gataaagaag gacgcagcaa tgtcgttctc atcgaacacg ccctcactgg agattccaac 2640 gcagccgatt ggtgggctga cttgctcggt cccggcaaag ccatcaacac tgatatttac 2700 tgcgtgatct gtaccaacgt catcggtggt tgcaacggtt ccaccggacc tggctccatg 2760 catccagatg gaaatttctg gggtaatcgc ttccccgcca cgtccattcg tgatcaggta 2820 aacgccgaaa aacaattcct cgacgcactc ggcatcacca cggtcgccgc agtacttggt 2880 ggttccatgg gtggtgcccg caccctagag tgggccgcaa tgtacccaga aactgttggc 2940 gcagctgctg ttcttgcagt ttctgcacgc gccagcgcct ggcaaatcgg cattcaatcc 3000 gcccaaatta aggcgattga aaacgaccac cactggcacg aaggcaacta ctacgaatcc 3060 ggctgcaacc cagccaccgg actcggcgcc gcccgacgca tcgcccacct cacctaccgt 3120 ggcgaactag aaatcgacga acgcttcggc accaaagccc aaaagaacga aaacccactc 3180 ggtccctacc gcaagcccga ccagcgcttc gccgtggaat cctacttgga ctaccaagca 3240 gacaagctag tacagcgttt cgacgccggc tcctacgtct tgctcaccga cgccctcaac 3300 cgccacgaca ttgg 3314 <210> 27 <211> 43 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 27 gaattcgagc tcggtacccg ggccagtaag gtgttaccca tgc 43 <210> 28 <211> 57 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 28 ctgcttgccg ccaaatagtt tagtactggt agatcaactc ctgtaatcag aattcta 57 <210> 29 <211> 57 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 29 tagaattctg attacaggag ttgatctacc agtactaaac tatttggcgg caagcag 57 <210> 30 <211> 43 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 30 tcgactctag aggatccccg ggcgatctca attcccatgc ctc 43 <210> 31 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 31 tcgagctcgg tacccctgca atagctgcaa agtgg 35 <210> 32 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 32 tgagtctatt taaagcgggt aattttcttg acttt 35 <210> 33 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 33 caagaaaatt acccgcttta aatagactca cccca 35 <210> 34 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 34 ctctagagga tccccgcctt aatttgggcg gattg 35 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 35 ttcctggtct gacgacagtg 20 <210> 36 <211> twenty one <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 36 gatgtcttca gcttcaccct g 21 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 37 ccgaggataa tccacaaggt 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primer <400> 38 cgaagcgttc gtcgatttct 20 <210> 39 <211> 5666 <212> DNA <213> Corynebacterium glutamicum <400> 39 tgtcatgctt ccggaggtgc gcagggctcg agactccgga aagctatttg ccactccgat 60 gtttgggtca ctcgacgaga tacgtgctga tcacctaatt tggtgcacag ggtttcggcc 120 ggcgattagg ccagttcgtc aacttctcaa acacggacaa ccaaaggttc ctggtcttta 180 tttagtaggc tacggagatt ggacgggacc tgggtctgcg actatcacag gggtcgggct 240 ttatgccaag cgagcagcca aagagattgc cgcgtcagtc ggcaaagtcg ttaaatagtt 300 tgaaggctaa gaacttaatg ttaaagcgaa aattgttttg acacctcaac taatgcagcg 360 atgcgttctt tccagaatgc tttcatgaca gggatgctgt cttgatcagg caggcgtctg 420 tgctggatgc cgaagctgga tttattgtcg cctttggagg tgaagttgac gctcactcga 480 gaatcatcgg ccaaccattt ggcattgaat gttctaggtt cggaggcgga ggttttctca 540 attagtgcgg gatcgagcca ctgcgcccgc aggtcatcgt ctccgaagag cttccacact 600 ttttcgaccg gcaggttaag ggttttggag gcattggccg cgaacccatc gctggtcatc 660 ccgggtttgc gcatgccacg ttcgtattca taaccaatcg cgatgccttg agcccaccag 720 ccactgacat caaagttgtc cacgatgtgc tttgcgatgt gggtgtgagt ccaagaggtg 780 gcttttacgt cgtcaagcaa ttttagccac tcttcccacg gctttccggt gccgttgagg 840 atagcttcag gggacatgcc tggtgttgag ccttgcggag tggagtcagt catgcgaccg 900 agactagtgg cgctttgcct gtgttgctta ggcggcgttg aaaatgaact acgaatgaaa 960 agttcgggaa ttgtctaatc cgtactaagc tgtctacaca atgtctactt cagttacttc 1020 accagcccac aacaacgcac attcctccga atttttggat gcgttggcaa accatgtgtt 1080 gatcggcgac ggcgccatgg gcacccagct ccaaggcttt gacctggacg tggaaaagga 1140 tttccttgat ctggaggggt gtaatgagat tctcaacgac acccgccctg atgtgttgag 1200 gcagattcac cgcgcctact ttgaggcggg agctgacttg gttgagacca atacttttgg 1260 ttgcaacctg ccgaacttgg cggattatga catcgctgat cgttgccgtg agcttgccta 1320 caagggcact gcagtggcta gggaagtggc tgatgagatg gggccgggcc gaaacggcat 1380 gcggcgtttc gtggttggtt ccctgggacc tggaacgaag cttccatcgc tgggccatgc 1440 accgtatgca gatttgcgtg ggcactacaa ggaagcagcg cttggcatca tcgacggtgg 1500 tggcgatgcc tttttgattg agactgctca ggacttgctt caggtcaagg ctgcggttca 1560 cggcgttcaa gatgccatgg ctgaacttga tacattcttg cccattattt gccacgtcac 1620 cgtagagacc accggcacca tgctcatggg ttctgagatc ggtgccgcgt tgacagcgct 1680 gcagccactg ggtatcgaca tgattggtct gaactgcgcc accggcccag atgagatgag 1740 cgagcacctg cgttacctgt ccaagcacgc cgatattcct gtgtcggtga tgcctaacgc 1800 aggtcttcct gtcctgggta aaaacggtgc agaataccca cttgaggctg aggatttggc 1860 gcaggcgctg gctggattcg tctccgaata tggcctgtcc atggtgggtg gttgttgtgg 1920 caccacacct gagcacatcc gtgcggtccg cgatgcggtg gttggtgttc cagagcagga 1980 aacctccaca ctgaccaaga tccctgcagg ccctgttgag caggcctccc gcgaggtgga 2040 gaaagaggac tccgtcgcgt cgctgtacac ctcggtgcca ttgtcccagg aaaccggcat 2100 ttccatgatc ggtgagcgca ccaactccaa cggttccaag gcattccgtg aggcaatgct 2160 gtctggcgat tgggaaaagt gtgtggatat tgccaagcag caaacccgcg atggtgcaca 2220 catgctggat ctttgtgtgg attacgtggg acgagacggc accgccgata tggcgacctt 2280 ggcagcactt cttgctacca gctccacttt gccaatcatg attgactcca ccgagccaga 2340 ggttattcgc acaggccttg agcacttggg tggacgaagc atcgttaact ccgtcaactt 2400 tgaagacggc gatggccctg agtcccgcta ccagcgcatc atgaaactgg taaagcagca 2460 cggtgcggcc gtggttgcgc tgaccattga tgaggaaggc caggcacgta ccgctgagca 2520 caaggtgcgc attgctaaac gactgattga cgatatcacc ggcagctacg gcctggatat 2580 caaagacatc gttgtggact gcctgacctt cccgatctct actggccagg aagaaaccag 2640 gcgagatggc attgaaacca tcgaagccat ccgcgagctg aagaagctct acccagaaat 2700 ccacaccacc ctgggtctgt ccaatatttc cttcggcctg aaccctgctg cacgccaggt 2760 tcttaactct gtgttcctca atgagtgcat tgaggctggt ctggactctg cgattgcgca 2820 cagctccaag attttgccga tgaaccgcat tgatgatcgc cagcgcgaag tggcgttgga 2880 tatggtctat gatcgccgca ccgaggatta cgatccgctg caggaattca tgcagctggtt 2940 tgagggcgtt tctgctgccg atgccaagga tgctcgcgct gaacagctgg ccgctatgcc 3000 tttgtttgag cgtttggcac agcgcatcat cgacggcgat aagaatggcc ttgaggatga 3060 tctggaagca ggcatgaagg agaagtctcc tattgcgatc atcaacgagg accttctcaa 3120 cggcatgaag accgtgggtg agctgtttgg ttccggacag atgcagctgc cattcgtgct 3180 gcaatcggca gaaaccatga aaactgcggt ggcctatttg gaaccgttca tggaagagga 3240 agcagaagct accggatctg cgcaggcaga gggcaagggc aaaatcgtcg tggccaccgt 3300 caagggtgac gtgcacgata tcggcaagaa cttggtggac atcattttgt ccaacaacgg 3360 ttacgacgtg gtgaacttgg gcatcaagca gccactgtcc gccatgttgg aagcagcgga 3420 agaacacaaa gcagacgtca tcggcatgtc gggacttctt gtgaagtcca ccgtggtgat 3480 gaaggaaaac cttgaggaga tgaacaacgc cggcgcatcc aattacccag tcattttggg 3540 tggcgctgcg ctgacgcgta cctacgtgga aaacgatctc aacgaggtgt acaccggtga 3600 ggtgtactac gcccgtgatg ctttcgaggg cctgcgcctg atggatgagg tgatggcaga 3660 aaagcgtggt gaaggacttg atcccaactc accagaagct attgagcagg cgaagaagaa 3720 ggcggaacgt aaggctcgta atgagcgttc ccgcaagatt gccgcggagc gtaaagctaa 3780 tgcggctccc gtgattgttc cggagcgttc tgatgtctcc accgatactc caaccgcggc 3840 accaccgttc tggggaaccc gcattgtcaa gggtctgccc ttggcggagt tcttgggcaa 3900 ccttgatgag cgcgccttgt tcatggggca gtggggtctg aaatccaccc gcggcaacga 3960 gggtccaagc tatgaggatt tggtggaaac tgaaggccga ccacgcctgc gctactggct 4020 ggatcgcctg aagtctgagg gcattttgga ccacgtggcc ttggtgtatg gctacttccc 4080 agcggtcgcg gaaggcgatg acgtggtgat cttggaatcc ccggatccac acgcagccga 4140 acgcatgcgc tttagcttcc cacgccagca gcgcggcagg ttcttgtgca tcgcggattt 4200 cattcgccca cgcgagcaag ctgtcaagga cggccaagtg gacgtcatgc cattccagct 4260 ggtcaccatg ggtaatccta ttgctgattt cgccaacgag ttgttcgcag ccaatgaata 4320 ccgcgagtac ttggaagttc acggcatcgg cgtgcagctc accgaagcat tggccgagta 4380 ctggcactcc cgagtgcgca gcgaactcaa gctgaacgac ggtggatctg tcgctgattt 4440 tgatccagaa gacaagacca agttcttcga cctggattac cgcggcgccc gcttctcctt 4500 tggttacggt tcttgccctg atctggaaga ccgcgcaaag ctggtggaat tgctcgagcc 4560 aggccgtatc ggcgtggagt tgtccgagga actccagctg cacccagagc agtccacaga 4620 cgcgtttgtg ctctaccacc cagaggcaaa gtactttaac gtctaacacc tttgagaggg 4680 aaaactttcc cgcacattgc agatcgtgcc actttaacta aggttgacgg catgattaag 4740 gcgattttct gggacatgga cggcacgatg gtggactctg agccacagtg gggcattgct 4800 acctacgagc tcagcgaagc catgggccgc cgcctcaccc cggagctccg ggaactcacc 4860 gtcggctcga gcctgccgcg caccatgcgc ttatgcgcag agcacgcagg cattacattg 4920 agcgacgcgg actacgagcg ctaccgggct ggcatgttcg cccgggtcca tgagcttttc 4980 gacgaatccc tcgtcccaaa tccaggcgtc accgaactcc tgacagagtt gaaggccctc 5040 gagatcccca tgttggtcac caccaacaca gagcgcgatc tcgcgacccg ttcagtcgca 5100 gccgtgggaa atgagttctt catcggttct atcgctggtg atgaagtccc aacagcaaag 5160 ccagcccccg acatgtacct cgaagcagca cgacgtgtgg gctttgaccc atcagagtgc 5220 ctcgtgttcg aagattccta caacggcatg ctgggcgctg ttactgcagg ttgccgcgtc 5280 attggtctgc acccagaaga agtccaagcg ccagaaggtg tagtgccttt gcgttccctc 5340 cacggtaaaa actctttcga aggtgtcacc gctgagatgg tcactgcctg gtaccaccag 5400 atcgagccgg caggtgtcgc aaaataaaac caggtggggg agtgaaatta ttcgactaat 5460 atcctccccc aaacacacat tgataactgt tgtgtggaag aatgtaccga gtgaagacat 5520 ttgactcgct gtacgaga cttcttaacc gtgctcagac ccgccctga gggtctgga ccgtggccgc cttggataaa ggcatccatc atctaggtaa gaaggtcatc gaaagaagccg gagaggtctg gattgcagcc gagtat <210> 40 <211> 3613 <212> DNA <213> Corynebacterium glutamicum <400> 40 tcctgtgggg tgaacttgac ctgtgctggg ccacgacgtc cgaaaacgtg cacttcagtg gccttgtttt ctttgaggga gtcgtagcg ttgtcggaaa tttcggtgac tttgagctcg tcgcctgtct tagccaggat gcgggctacg tcgaggccga cgttaccaac gccgataaca gcgacggact gtgcagacag atcccaggag cgctcgaagc gtgggttgcc gtcgtagaag 240 300. ccaacgaact cgccggcacc gaaggagcct tctgcttcaa ttccggggat gttgaggtcg cggtctgcaa ctgcgccggt ggagaacacg actgcatcgt agtagtcgcg gagttcttcg 360 acggtgatgt ctttgccgat ttcaatgtta ccgagcaggc gcaggcgtgg cttgtccaac 420 acgttgtgca gggacttaac gatgcccttg atgcgtgggt ggtctggagc aacgccgtaa 480 cggatgagtc cgaacggtgc aggcatttgc tcgaaaaggt caacgaacac ttcgcgctct 540 tcattgcgga tgaggaggtc ggatgcgtaa atgccagcag ggccagctcc gatgacggct 600 acgcgcaggg gagttgtcat gtgtttgaag ttgcctttcg tgagcccttt tatggaaaca 660 agggtgtgaa aatcaagtag ttaaaggtgt ttcaagtcca ggctgtttaa cactcctaga 720 ccgcttggtc tgtaaacgta gcagcgaaat gcgacaatgc gaagactttt gcttaattaa 780 attcaaactc catgaaaaaa ctagacagat cggtctatta tattcacggt gaacctaacc 840 taatatcccc aggttaattc atttaaacgg gcattaggtg actccattgc tttcagtctc 900 atgaatctaa tggttggtct agacagagcg gtacgtctaa gtttgcggat agatcaaacc 960 gagtgacatg tacttcacta gctctttaag gattaactcc ccatgacaac aaccaccgga 1020 agtgcccggc cagcacgtgc cgccaggaag cctaagcccg aaggccaatg gaaaatcgac 1080 ggcaccgagc cgcttaacca tgccgaggaa attaagcaag aagaacccgc ttttgctgtc 1140 aagcagcggg tcattgatat ttactccaag cagggttttt cttccattgc accggatgac 1200 attgccccac gctttaagtg gttgggcatt tacacccagc gtaagcagga tctgggcggt 1260 gaactgaccg gtcagcttcc tgatgatgag ctgcaggatg agtacttcat gatgcgtgtg 1320 cgttttgatg gcggactggc ttcccctgag cgcctgcgtg ccgtgggtga aatttctagg 1380 gattatgctc gttccaccgc ggacttcacc gaccgccaga acattcagct gcactggatt 1440 cgtattgaag atgtgcctgc gatctgggag aagctagaaa ccgtcggact gtccaccatg 1500 cttggttgcg gtgacgttcc acgtgttatc ttgggctccc cagtttctgg cgtagctgct 1560 gaagagctga tcgatgccac cccggctatc gatgcgattc gtgagcgcta cctagacaag 1620 gaagagttcc acaaccttcc tcgtaagttt aagactgcta tcactggcaa ccagcgccag 1680 gatgttaccc acgaaatcca ggacgtttcc ttcgttcctt cgattcaccc agaattcggc 1740 ccaggatttg agtgctttgt gggcggtggc ctgtccacca acccaatgct tgctcagcca 1800 cttggttctt ggattccact tgatgaggtt ccagaagtgt gggctggcgt cgccggaatt 1860 ttccgcgact acggcttccg acgcctgcgt aaccgtgctc gcctcaagtt cttggtggca 1920 cagtggggta ttgagaagtt ccgtgaagtt cttgagaccg aatacctcga gcgcaagctg 1980 atcgatggcc cagttgttac caccaaccct ggctaccgtg accacattgg cattcaccca 2040 caaaaggacg gcaagttcta cctcggtgtg aagccaaccg ttggacacac caccggtgag 2100 cagctcattg ccattgctga tgttgcagaa aagcacggca tcaccaggat tcgtaccacg 2160 gcggaaaagg aactgctctt cctcgatatt gagagaaaga accttactac cgttgcacgc 2220 gacctggatg aaatcggact gtactcttca ccttccgagt tccgccgcgg catcatttcc 2280 tgcaccggct tggagttctg caagcttgcg cacgcaacca ccaagtcacg agcaattgag 2340 cttgtcgacg aactggaaga gcgcctcggc gatttggatg ttcccatcaa gattgcactg 2400 aacggttgcc ctaactcttg tgcacgcacc caggtttccg acatcggatt caagggacag 2460 accgtcactg atgctgacgg caaccgcgtt gaaggtttcc aggttcacct gggcggttcc 2520 atgaacttgg atccaaactt cggacgcaag ctcaagggcc acaaggttat tgccgatgaa 2580 gtgggagagt acgtcactcg cgttgttacc cacttcaagg aacagcgcca cgaggacgag 2640 cacttccgcg attgggtcca gcgggccgct gaggaagatt tggtgtgagt cttcggagga 2700 aacccaatcc caaccgcaac caccctctgt actgcccata ctgcgcggga gaagttcttt 2760 tccccgatga gcaaacagaa ttcgcgtggt tgtgtgcgga ttgcaccaga gtttttgaag 2820 tgaaatatca cggccaggac gatccagtgc acaggccagc accagcaaag tccacatcgc 2880 aagcattaaa agaatctctc gaaagacaca aaagaggtga gtcgcaacaa tgagctttca 2940 actagttaac gccctgaaaa atactggttc ggtaaaagat cccgagatct cacccgaagg 3000 acctcgcacg accacaccgt tgtcaccaga ggtagcaaaa cataacgagg aactcgtcga 3060 aaagcatgct gctgcgttgt atgacgccag cgcgcaagag atcctggaat ggacagccga 3120 gcacgcgccg ggcgctattg cagtgacctt gagcatggaa aacaccgtgc tggcggagct 3180 ggctgcgcgg cacctgccgg aagctgattt cctctttttg gacaccggtt accacttcaa 3240 ggagaccctt gaagttgccc gtcaggtaga tgagcgctat tcccagaagc ttgtcaccgc 3300 gctgccgatc ctcaagcgca cggagcagga ttccatttat ggtctcaacc tgtaccgcag 3360 caacccagcg gcgtgctgcc gaatgcgcaa agttgaaccg ctggcggcgt cgttaagccc 3420 atacgctggc tggatcaccg gcctgcgccg cgctgatggc ccaacccgtg ctcaagcccc 3480 tgcgctgagc ttggatgcca ccggcaggct caagatttct ccaattatca cctggtcatt 3540 ggaggaaacc aacgagttca ttgcggacaa caacctcatc gatcacccac ttacccatca 3600 gggttatcca tca 3613 <210> 41 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primer <400> 41 caacgaaagg aaacaatgtc tacttcagtt acttc 35 <210> 42 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primer <400> 42 tagtcagaga gtgatttaga cgttaaagta ctttg 35 <210> 43 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 43 atcaaaacag atatcatgac aacaaccacc ggaag 35 <210> 44 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 44 cgctagtcag agagttcaca ccaaatcttc ctcag 35 <210> 45 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 45 ccgatcagcg taagtagaaa catcccagcg ctact 35 <210> 46 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 46 aactgaagta gacattgttt cctttcgttg ggtac 35 <210> 47 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 47 tactttaacg tctaaggtac cggcgcttca tgtca 35 <210> 48 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 48 ggtggttgtt gtcatgatat ctgttttgat ctcct 35 <210> 49 <211> 3261 <212> DNA <213> Corynebacterium glutamicum <400> 49 cctcactggc gaacacggcc gactcctgga acagcgcaac atggcatgga cgaaactcaa 60 cgaaatccca ggtgtcagct gtgtgaaacc aatggggagct ctatacgcgt tccccaagct 120 cgaccccaac gtgtacgaaa tccacgacga cacccaactc atgctggatc ttctccgtgc 180 cgagaaaatc ctcatggttc agggcactgg cttcaactgg ccacatcacg atcacttccg 240 agtggtcacc ctgccatggg catcccagtt ggaaaacgca attgagcgcc tgggtaactt 300 cctgtccact tacaagcagt agtagttgtt aggattcacc acgaatctca ggattttga gattcgtggt gattttgc gttttccagt caggctcctg caactttcgg accgatttca 420 gaggggcgga gctggtttgt ggtggatcct tgaatgga cctcgcagga agctttcagg 480 aagaccaagt tgggcctagg ggtggcggga ttgcaaaaat ccgtccccgg ttcgccatga 540 aatgctgatt ttgatcgaat ctttgcgcta actgtagggc gggttcaggg ggtgaatgca 660. cccgagca cccgaagggt gcgaagtggg cattcgtaga acaatcccag aggaaagccg tacggctttc ctcgacatga tcaatcaagg tatgtcaggt cttgctgcgt ctacagcggt 720 cggggtcagt gattcaccg ggcgaaagtg ggcgaaggcc gccggggtga aactgacccg 780 cggcccgcga ggtggcaatg cttttgacac cgccgagaaa cttgagattg cagccagcat 840 gctagagaaa ggatgcctac cccgagaaat cggcgagtat gtcggcatga ctcgggccaa fathercccta tggcgcaaac aaggcccaga caagcttcgc caacgcgcag ccaccttgcg caccggcaag cgagcagctg aattcatcca cgccccggtg atgggccctt attgggcc acgcacactc catcaagtgt tgcgtgagga ctacacaaca ctgtttgacg agttatctgc 1080 gttggggttg ccagcacagg tgtgtggggc cttacttcat cttgctccac caccatcatt 1140 acgcttttct tatatgtcgt gtgtagtgcc gttatttgct gatgaaatca aagtcgtagg 1200 acaaggcaca cgattatcgt tagaagagaa aatgatgatc caacgtttcc atgacaccgg 1260 ggtcagtgca gcagaaatcg gtcgacgcct gggtcggtgt cggcaaacaa tttccaggga 1320 acttcgacgt ggtcaagatg atgatggacg ttatcgtgca cgcgactcct atgaaggtgc 1380 gatcaggaaa ctagcgcgtc cgaaaacacc gaaacttgat gccaatcgta ggcttcgggc 1440 tgtggtggtc gaggcgttga samaaatt atctccggag cagatttctg gtcttttagc 1500 caccgagcat gctaacgata gctctatgca gattagtcat gaaactattt accaggcgtt 1560 atatgttcaa ggtaaagggg cgttgcgtga tgaattgaag gtggagaaat ttcttcgtac 1620 cggtcggaag ggacgtaaac cgcagtcgaa gttgccatcg agaggtaagc cgtgggtgga 1680 gggtgcgttg attagtcaac gcccagcaga agttgctgat cgtgctgtgc ctgggcactg 1740 ggagggcgat ttagtaattg gtggtgaaaa ccaagcgaca gcgttggtga cgttggtgga 1800 gcgcacgagc cggttgacgt tgattaagcg gttgggggtt aatcatgagg cgtcgactgt 1860 gacggatgcg ttggtggaga tgatgggtga tttgccgcag gcgttgcgtc ggagtttgac 1920 gtgggatcag ggtgtggaga tggcagagca tgcgcggttt agcgtggtga ccaagtgtcc 1980 ggtgtttttc tgtgatcctc attcgccgtg gcagcgtggg tcgaatgaga atacgaatgg 2040 attggtcagg gattttttcc cgaagggcac taattttgct aaagtaagtg acgaagaagt 2100 tcagcgggca caggatctgc tgaattaccg gccgcggaaa atgcatggtt ttaaaagcgc 2160 gacgcaggta tatgaaaaaa tcgtagttgg tgcatccacc gattgaattc gcctaggaga 2220 ttgtacgaaa attcgttcgg ctttcggatt tcctggcgat ctgagacgag aagttgaaca 2280 gctaacctgc agaaaccttg caagaatcac aacagcccca atggcctcaa aagtcacgcc 2340 ctcagaatcg ctgccaggcg tctaaatccc ctaaaacggg acaataggtc actgggcgat 2400 cccaagccct taaaacgtga tccttaaata cccactgtcc tctattctgg gttaggcttc 2460 actgggtaaa agtgcctgcc tatgcctgaa acttgagcat ggcaacagca aggagacacc 2520 gtgggaaaac atgcagctga aacatcggaa ccgaagaaaa attcaccgtg gcgcattggt 2580 ttgttgacgt ttttgatttc ttcagttgtc gtgacgctgg tgggcatggt gatgctgtgg 2640 ccggattctg atgatgtggt gttggcggat aacttttcgc agacgtttgc gggaaatcat 2700 gagcaggtgg atggaacgat cacgctcgtt gataattctg cgtgtaattc gccagacacc 2760 ggccgagttt ttgcggaaag ccccacgatt tctgcggagc cggcaacgtt ggagtgcgtg 2820 cgtgcactcg tagacatcac atcgggtgcc aatgaggggc agaaaactca gctgatcact 2880 tacgcgcaac ctggtgatcc ggagttttcc gagggcgaca agatccgcat ggtggaaaca 2940 ccggatacaa atggcgagat catctacacc tttgctgatt accagcgcgg accggcgttg 3000 atcatttggg gtgtggttct cattgtggcg atgggagctt tcgcggcgtg gcgaggtgtg 3060 cgtgcgctgg ttggtttggt cgtcaccttg ggaattgttg gtattttctt gctgccagga 3120 ttggccagcg ggcacgatgc gatgtggttg gcgctggtgt gtggcgcggc gatcttgttg 3180 attgtggtgc cgatggttca cggaatcaac tggaaatcgg cagctgcgtt ggcgggcacg 3240 ctggtggcat tgttgttgtc g 3261 <210> 50 <211> 40 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 50 gtacccgggg atcctctaga cctgggtaac ttcctgtcca 40 <210> 51 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 51 caggttagca gtacttctca agtttctcgg cggtg 35 <210> 52 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 52 aacttgagaa gtactgctaa cctgcagaaa ccttg 35 <210> 53 <211> 40 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 53 gcctgcaggt cgactctaga ctccgcagaa atcgtggggc 40 <210> 54 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 54 cgccgagaaa cttgagaagt ggcgcttcat gtcaa 35 <210> 55 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 55 ctgcaggtta gcagtttagt caaggccccg caaca 35 <210> 56 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 56 ctgcaggtta gcagttcaca agctgttaag cgaag 35 <210> 57 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 57 ctgcaggtta gcagttcaga tcaccgcgag cgcct 35 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 58 ttctccgtgc cgagaaaatc 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 59 gtagatgatc tcgccatttg 20 <210> 60 <211> 394 <212> PRT <213> Chromobacterium violaceum <400> 60 Met Ala Ser Asp Ala Pro His Leu Pro Leu His Pro Glu Thr Leu Ala 1 5 10 15 Ile Arg Ala Gly Leu Glu Thr Ser Gln Phe Asn Glu His Ser Gln Gly 20 25 30 Leu Phe Leu Thr Ser Ser Phe Thr Tyr Glu Ser Ala Ala Gln Ala Ala Ala 35 40 45 Ala Met Phe Leu Gly Glu Ile Asp Gly Tyr Thr Tyr Ser Arg Phe Thr 50 55 60 Asn Pro Thr Val Ala Ala Phe Gln His Arg Leu Ala Gln Met Glu Gly 65 70 75 80 Gly Glu Arg Ala Ile Ala Thr Ala Thr Gly Met Ala Ala Ile Gln Ala 85 90 95 Ile Met Met Thr Leu Leu Gln Ala Gly Asp His Ile Val Ser Ser Gln 100 105 110 Ser Leu Phe Gly Ser Thr Thr Asn Leu Phe Ala Asn Gln Leu Ala Lys 115 120 125 Phe Ala Val Ala Thr Asp Phe Val Asp Ala Arg Asp Leu Ser Ala Trp 130 135 140 Arg Glu Ala Leu Arg Pro Asn Thr Lys Leu Leu Phe Leu Glu Thr Pro 145 150 155 160 Ser Asn Pro Leu Thr Glu Val Ala Asp Ile Ala Ala Ile Ala Asp Ile 165 170 175 Ala His Ala His Gly Ala Leu Leu Val Val Asp Asn Ser Phe Cys Ser 180 185 190 Pro Ala Leu Gln Gln Pro Leu Lys Leu Gly Ala Asp Leu Val Met His 195 200 205 Ser Ala Thr Lys Phe Ile Asp Gly His Gly Arg Val Met Gly Gly Ala 210 215 220 Val Val Gly Ser Asp Lys Leu Val Glu Gln Val Tyr Leu His Val Arg 225 230 235 240 Ala Ala Gly Pro Ser Leu Ala Pro Phe Asn Ala Trp Thr Leu Leu Ser 245 250 255 Gly Leu Glu Thr Leu His Leu Arg Met Glu Lys His Ser Ala Asn Ala 260 265 270 Leu Glu Leu Ala Arg Trp Leu Glu Ala Gln Pro Asn Val Glu Arg Val 275 280 285 Tyr Tyr Pro Gly Leu Glu Ser His Pro Gln His Glu Leu Ala Leu Arg 290 295 300 Gln Gln Lys Ser Gly Gly Ala Val Val Ser Phe Val Val Lys Gly Gly 305 310 315 320 Arg Lys Ala Ala Trp Lys Val Val Asp Ala Val Arg Val Ile Ser Arg 325 330 335 Thr Ala Asn Leu Gly Asp Val Lys Thr Thr Leu Thr His Pro Ala Ser 340 345 350 Thr Thr His Ala Arg Val Thr Gln Glu Ala Arg Glu Arg Ala Gly Ile 355 360 365 Val Glu Gly Leu Leu Arg Val Ser Val Gly Leu Glu Asn Val Arg Asp 370 375 380 Leu Gln Gln Asp Leu Leu Arg Gly Leu Asp 385 390 <210> 61 <211> 399 <212> PRT <213> Unknown <220> <221> <222> <223> Hyphomonas neptunium <400> 61 Met Ala Asp Ala Pro Gly Gly Asp Lys Lys Gly Trp Lys Pro Ala Thr 1 5 10 15 Gln Ala Val Arg Gly Gly Leu Met Arg Ser Gln His Gly Glu Ile Ser 20 25 30 Glu Ala Leu Tyr Leu Thr Ser Gly Tyr Ala Tyr Asp Ser Ala Glu Gln 35 40 45 Ala Met Arg Arg Met Ala Gly Glu Glu Glu Gly Phe Val Tyr Ser Arg 50 55 60 Tyr Gly Ser Pro Thr Asn Glu Met Leu Gln Gln Arg Leu Ala Leu Ile 65 70 75 80 Glu Gly Ala Glu Ala Cys Arg Val Thr Gly Ser Gly Met Gly Ala Ile 85 90 95 Ser Ser Ala Ile Leu Ala Pro Leu Lys Ala Gly Asp Arg Val Val Ala 100 105 110 Ala Thr Ala Leu Phe Gly Ser Cys Arg Trp Ile Ile Ala Asn Gln Met 115 120 125 Pro Lys Phe Gly Ile Glu Ala Val Phe Val Asp Gly Ala Asp Leu Asp 130 135 140 Ala Trp Lys Arg Glu Ile Asp Lys Gly Cys Gln Leu Val Leu Ile Glu 145 150 155 160 Ser Pro Ala Asn Pro Leu Leu Asp Gly Val Asp Ile Glu Ala Val Ala 165 170 175 Arg Leu Ala Lys Ala Ala Gly Ala Leu Leu Val Val Asp Asn Val Phe 180 185 190 Ala Thr Pro Val Leu Gln Arg Pro Leu Glu Met Gly Ala Asp Val Ile 195 200 205 Ala Tyr Ser Ala Thr Lys His Met Asp Gly Gln Gly Arg Val Leu Leu 210 215 220 Gly Ala Ile Leu Thr Asp Ala Lys Arg Met Ser Asp Val Tyr Asp Pro 225 230 235 240 Trp Leu Arg His Met Gly Pro Ala Ala Ser Pro Phe Asn Ala Trp Val 245 250 255 Val Leu Lys Gly Leu Glu Thr Met Gln Leu Arg Val Glu Ala Gln Ser 260 265 270 Arg Thr Ala Ala Arg Leu Ala Asp Val Leu Ala Asp His Pro Ala Val 275 280 285 Asn Ala Val Arg Tyr Pro His Arg Lys Asp His Pro His Tyr Glu Val 290 295 300 His Lys Arg Gln Met Lys Ser Gly Gly Thr Leu Leu Ala Leu Ser Leu 305 310 315 320 Lys Gly Gly Gln Asp Ala Ala Phe Arg Phe Leu Asn Gly Leu Gln Leu 325 330 335 Val Asp Ile Cys Asn Asn Leu Gly Asp Thr Lys Ser Leu Ala Cys His 340 345 350 Pro Ser Thr Thr Thr His Arg Ala Leu Ser Asp Glu Asp Gln Ala Ala 355 360 365 Met Gly Leu Asp Arg Ser Trp Val Arg Leu Ser Val Gly Leu Glu Asp 370 375 380 Ala Asp Asp Leu Glu Ala Asp Leu Leu Ala Ser Leu Asn Ser Leu 385 390 395 <210> 62 <211> 393 <212> PRT <213> Rhodobacter sphaeroides <400> 62 Met Thr Lys Asp Trp Lys Thr Arg Thr Gln Leu Val His Gly Gly Ser 1 5 10 15 Arg Arg Ser Gln Tyr Gly Glu Met Ala Glu Ala Ile Phe Leu Thr Gln 20 25 30 Gly Phe Val Tyr Asp Ser Ala Glu Gln Ala Glu Ala Arg Phe Ile Glu 35 40 45 Thr Gly Ala Asp Glu Phe Ile Tyr Ala Arg Tyr Gly Asn Pro Thr Thr 50 55 60 Arg Met Phe Glu Glu Arg Ile Ala Ala Val Glu Gly Thr Glu Asp Ala 65 70 75 80 Phe Ala Thr Ala Ser Gly Met Ala Ala Ile His Gly Val Leu Thr Ser 85 90 95 Ile Val Arg Ala Gly Asp His Leu Val Ala Ala Arg Ala Leu Phe Gly 100 105 110 Ser Cys Ile Tyr Ile Leu Glu Glu Val Leu Gly Arg Phe Gly Val Glu 115 120 125 Val Thr Phe Val Asp Gly Thr Asp Leu Asp Gln Trp Arg Ala Ala Val 130 135 140 Arg Pro Gly Thr Lys Ala Val Phe Phe Glu Ser Val Ser Asn Pro Thr 145 150 155 160 Leu Glu Val Ala Asp Ile Gly Ala Ile Ala Glu Ile Ala His Ala Val 165 170 175 Gly Ala Leu Val Ile Val Asp Asn Val Phe Ala Thr Pro Val Phe Ser 180 185 190 Thr Ala Val Arg Gln Gly Ala Asp Val Val Ile Tyr Ser Ala Thr Lys 195 200 205 His Ile Asp Gly Gln Gly Arg Ala Leu Gly Gly Val Val Cys Ala Ser 210 215 220 Gln Ala Phe Ile Arg Lys Val Leu Glu Pro Phe Met Lys His Thr Gly 225 230 235 240 Gly Ser Met Ser Pro Phe Asn Ala Trp Leu Met Leu Asn Gly Met Ala 245 250 255 Thr Leu Asp Leu Arg Cys Arg Ala Met Ala Asp Thr Ala Glu Lys Ile 260 265 270 Ala Arg Ala Leu Glu Gly His Pro Gln Leu Gly Arg Val Ile His Pro 275 280 285 Ala Leu Glu Ser His Pro Gln His Glu Met Ala Lys Ala Gln Met Glu 290 295 300 Arg Pro Gly Thr Met Ile Ala Leu Asp Leu Ala Gly Gly Lys Glu Ala 305 310 315 320 Ala Phe Arg Phe Leu Asp Ala Leu Arg Ile Val Lys Ile Ser Asn Asn 325 330 335 Leu Gly Asp Ala Arg Ser Ile Ala Thr His Pro Ala Thr Thr Thr His 340 345 350 Gln Arg Leu Ser Asp Ala Gln Lys Ala His Leu Gly Ile Thr Pro Gly 355 360 365 Leu Val Arg Leu Ser Val Gly Leu Glu Asp Ala Asp Asp Leu Ile Ala 370 375 380 Asp Leu Lys Gln Ala Leu Ala Val Ile 385 390 <210> 63 <211> 1185 <212> DNA <213> Chromobacterium violaceum <400> 63 atggcatccg acgcgccgca tcttccgctg caccctgaaa ccctggccat ccgggccggg 60 ttggaaacca gccagttcaa cgagcacagc cagggcctgt tcctgacgtc cagcttcacc 120 tacgaatcgg ccgcgcaggc ggcggcgatg ttcctgggcg agatcgacgg ctacacctat 180 tcccgcttca ccaatccgac cgtcgccgcg ttccagcata ggctggcgca gatggagggc 240 ggggagcgcg ccatcgccac cgccaccggc atggcggcga tccaggccat catgatgact 300 ttgctgcagg ctggcgacca catcgtgtcg tcgcaaagcc tgttcggctc caccaccaat 360 ctgttcgcca accagttggc caagttcgcc gtggccaccg acttcgtcga cgcgcgcgac 420 ctgtccgcct ggcgggaggc gctgcggccg aacaccaagc tgctgttcct ggagacgccg 480 tccaatccct tgaccgaagt ggccgacatc gcggccatcg ccgacatcgc ccacgcgcat 540 ggcgcgctgc tggtggtgga caacagcttc tgttcgccgg ccttgcagca gccgttgaaa 600 ctgggcgccg atctggtcat gcattccgcc accaagttca tcgacggcca tggccgggtg 660 atgggcgggg cggtggtcgg cagcgacaag ctggtcgagc aggtctattt gcacgtgcgc 720 gccgccggtc cctcgctggc gccgttcaat gcctggacgc tgctgtccgg tttggagacg 780 ctgcacctgc ggatggagaa gcacagcgcc aacgcgctgg agctggcgcg ctggctggag 840 gcgcagccca atgtggagcg cgtctattac ccgggcctgg agagccaccc ccagcacgag 900 ctggcgctgc gccagcagaa gagcggcgga gcggtggtgt ccttcgtggt caagggcggc 960 cgcaaggccg cgtggaaagt ggtggacgcg gtcagggtga tctcgcgcac cgccaatctg 1020 ggcgatgtga aaaccaccct cactcatccg gccagcacca cccacgcccg cgtgacgcag 1080 gaggcgcgcg agcgcgccgg catcgtcgag gggctgttgc gcgtcagcgt cggcctggaa 1140 aatgtacggg accttcaaca agatctgttg cggggccttg actaa 1185 <210> 64 <211> 1200 <212> DNA <213> Unknown <220> <221> <222> <223> Hyphomonas neptunium <400> 64 atggcggatg cacccggcgg cgacaagaag ggctggaagc ctgcgaccca ggcggtacgc 60 ggcggcctga tgcggtccca gcatggggag atttccgagg cgctgtatct gacctccggc 120 tacgcttacg actcggccga gcaggcgatg cgccggatgg cgggcgagga agaaggcttc 180 gtctattccc gctatggcag cccgaccaat gagatgctgc aacagcgcct cgcgctgatt 240 gaaggcgccg aagcgtgccg ggtgacgggc tctggcatgg gcgcgatttc gtcggccatc 300 ctggcgccgc ttaaagcggg cgaccgggtg gtggcggcga ccgcgctgtt tggctcgtgc 360 cgctggatca ttgccaacca gatgccgaag tttggcatcg aggcagtgtt cgtggacggg 420 gccgatcttg atgcttggaa gcgcgagatc gacaagggct gccagctggt gctgatcgaa 480 agcccggcca atccgttgct cgacggcgtg gacatcgaag cggtcgccag gctcgccaag 540 gcggcgggcg cgctgctggt ggtggacaat gtgtttgcca cgccggtgct tcagcggccg 600 ctggaaatgg gcgccgatgt gatcgcctat tcggccacca aacatatgga cgggcagggc 660 cgcgttctgc tgggcgcgat cctgacggac gccaagcgga tgagtgatgt gtatgatccg 720 tggctgcgcc atatggggcc ggcggcctcg ccgtttaacg cctgggtagt gctgaagggc 780 cttgagacga tgcagctgcg cgtggaagcg cagagccgca cggcggcgcg gctggcggat 840 gttctggccg atcatccggc ggtcaatgcc gtgcgctatc cccaccgcaa ggatcacccg 900 cattatgagg tgcacaagcg ccagatgaaa tcgggcggca cgctgctcgc gctgtcgctc 960 aagggcgggc aggacgcggc gttccgcttc ctcaacgggc tgcagctggt cgacatctgc 1020 aacaaccttg gcgatacgaa atcgctggcc tgtcatccct ccaccacgac gcaccgcgcg 1080 ttgagtgatg aggatcaggc ggcgatgggg cttgaccgca gctgggtccg gctctctgtt 1140 ggtcttgaag acgcagatga tctggaagct gatcttctcg cttcgcttaa cagcttgtga 1200 1200 <210> 65 <211> 1182 <212> DNA <213> Rhodobacter sphaeroides <400> 65 atgacgaagg actggagac aaggacgcaa ctcgtccacg ggggcagccg ccggagccag 60 tatggcgaaa tggccgaggc gatcttcctg acccagggct tcgtctacga ctcggccgaa 120 caggccgaag cgcgcttcat cgagaccggc gccgacgaat tcatctatgc ccgctacggc 180 aaccccacga cgcgcatgtt cgaagagcgc atcgcggccg tcgagggcac cgaggatgcg 240 ttcgccaccg cctcgggcat ggccgcgatc cacggcgtgc tcacctcgat cgtgcgggcg 300 ggcgatcatc tggtggcggc gcgcgctctg ttcggctcct gcatctacat cctcgaggag 360 gtgctgggcc gattcggcgt cgaggtgacc ttcgtcgacg gcaccgatct cgatcagtgg 420 cgcgcggcgg tgcggcccgg cacgaaggcc gtgttcttcg agtcggtctc gaatccgacg 480 ctcgaggtgg ccgatatcgg cgccatcgcc gagatcgccc atgccgtggg cgcgctcgtc 540 atcgtggaca atgtcttcgc gacgccccgtc ttctcgacgg cggtgcggca gggcgcggat 600 gtggtgatct attcggccac caagcacatc gacgggcaag ggcgcgcgct cggcggcgtg 660 gtctgcgcct cgcaggcctt catccgcaag gtgctcgaac ccttcatgaa gcacaccggc 720 ggctcgatga gccccttcaa cgcctggctc atgctgaacg ggatggcgac gctcgacctg 780 cgctgccgcg cgatggccga cacggccgag aagatcgccc gcgcgctcga gggccatccg 840 cagctcggcc gcgtgatcca tcccgcgctg gaaagccacc cgcagcacga gatggccaag 900 gcgcagatgg agcgtcccgg cacgatgatc gcgctcgacc tcgccggggg caaggaggcg 960 gccttccgct tcctcgacgc cctgaggatc gtgaagatct ccaacaatct gggcgatgcc 1020 cgctcgatcg cgacccaccc ggcaacgacc acccaccagc gtctttccga cgcgcagaag 1080 gcccatctcg gcatcacgcc cgggctcgtg cggctgtcgg tggggctcga ggatgcggac 1140 gacctgatcg ccgatctgaa acaggcgctc gcggtgatct ga 1182 <210> 66 <211> 404 <212> PRT <213> Artificial Sequence <220> <221> <222> <223> RspmetZ_long <400> 66 Met Gly Ile Ala Phe Arg Glu Gly Arg Thr Gly Met Thr Lys Asp Trp 1 5 10 15 Lys Thr Arg Thr Gln Leu Val His Gly Gly Ser Arg Arg Ser Gln Tyr 20 25 30 Gly Glu Met Ala Glu Ala Ile Phe Leu Thr Gln Gly Phe Val Tyr Asp 35 40 45 Ser Ala Glu Gln Ala Glu Ala Arg Phe Ile Glu Thr Gly Ala Asp Glu 50 55 60 Phe Ile Tyr Ala Arg Tyr Gly Asn Pro Thr Thr Arg Met Phe Glu Glu 65 70 75 80 Arg Ile Ala Ala Val Glu Gly Thr Glu Asp Ala Phe Ala Thr Ala Ser 85 90 95 Gly Met Ala Ala Ile His Gly Val Leu Thr Ser Ile Val Arg Ala Gly 100 105 110 Asp His Leu Val Ala Ala Arg Ala Leu Phe Gly Ser Cys Ile Tyr Ile 115 120 125 Leu Glu Glu Val Leu Gly Arg Phe Gly Val Glu Val Thr Phe Val Asp 130 135 140 Gly Thr Asp Leu Asp Gln Trp Arg Ala Ala Val Arg Pro Gly Thr Lys 145 150 155 160 Ala Val Phe Phe Glu Ser Val Ser Asn Pro Thr Leu Glu Val Ala Asp 165 170 175 Ile Gly Ala Ile Ala Glu Ile Ala His Ala Val Gly Ala Leu Val Ile 180 185 190 Val Asp Asn Val Phe Ala Thr Pro Val Phe Ser Thr Ala Val Arg Gln 195 200 205 Gly Ala Asp Val Val Ile Tyr Ser Ala Thr Lys His Ile Asp Gly Gln 210 215 220 Gly Arg Ala Leu Gly Gly Val Val Cys Ala Ser Gln Ala Phe Ile Arg 225 230 235 240 Lys Val Leu Glu Pro Phe Met Lys His Thr Gly Gly Ser Met Ser Pro 245 250 255 Phe Asn Ala Trp Leu Met Leu Asn Gly Met Ala Thr Leu Asp Leu Arg 260 265 270 Cys Arg Ala Met Ala Asp Thr Ala Glu Lys Ile Ala Arg Ala Leu Glu 275 280 285 Gly His Pro Gln Leu Gly Arg Val Ile His Pro Ala Leu Glu Ser His 290 295 300 Pro Gln His Glu Met Ala Lys Ala Gln Met Glu Arg Pro Gly Thr Met 305 310 315 320 Ile Ala Leu Asp Leu Ala Gly Gly Lys Glu Ala Ala Phe Arg Phe Leu 325 330 335 Asp Ala Leu Arg Ile Val Lys Ile Ser Asn Asn Leu Gly Asp Ala Arg 340 345 350 Ser Ile Ala Thr His Pro Ala Thr Thr Thr His Gln Arg Leu Ser Asp 355 360 365 Ala Gln Lys Ala His Leu Gly Ile Thr Pro Gly Leu Val Arg Leu Ser 370 375 380 Val Gly Leu Glu Asp Ala Asp Asp Leu Ile Ala Asp Leu Lys Gln Ala 385 390 395 400 Leu Ala Val Ile <210> 67 <211> 404 <212> PRT <213> Artificial Sequence <220> <221> <222> <223> RspmetZ_3 <400> 67 Met Gly Asn Ala Phe Arg Glu Gly Arg Thr Gly Met Thr Lys Asp Trp 1 5 10 15 Lys Thr Arg Thr Gln Leu Val His Gly Gly Ser Arg Arg Ser Gln Tyr 20 25 30 Gly Glu Met Ala Glu Ala Ile Phe Leu Thr Gln Gly Phe Val Tyr Asp 35 40 45 Ser Ala Glu Gln Ala Glu Ala Arg Phe Ile Glu Thr Gly Ala Asp Glu 50 55 60 Phe Ile Tyr Ala Arg Tyr Gly Asn Pro Thr Thr Arg Met Phe Glu Glu 65 70 75 80 Arg Ile Ala Ala Val Glu Gly Thr Glu Asp Ala Phe Ala Thr Ala Ser 85 90 95 Gly Met Ala Ala Ile His Gly Val Leu Thr Ser Ile Val Arg Ala Gly 100 105 110 Asp His Leu Val Ala Ala Arg Ala Leu Phe Gly Ser Cys Ile Tyr Ile 115 120 125 Leu Glu Glu Val Leu Gly Arg Phe Gly Val Glu Val Thr Phe Val Asp 130 135 140 Gly Thr Asp Leu Asp Gln Trp Arg Ala Ala Val Arg Pro Gly Thr Lys 145 150 155 160 Ala Val Phe Phe Glu Ser Val Ser Asn Pro Thr Leu Glu Val Ala Asp 165 170 175 Ile Gly Ala Ile Ala Glu Ile Ala His Ala Val Gly Ala Leu Val Ile 180 185 190 Val Asp Asn Val Phe Ala Thr Pro Val Phe Ser Thr Ala Val Arg Gln 195 200 205 Gly Ala Asp Val Val Ile Tyr Ser Ala Thr Lys His Ile Asp Gly Gln 210 215 220 Gly Arg Ala Leu Gly Gly Val Val Cys Ala Ser Gln Ala Phe Ile Arg 225 230 235 240 Lys Val Leu Glu Pro Phe Met Lys His Thr Gly Gly Ser Met Ser Pro 245 250 255 Phe Asn Ala Trp Leu Met Leu Asn Gly Met Ala Thr Leu Asp Leu Arg 260 265 270 Cys Arg Ala Met Ala Asp Thr Ala Glu Lys Ile Ala Arg Ala Leu Glu 275 280 285 Gly His Pro Gln Leu Gly Arg Val Ile His Pro Ala Leu Glu Ser His 290 295 300 Pro Gln His Glu Met Ala Lys Ala Gln Met Glu Arg Pro Gly Thr Met 305 310 315 320 Ile Ala Leu Asp Leu Ala Gly Gly Lys Glu Ala Ala Phe Arg Phe Leu 325 330 335 Asp Ala Leu Arg Ile Val Lys Ile Ser Asn Asn Leu Gly Asp Ala Arg 340 345 350 Ser Ile Ala Thr His Pro Ala Thr Thr Thr His Gln Arg Leu Ser Asp 355 360 365 Ala Gln Lys Ala His Leu Gly Ile Thr Pro Gly Leu Val Arg Leu Ser 370 375 380 Val Gly Leu Glu Asp Ala Asp Asp Leu Ile Ala Asp Leu Lys Gln Ala 385 390 395 400 Lion Winged Val Island <210> 68 <211> 404 <212> PRT <213> Artificial Sequence <220> <221> <222> <223> RspmetZ_65 <400> 68 Met Gly Ile Ala Phe Arg Glu Gly Arg Thr Gly Met Thr Lys Asp Trp 1 5 10 15 Lys Thr Arg Thr Gln Leu Val His Gly Gly Ser Arg Arg Ser Gln Tyr 20 25 30 Gly Glu Met Ala Glu Ala Ile Phe Leu Thr Gln Gly Phe Val Tyr Asp 35 40 45 Ser Ala Glu Gln Ala Glu Ala Arg Phe Ile Glu Thr Gly Ala Asp Glu 50 55 60 Tyr Ile Tyr Ala Arg Tyr Gly Asn Pro Thr Thr Arg Met Phe Glu Glu 65 70 75 80 Arg Ile Ala Ala Val Glu Gly Thr Glu Asp Ala Phe Ala Thr Ala Ser 85 90 95 Gly Met Ala Ala Ile His Gly Val Leu Thr Ser Ile Val Arg Ala Gly 100 105 110 Asp His Leu Val Ala Ala Arg Ala Leu Phe Gly Ser Cys Ile Tyr Ile 115 120 125 Leu Glu Glu Val Leu Gly Arg Phe Gly Val Glu Val Thr Phe Val Asp 130 135 140 Gly Thr Asp Leu Asp Gln Trp Arg Ala Ala Val Arg Pro Gly Thr Lys 145 150 155 160 Ala Val Phe Phe Glu Ser Val Ser Asn Pro Thr Leu Glu Val Ala Asp 165 170 175 Ile Gly Ala Ile Ala Glu Ile Ala His Ala Val Gly Ala Leu Val Ile 180 185 190 Val Asp Asn Val Phe Ala Thr Pro Val Phe Ser Thr Ala Val Arg Gln 195 200 205 Gly Ala Asp Val Val Ile Tyr Ser Ala Thr Lys His Ile Asp Gly Gln 210 215 220 Gly Arg Ala Leu Gly Gly Val Val Cys Ala Ser Gln Ala Phe Ile Arg 225 230 235 240 Lys Val Leu Glu Pro Phe Met Lys His Thr Gly Gly Ser Met Ser Pro 245 250 255 Phe Asn Ala Trp Leu Met Leu Asn Gly Met Ala Thr Leu Asp Leu Arg 260 265 270 Cys Arg Ala Met Ala Asp Thr Ala Glu Lys Ile Ala Arg Ala Leu Glu 275 280 285 Gly His Pro Gln Leu Gly Arg Val Ile His Pro Ala Leu Glu Ser His 290 295 300 Pro Gln His Glu Met Ala Lys Ala Gln Met Glu Arg Pro Gly Thr Met 305 310 315 320 Ile Ala Leu Asp Leu Ala Gly Gly Lys Glu Ala Ala Phe Arg Phe Leu 325 330 335 Asp Ala Leu Arg Ile Val Lys Ile Ser Asn Asn Leu Gly Asp Ala Arg 340 345 350 Ser Ile Ala Thr His Pro Ala Thr Thr Thr His Gln Arg Leu Ser Asp 355 360 365 Ala Gln Lys Ala His Leu Gly Ile Thr Pro Gly Leu Val Arg Leu Ser 370 375 380 Val Gly Leu Glu Asp Ala Asp Asp Leu Ile Ala Asp Leu Lys Gln Ala 385 390 395 400 Leu Ala Val Ile <210> 69 <211> 404 <212> PRT <213> Artificial Sequence <220> <221> <222> <223> RspmetZ_104 <400> 69 Met Gly Ile Ala Phe Arg Glu Gly Arg Thr Gly Met Thr Lys Asp Trp 1 5 10 15 Lys Thr Arg Thr Gln Leu Val His Gly Gly Ser Arg Arg Ser Gln Tyr 20 25 30 Gly Glu Met Ala Glu Ala Ile Phe Leu Thr Gln Gly Phe Val Tyr Asp 35 40 45 Ser Ala Glu Gln Ala Glu Ala Arg Phe Ile Glu Thr Gly Ala Asp Glu 50 55 60 Phe Ile Tyr Ala Arg Tyr Gly Asn Pro Thr Thr Arg Met Phe Glu Glu 65 70 75 80 Arg Ile Ala Ala Val Glu Gly Thr Glu Asp Ala Phe Ala Thr Ala Ser 85 90 95 Gly Met Ala Ala Ile His Gly Ala Leu Thr Ser Ile Val Arg Ala Gly 100 105 110 Asp His Leu Val Ala Ala Arg Ala Leu Phe Gly Ser Cys Ile Tyr Ile 115 120 125 Leu Glu Glu Val Leu Gly Arg Phe Gly Val Glu Val Thr Phe Val Asp 130 135 140 Gly Thr Asp Leu Asp Gln Trp Arg Ala Ala Val Arg Pro Gly Thr Lys 145 150 155 160 Ala Val Phe Phe Glu Ser Val Ser Asn Pro Thr Leu Glu Val Ala Asp 165 170 175 Ile Gly Ala Ile Ala Glu Ile Ala His Ala Val Gly Ala Leu Val Ile 180 185 190 Val Asp Asn Val Phe Ala Thr Pro Val Phe Ser Thr Ala Val Arg Gln 195 200 205 Gly Ala Asp Val Val Ile Tyr Ser Ala Thr Lys His Ile Asp Gly Gln 210 215 220 Gly Arg Ala Leu Gly Gly Val Val Cys Ala Ser Gln Ala Phe Ile Arg 225 230 235 240 Lys Val Leu Glu Pro Phe Met Lys His Thr Gly Gly Ser Met Ser Pro 245 250 255 Phe Asn Ala Trp Leu Met Leu Asn Gly Met Ala Thr Leu Asp Leu Arg 260 265 270 Cys Arg Ala Met Ala Asp Thr Ala Glu Lys Ile Ala Arg Ala Leu Glu 275 280 285 Gly His Pro Gln Leu Gly Arg Val Ile His Pro Ala Leu Glu Ser His 290 295 300 Pro Gln His Glu Met Ala Lys Ala Gln Met Glu Arg Pro Gly Thr Met 305 310 315 320 Ile Ala Leu Asp Leu Ala Gly Gly Lys Glu Ala Ala Phe Arg Phe Leu 325 330 335 Asp Ala Leu Arg Ile Val Lys Ile Ser Asn Asn Leu Gly Asp Ala Arg 340 345 350 Ser Ile Ala Thr His Pro Ala Thr Thr Thr His Gln Arg Leu Ser Asp 355 360 365 Ala Gln Lys Ala His Leu Gly Ile Thr Pro Gly Leu Val Arg Leu Ser 370 375 380 Val Gly Leu Glu Asp Ala Asp Asp Leu Ile Ala Asp Leu Lys Gln Ala 385 390 395 400 Leu Ala Val Ile <210> 70 <211> 404 <212> PRT <213> Artificial Sequence <220> <221> <222> <223> RspmetZ_196 <400> 70 Met Gly Ile Ala Phe Arg Glu Gly Arg Thr Gly Met Thr Lys Asp Trp 1 5 10 15 Lys Thr Arg Thr Gln Leu Val His Gly Gly Ser Arg Arg Ser Gln Tyr 20 25 30 Gly Glu Met Ala Glu Ala Ile Phe Leu Thr Gln Gly Phe Val Tyr Asp 35 40 45 Ser Ala Glu Gln Ala Glu Ala Arg Phe Ile Glu Thr Gly Ala Asp Glu 50 55 60 Phe Ile Tyr Ala Arg Tyr Gly Asn Pro Thr Thr Arg Met Phe Glu Glu 65 70 75 80 Arg Ile Ala Ala Val Glu Gly Thr Glu Asp Ala Phe Ala Thr Ala Ser 85 90 95 Gly Met Ala Ala Ile His Gly Val Leu Thr Ser Ile Val Arg Ala Gly 100 105 110 Asp His Leu Val Ala Ala Arg Ala Leu Phe Gly Ser Cys Ile Tyr Ile 115 120 125 Leu Glu Glu Val Leu Gly Arg Phe Gly Val Glu Val Thr Phe Val Asp 130 135 140 Gly Thr Asp Leu Asp Gln Trp Arg Ala Ala Val Arg Pro Gly Thr Lys 145 150 155 160 Ala Val Phe Phe Glu Ser Val Ser Asn Pro Thr Leu Glu Val Ala Asp 165 170 175 Ile Gly Ala Ile Ala Glu Ile Ala His Ala Val Gly Ala Leu Val Ile 180 185 190 Val Asp Asn Ile Phe Ala Thr Pro Val Phe Ser Thr Ala Val Arg Gln 195 200 205 Gly Ala Asp Val Val Ile Tyr Ser Ala Thr Lys His Ile Asp Gly Gln 210 215 220 Gly Arg Ala Leu Gly Gly Val Val Cys Ala Ser Gln Ala Phe Ile Arg 225 230 235 240 Lys Val Leu Glu Pro Phe Met Lys His Thr Gly Gly Ser Met Ser Pro 245 250 255 Phe Asn Ala Trp Leu Met Leu Asn Gly Met Ala Thr Leu Asp Leu Arg 260 265 270 Cys Arg Ala Met Ala Asp Thr Ala Glu Lys Ile Ala Arg Ala Leu Glu 275 280 285 Gly His Pro Gln Leu Gly Arg Val Ile His Pro Ala Leu Glu Ser His 290 295 300 Pro Gln His Glu Met Ala Lys Ala Gln Met Glu Arg Pro Gly Thr Met 305 310 315 320 Ile Ala Leu Asp Leu Ala Gly Gly Lys Glu Ala Ala Phe Arg Phe Leu 325 330 335 Asp Ala Leu Arg Ile Val Lys Ile Ser Asn Asn Leu Gly Asp Ala Arg 340 345 350 Ser Ile Ala Thr His Pro Ala Thr Thr Thr His Gln Arg Leu Ser Asp 355 360 365 Ala Gln Lys Ala His Leu Gly Ile Thr Pro Gly Leu Val Arg Leu Ser 370 375 380 Val Gly Leu Glu Asp Ala Asp Asp Leu Ile Ala Asp Leu Lys Gln Ala 385 390 395 400 Leu Ala Val Ile <210> 71 <211> 404 <212> PRT <213> Artificial Sequence <220> <221> <222> <223> RspmetZ_3_65_104 <400> 71 Met Gly Asn Ala Phe Arg Glu Gly Arg Thr Gly Met Thr Lys Asp Trp 1 5 10 15 Lys Thr Arg Thr Gln Leu Val His Gly Gly Ser Arg Arg Ser Gln Tyr 20 25 30 Gly Glu Met Ala Glu Ala Ile Phe Leu Thr Gln Gly Phe Val Tyr Asp 35 40 45 Ser Ala Glu Gln Ala Glu Ala Arg Phe Ile Glu Thr Gly Ala Asp Glu 50 55 60 Tyr Ile Tyr Ala Arg Tyr Gly Asn Pro Thr Thr Arg Met Phe Glu Glu 65 70 75 80 Arg Ile Ala Ala Val Glu Gly Thr Glu Asp Ala Phe Ala Thr Ala Ser 85 90 95 Gly Met Ala Ala Ile His Gly Ala Leu Thr Ser Ile Val Arg Ala Gly 100 105 110 Asp His Leu Val Ala Ala Arg Ala Leu Phe Gly Ser Cys Ile Tyr Ile 115 120 125 Leu Glu Glu Val Leu Gly Arg Phe Gly Val Glu Val Thr Phe Val Asp 130 135 140 Gly Thr Asp Leu Asp Gln Trp Arg Ala Ala Val Arg Pro Gly Thr Lys 145 150 155 160 Ala Val Phe Phe Glu Ser Val Ser Asn Pro Thr Leu Glu Val Ala Asp 165 170 175 Ile Gly Ala Ile Ala Glu Ile Ala His Ala Val Gly Ala Leu Val Ile 180 185 190 Val Asp Asn Val Phe Ala Thr Pro Val Phe Ser Thr Ala Val Arg Gln 195 200 205 Gly Ala Asp Val Val Ile Tyr Ser Ala Thr Lys His Ile Asp Gly Gln 210 215 220 Gly Arg Ala Leu Gly Gly Val Val Cys Ala Ser Gln Ala Phe Ile Arg 225 230 235 240 Lys Val Leu Glu Pro Phe Met Lys His Thr Gly Gly Ser Met Ser Pro 245 250 255 Phe Asn Ala Trp Leu Met Leu Asn Gly Met Ala Thr Leu Asp Leu Arg 260 265 270 Cys Arg Ala Met Ala Asp Thr Ala Glu Lys Ile Ala Arg Ala Leu Glu 275 280 285 Gly His Pro Gln Leu Gly Arg Val Ile His Pro Ala Leu Glu Ser His 290 295 300 Pro Gln His Glu Met Ala Lys Ala Gln Met Glu Arg Pro Gly Thr Met 305 310 315 320 Ile Ala Leu Asp Leu Ala Gly Gly Lys Glu Ala Ala Phe Arg Phe Leu 325 330 335 Asp Ala Leu Arg Ile Val Lys Ile Ser Asn Asn Leu Gly Asp Ala Arg 340 345 350 Ser Ile Ala Thr His Pro Ala Thr Thr Thr His Gln Arg Leu Ser Asp 355 360 365 Ala Gln Lys Ala His Leu Gly Ile Thr Pro Gly Leu Val Arg Leu Ser 370 375 380 Val Gly Leu Glu Asp Ala Asp Asp Leu Ile Ala Asp Leu Lys Gln Ala 385 390 395 400 Leu Ala Val Ile <210> 72 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 72 atcaaaacag atatcatggg tatcgcgttt cgtga 35 <210> 73 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 73 ccttcacgaa acgcgttacc catgatatct g 31 <210> 74 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 74 cagatatcat gggtaacgcg tttcgtgaag g 31 <210> 75 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 75 tagcgggcat agatgtattc gtcggcgccg g 31 <210> 76 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 76 ccggcgccga cgaatacatc tatgcccgct a 31 <210> 77 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 77 acgatcgagg tgagcgcgcc gtggatcgcg g 31 <210> 78 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primers <400> 78 ccgcgatcca cggcgcgctc acctcgatcg t 31 <210> 79 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primer <400> 79 cgggcgtcgc gaagatattg tccacgatga c 31 <210> 80 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> Primer <400> 80 gtcatcgtgg acaatatctt cgcgacgccc g 31 <210> 81 <211> 5803 <212> DNA <213> Artificial Sequence <220> <221> <222> <223> pDCM2 <400> 81 gttcgcttgc tgtccataaa accgcccagt ctagctatcg ccatgtaagc ccactgcaag 60 ctacctgctt tctctttgcg cttgcgtttt cccttgtcca gatagcccag tagctgacat 120 tcatccgggg tcagcaccgt ttctgcggac tggctttcta cgtgttccgc ttcctttagc 180 agcccttgcg ccctgagtgc ttgcggcagc gtgaagctag cttttatcgc cattcgccat 240 tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc 300 tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt 360 cacgacgttg taaaacgacg gccagtgaat tcgagctcgg tacccgggga tcctctagag 420 tcgacctgca ggcatgcaag cttggcgtaa tcatggtcat agctgtttcc tgtgtgaaat 480 tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg taaagcctgg 540 ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc cgctttccag 600 tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt 660 ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg 720 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg 780 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 840 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 900 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 960 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 1020 tttctccctt cgggaagcgt ggcgctttct caatgctcac gctgtaggta tctcagttcg 1080 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 1140 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 1200 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 1260 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct 1320 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc 1380 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 1440 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 1500 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttgggg 1560 tgggcgaaga actccagcat gagatccccg cgctggagga tcatccagcc ctgatagaaa 1620 cagaagccac tggagcacct caaaaacacc atcatacact aaatcagtaa gttggcagca 1680 tcacccgacg cactttgcgc cgaataaata cctgtgacgg aagatcactt cgcagaataa 1740 ataaatcctg gtgtccctgt tgataccggg aagccctggg ccaacttttg gcgaaaatga 1800 gacgttgatc ggcacgtaag aggttccaac tttcaccata atgaaataag atcactaccg 1860 ggcgtatttt ttgagttatc gagattttca ggagctgata gaaacagaag ccactggagc 1920 acctcaaaaa caccatcata cactaaatca gtaagttggc agcatcaccc gacgcacttt 1980 gcgccgaata aatacctgtg acggaagatc acttcgcaga ataaataaat cctggtgtcc 2040 ctgttgatac cgggaagccc tgggccaact tttggcgaaa atgagacgtt gatcggcacg 2100 taagaggttc caactttcac cataatgaaa taagatcact accgggcgta ttttttgagt 2160 tatcgagatt ttcaggagct ctttggcatc gtctctcgcc tgtcccctca gttcagtaat 2220 ttcctgcatt tgcctgtttc cagtcggtag atattccaca aaacagcagg gaagcagcgc 2280 ttttccgctg cataaccctg cttcggggtc attatagcga ttttttcggt atatccatcc 2340 tttttcgcac gatatacagg attttgccaa agggttcgtg tagactttcc ttggtgtatc 2400 caacggcgtc agccgggcag gataggtgaa gtaggcccac ccgcgagcgg gtgttccttc 2460 ttcactgtcc cttattcgca cctggcggtg ctcaacggga atcctgctct gcgaggctgg 2520 ccggctaccg ccggcgtaac agatgagggc aagcggatgg ctgatgaaac caagccaacc 2580 aggaagggca gcccacctat caaggtgtac tgccttccag acgaacgaag agcgattgag 2640 gaaaaggcgg cggcggccgg catgagcctg tcggcctacc tgctggccgt cggccagggc 2700 tacaaaatca cgggcgtcgt ggactatgag cacgtccgcg agggcgtccc ggaaaacgat 2760 tccgaagccc aacctttcat agaaggcggc ggtggaatcg aaatctcgtg atggcaggtt 2820 gggcgtcgct tggtcggtca tttcgaaaaa ggttaggaat acggttagcc atttgcctgc 2880 ttttatatag ttcantatgg gattcacctt tatgttgata agaaataaaaa gaaaatgcca 2940 ataggatatc ggcattttct tttgcgtttt tatttgttaa ctgttaattg tccttgttca 3000 aggatgctgt ctttgacaac agatgttttc ttgcctttga tgttcagcag gaagctcggc 3060 gcaaacgttg attgtttgtc tgcgtagaat cctctgtttg tcatatagct tgtaatcacg 3120 acattgtttc ctttcgcttg aggtacagcg aagtgtgagt aagtaaaggt tacatcgtta 3180 ggcggatcaa gatccatttt taacacaagg ccagttttgt tcagcggctt gtatgggcca 3240 gttaaagaat tagaaacata accaagcatg taaatatcgt tagacgtaat gccgtcaatc 3300 gtcatttttg atccgcggga gtcagtgaac aggtaccatt tgccgttcat tttaaagacg 3360 ttcgcgcgtt caatttcatc tgttactgtg ttagatgcaa tcagcggttt catcactttt 3420 ttcagtgtgt aatcatcgtt tagctcaatc ataccgagag cgccgtttgc taactcagcc 3480 gtgcgttttt tatcgctttg cagaagtttt tgactttctt gacggaagaa tgatgtgctt 3540 ttgccatagt atgctttgtt aaataaagat tcttcgcctt ggtagccatc ttcagttcca 3600 gtgtttgctt caaatactaa gtatttgtgg cctttatctt ctacgtagtg aggatctctc 3660 agcgtatggt tgtcgcctga gctgtagttg ccttcatcga tgaactgctg tacattttga 3720 tacgtttttc cgtcaccgtc aaagattgat ttataatcct ctacaccgtt gatgttcaaa 3780 gagctgtctg atgctgatac gttaacttgt gcagttgtca gtgtttgttt gccgtaatgt 3840 ttaccggaga aatcagtgta gaataaacgg atttttccgt cagatgtaaa tgtggctgaa 3900 cctgaccatt cttgtgtttg gtcttttagg atagaatcat ttgcatcgaa ttgtcgctg 3960 tctttaaaga cgcggccagc gtttttccag ctgtcaatag aagtttcgcc gactttttga 4020 tagaacatgt aaatcgatgt gtcatccgca tttttaggat ctccggctaa tgcaaagacg 4080 atgtggtagc cgtgatagtt tgcgacagtg ccgtcagcgt tttgtaatgg ccagctgtcc 4140 caaacgtcca ggccttttgc agaagagata ttttaattg tggacgaatc aaattcagaa 4200 acttgatatt tttcattttt ttgctgttca gggatttgca gcatatcatg gcgtgtaata 4260 tgggaaatgc cgtatgtttc cttatatggc ttttggttcg tttctttcgc aaacgcttga 4320 gttgcgcctc ctgccagcag tgcggtagta aaggttaata ctgttgcttg tttgcaaac 4380 ttttgatgt tcatcgttca tgtctcctt tttatgtact gtgttagcgg tctgcttctt 4440 ccagccctcc tgtttgaaga tggcaagtta gttacgcaca ataaaaaaag acctaaaata 4500 tgtaaggggt gacgccaaag tatacacttt gccctttaca cattttaggt cttgcctgct 4560 tttcagtaa caaacccgcg cgatttactt ttcgacctca ttctattaga ctctcgtttg 4620 gattgcaact ggtctatttt cctcttttgt ttgatagaaa atcataaaag gatttgcaga 4680 ctacgggcct aaagaactaa aaaatctatc tgtttctttt cattctctgt attttttata 4740 gtttctgttg catgggcata aagttgcctt tttaatcaca attcagaaaa tatcataata 4800 tctcatttca ctaaataata gtgaacggca ggtatatgtg atgggttaaa aaggatcacc 4860 ccagagtccc gctcagaaga actcgtcaag aaggcgatag aaggcgatgc gctgcgaatc 4920 gggagcggcg ataccgtaaa gcacgaggaa gcggtcagcc cattcgccgc caagctcttc 4980 agcaatatca cgggtagcca acgctatgtc ctgatagcgg tccgccacac ccagccggcc 5040 acagtcgatg aatccagaaa agcggccatt ttccaccatg atattcggca agcaggcatc 5100 gccatgggtc acgacgagat cctcgccgtc gggcatccgc gccttgagcc tggcgaacag 5160 ttcggctggc gcgagcccct gatgctcttc gtccagatca tcctgatcga caagaccggc 5220 ttccatccga gtacgtgctc gctcgatgcg atgtttcgct tggtggtcga atgggcaggt 5280 agccggatca agcgtatgca gccgccgcat tgcatcagcc atgatggata ctttctcggc 5340 aggagcaagg tgagatgaca ggagatcctg ccccggcact tcgcccaata gcagccagtc 5400 ccttcccgct tcagtgacaa cgtcgagaca gctgcgcaag gaacgcccgt cgtggccagc 5460 cacgatagcc gcgctgcctc gtcttggagt tcattcaggg caccggacag gtcggtcttg 5520 acaaaaagaa ccgggcgccc ctgcgctgac agccggaaca cggcggcatc agagcagccg 5580 attgtctgtt gtgcccagtc atagccgaat agcctctcca cccaagcggc cggagaacct 5640 gcgtgcaatc catcttgttc aatcatgcga aacgatcctc atcctgtctc ttgatcagat 5700 cttgatcccc tgcgccatca gatccttggc ggcaagaaag ccatccagtt tactttgcag 5760 ggcttcccaa ccttaccaga gggcgcccca gctggcaatt ccg 5803

[0011] BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 A diagram of the pDCM2 plasmid is shown.

[0013] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] The present application is described in detail below. At the same time, each description and each embodiment disclosed in the present application can also be applied to other descriptions and embodiments. In other words, all combinations of the various elements disclosed in the present application fall within the scope of the present application. In addition, the scope of the present application is not limited by the specific description described below.

[0015] In addition, those skilled in the art will recognize or be able to determine, using only routine experimentation, many equivalents of the specific embodiments of the present application described herein. In addition, these equivalents should be construed to fall within the content of the present application.

[0016] One aspect of the present application provides an L-methionine-producing microorganism, into which a protein encoded by an exogenous metZ gene is introduced.

[0017] Another aspect of the present invention provides a method for producing L-methionine, which comprises culturing an L-methionine-producing microorganism in a medium containing thiosulfate.

[0018] The term "metZ gene" used herein is a gene encoding an enzyme involved in sulfur hydration using acylhomoserine as a substrate.

[0019] The term "acyl homoserine" used herein refers to a compound in which an acyl group is bound to homoserine, and includes succinyl homoserine and acetyl homoserine. For example, acyl homoserine may be O-succinyl homoserine or O-acetyl homoserine, but is not limited thereto.

[0020] The term enzyme encoded by the metZ gene used herein may be succinylhomoserine sulfhydrylase, acetylhomoserine sulfhydrylase, or an enzyme involved in sulfur hydration using O-succinylhomoserine as a substrate, but is not limited thereto.

[0021] As used herein, the term "sulfhydration" may be used interchangeably with the term "sulfhydrylation" and refers to a reaction that provides a sulfhydryl (-SH) group to a specific molecule. For the purposes of this application, the term may refer to a reaction in the synthesis of methionine, but is not limited thereto. Enzymes involved in "sulfhydration" may also be referred to as "sulfhydrylating enzymes," but are not limited thereto.

[0022] In traditional methionine fermentation, the enzyme expressed by the metZ gene has been used in vitro for the following reactions:

[0023] CH3SH+O-acetyl-L-homoserine=>acetate+methionine

[0024] CH3SH+O-succinyl-L-homoserine=>succinate+methionine

[0025] In other words, in a method for producing methionine, the method includes a first step of preparing a methionine precursor using a microorganism; and a second step of adding methyl mercaptan and methionine converting enzyme to a fermentation broth containing the methionine precursor for an in vitro enzyme reaction, and the enzyme expressed by the metZ gene acts as a methionine converting enzyme in vitro (see US 2010-0184164 A1).

[0026] Meanwhile, in the fermentation of methionine in Corynebacterium microorganisms, two sulfur hydration pathways (sulfhydration steps) are used (Hwang BJ et al., J Bacteriol 184 (5): 1277–1286, 2002). One of them is to convert O-acetyl homoserine (acetyl homoserine: AH) into cystathionine using an enzyme encoded by the metB gene. In this case, cysteine ​​is used as a sulfur source. In other words, the reaction in which acyl homoserine and cysteine ​​are converted into cystathionine as reactants is called "transsulfurization", and the enzyme involved in the reaction is called "transsulfurase". Another is to convert O-acetyl homoserine into homocysteine ​​using an enzyme encoded by the metY gene. In this case, an inorganic sulfur compound (such as hydrogen sulfide, etc.) is used as a sulfur source. In this reaction in which acyl homoserine and hydrogen sulfide are converted into homocysteine ​​as reactants, cystathionine as an intermediate is not produced in the process of producing homocysteine ​​(methionine precursor), which is different from the above-mentioned transsulfurization. This reaction is called direct sulfhydration.

[0027] In other words, the sulfur hydration pathway may refer to a reaction pathway for converting acyl homoserine into another substance by reacting with a sulfur source, and may be mainly divided into transsulfurization and direct sulfur hydration.

[0028] However, in Corynebacterium strains, both enzymes involved in sulfur hydration have disadvantages. For example, the protein encoded by the metB gene produces homolanthionine as a byproduct in addition to cystathionine by using acetylhomoserine and homocysteine ​​(Kromer JO et al., J Bacteriol 188(2):609–618, 2006). In addition, the metY gene is known to be feedback inhibited by methionine (Yeom HJ et al., J Microbiol Biotechnol 14(2):373–378, 2004).

[0029] The present application is characterized in that an exogenous metZ gene is introduced into a Corynebacterium strain to biologically produce methionine by only a single-step reaction, and it is demonstrated that the introduction of the metZ gene can be effectively applied to methionine fermentation.

[0030] In the methionine synthesis pathway in which the protein encoded by the metZ gene of the present application participates, the generation of by-products can be reduced. The by-product can be homolanthionine. The generation of by-products can be reduced, compared with the generation of by-products in the synthesis pathway in which the protein encoded by the metB gene participates, but is not limited thereto.

[0031] Therefore, compared with methionine-producing microorganisms without the introduction of exogenous metZ gene, the microorganisms of the present application that introduce exogenous metZ gene and the method for producing methionine including culturing the microorganisms can show reduced production of byproducts. The protein encoded by the metZ gene of the present application may not be subject to feedback inhibition by methionine.

[0032] The protein encoded by the metZ gene of the present application is an O-acylhomoserine sulfhydrylase (sulfhydrylase) that can utilize hydrogen sulfide as a sulfur source, and is also an O-acylhomoserine transsulfurase that can utilize cysteine ​​as a sulfur source. More specifically, the protein can be an O-acetylhomoserine sulfhydrylase, an O-acetylhomoserine transsulfurase, an O-succinylhomoserine sulfhydrylase or an O-succinylhomoserine transsulfurase. Therefore, the protein encoded by the metZ gene of the present application can be a protein with O-acylhomoserine sulfhydrylase activity, specifically, it can be a protein with one or more activities of O-acetylhomoserine sulfhydrylase, O-acetylhomoserine transsulfurase, O-succinylhomoserine sulfhydrylase and O-succinylhomoserine transsulfurase.

[0033] For example, the exogenous metZ gene of the present application can be a gene derived from an L-methionine producing microorganism different from the gene introduced into the gene, or can be a gene different from the gene inherently present in the L-methionine producing microorganism introduced into the gene. Specifically, the gene can be a gene named metZ derived from Chromobacterium violaceum, Hyphomonas neptunium or Rhodobacter sphaeroides, but is not limited thereto. For the purpose of the present application, the gene can include any gene without limitation, as long as it can enhance L-methionine production capacity. The sequence of the metZ gene can be obtained from the known database GenBank of NCBI, and as a method for obtaining the corresponding sequence, various methods known in the art are applicable.

[0034] In the present application, the protein encoded by exogenous metZ may include any one or more of the polypeptide sequences selected from SEQ ID NOs: 60, 61 and 62, and amino acid sequences (polypeptide sequences) having 90% or higher homology or identity therewith, but are not limited thereto. For example, the protein may include a polypeptide sequence having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 97.7%, 97.8%, 98%, 98.5%, 98.7%, 98.8%, 99%, 99.5%, 99.7%, 99.8% or less than 100% homology or identity with any one of the polypeptide sequences of SEQ ID NOs: 60, 61 and 62. For example, the protein may include any one of the polypeptide sequences of SEQ ID NOs: 66-71 and polypeptide sequences having 90% or higher homology or identity therewith, but are not limited thereto.

[0035] The metZ gene of the present application may include any one or more of the polynucleotide sequences selected from SEQ ID NO: 63, 64 and 65, and polynucleotide sequences having 90% or higher homology or identity therewith, but is not limited thereto. For example, the gene may include any one or more polynucleotide sequences selected from SEQ ID NO: 63, 64 and 65, and polynucleotide sequences having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 97.7%, 97.8%, 98%, 98.5%, 98.7%, 98.8%, 99%, 99.5%, 99.7%, 99.8% or less than 100% homology or identity therewith.

[0036] The term "polynucleotide" as used herein refers to a DNA chain having a predetermined length or longer, which is a long-chain polymer of nucleotides formed by linking nucleotide monomers by covalent bonds.

[0037] In the present application, as long as the metZ gene includes a polynucleotide encoding a protein encoded by any one or more polynucleotide sequences selected from SEQ ID NOs: 63, 64 and 65, or a polynucleotide encoding a protein having the efficacy corresponding to a protein having any one or more amino acid sequences of SEQ ID NOs: 60, 61 and 62, it is obvious that a part of the sequence in any polynucleotide encoding the amino acid sequence is deleted, modified, substituted or added, which also falls within the scope of the present application.

[0038] For example, the metZ gene may be a gene encoding an amino acid sequence having a partial (e.g., 1 to 20 amino acids) substitution in any one of the amino acid sequences of SEQ ID NOs: 60, 61, and 62. In another embodiment, the metZ gene may be a sequence encoding an amino acid sequence to which 20, 19, 18, 17, 16, 15, 14, 13, 12, or 11 or fewer amino acid sequences are added before / after the amino acid sequence. In another embodiment, the metZ gene may be a sequence encoding an amino acid sequence including all of the above substitutions and additions, but is not limited thereto.

[0039] In addition, probes generated from known nucleotide sequences, such as polynucleotides that hybridize to the complementary sequence of all or part of a polynucleotide sequence under stringent conditions, may also be included, but are not limited thereto.

[0040] In other words, although described in the present application as "a polynucleotide comprising a nucleotide sequence of a specific sequence number", "a polynucleotide consisting of a nucleotide sequence of a specific sequence number" or "a polynucleotide having a nucleotide sequence of a specific sequence number", it is clear that the situation where a part of the sequence in any polynucleotide encoding an amino acid sequence is deleted, modified, substituted, conservatively substituted or added can also be included in the scope of the present application, as long as it has the same or corresponding activity as the polypeptide encoded by the nucleotide sequence consisting of the polynucleotide of the sequence number. For example, it may be the situation where a sequence that does not change the function of the protein, a naturally occurring mutation, a silent mutation or a conservative substitution is added to the N-terminus and / or C-terminus of the amino acid sequence.

[0041] As used herein, the term "conservative substitution" refers to the substitution of an amino acid with another amino acid of similar structure and / or chemical properties. Such amino acid substitutions generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic properties of the residues.

[0042] The terms "homology" or "identity" as used herein refer to the degree of relatedness between two given nucleotide sequences and can be expressed as a percentage.

[0043] The terms "homology" and "identity" are often used interchangeably.

[0044] The sequence homology or identity of conservative polynucleotides can be determined by standard comparison algorithms and can be used together with the default gap penalty established by the program used. Basically, homologous or identical sequences are usually expected to hybridize with all or at least about 50%, 60%, 70%, 80% or 90% of the total length of the sequence under medium or high stringency conditions. Polynucleotides containing degenerate codons rather than common codons in the hybridizing polynucleotides are also considered.

[0045] Whether any two polynucleotide sequences have homology, similarity or identity can be determined by known computer algorithms, such as the "FASTA" program of Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444, using default parameters. Alternatively, it can be performed by the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), which is performed using the Needleman program of the EMBOSS program package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (version 5.0.0 or higher) (GCG program package (Devereux, J., et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S. F., et al., J MOLEC BIOL 215:403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and CARILLO et al.). al. (1988) SIAM J Applied Math 48:1073). For example, BLAST or ClustalW from the National Center for Biotechnology Information can be used to determine homology, similarity or identity.

[0046] Homology, similarity or identity of polynucleotides can be determined by comparing sequence information using, for example, the GAP computer program (Needleman et al. (1970), J Mol Biol. 48: 443), as disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2: 482. Briefly, the GAP program defines homology, similarity or identity as the value obtained by dividing the number of similarly aligned symbols (i.e., nucleotides or amino acids) by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program may include (1) a binary comparison matrix (containing values ​​of 1 for identical and 0 for non-identical) and the weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res. 14: 6745, as disclosed in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353–358 (1979). (or, the substitution matrix of EDNAFULL (EMBOSS version of NCBI NUC4.4); (2) the penalty for each gap is 3.0, and the additional penalty for each symbol in each gap is 0.10 (or the gap opening penalty is 10 and the gap extension penalty is 0.5); (3) there is no penalty for end gaps.

[0047] In addition, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity to each other can be identified by comparing the sequences under defined stringent conditions in a Southern hybridization experiment, and the definition of appropriate hybridization conditions is within the skills of those skilled in the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0048] In addition, due to codon degeneracy or considering the codons of polynucleotides in the organisms preferred for expression, in the polynucleotides of the present application, various modifications can be made in the coding region, as long as it does not change the polypeptide sequence. In addition, probes can be prepared from known gene sequences, for example, any polynucleotide sequence that can be hybridized with all or part of the complementary sequences of nucleotide sequences under stringent conditions, and the production capacity of L-methionine can be increased, rather than the naturally occurring sequence in the microorganisms introducing the sequence, including but not limited to this." stringent conditions" refer to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in various documents (for example, J.Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989), and are well known in the art. For example, stringent conditions may include conditions under which genes having high homology or identity of 40% or more, particularly 70% or more, 80% or more, 85% or more, 90% or more, more particularly 95% or more, more particularly 97% or more, more particularly 99% or more hybridize with each other, and genes having homology or identity lower than the above homology or identity do not hybridize with each other. Or common washing conditions for Southern hybridization, i.e., washing once, particularly washing twice or three times at a salt concentration and temperature corresponding to 60°C, 1×SSC, 0.1%SDS, particularly 60°C, 0.1×SSC, 0.1%SDS, more particularly 68°C, 0.1×SSC, 0.1%SDS.

[0049] Hybridization requires that the two polynucleotides have complementary sequences, but mismatches between bases are possible, depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize to each other. For example, for DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application can include isolated polynucleotide fragments that are complementary to the entire sequence and polynucleotide sequences that are essentially similar to them.

[0050] Specifically, polynucleotides having homology or identity can be detected using hybridization conditions, which include hybridization under the above conditions at a temperature of 55°C. m The hybridization step under the value. In addition, T m The value may be 60° C., 63° C., or 65° C., but is not limited thereto, and may be appropriately adjusted by those skilled in the art according to their purpose.

[0051] The appropriate stringency for hybridization of polynucleotides depends on the length of the polynucleotides and the degree of complementation, and variable factors are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0052] The term "protein introduction" as used herein refers to a microorganism showing an activity of a specific protein that was not originally present therein, or means that the microorganism shows an enhanced activity compared to the intrinsic activity of the protein or the activity before modification. For example, this may mean introducing a specific protein, introducing a polynucleotide encoding a specific protein into the chromosome of a microorganism, or introducing a vector containing a polynucleotide encoding a specific protein into a microorganism, so that its activity is expressed. In the present application, protein introduction can also be expressed as enhancing protein activity in a microorganism that does not have a specific protein activity.

[0053] Protein introduction can be by introducing the exogenous polynucleotide of the protein with the activity identical / similar to the activity of the above-mentioned protein, or by introducing the variant polynucleotide of codon optimization into host cell and carry out.Any exogenous polynucleotide sequence can be used, is not limited to source or sequence, as long as it shows the activity identical / similar to the activity of the above-mentioned protein.In addition, exogenous polynucleotide can be introduced into host cell after optimizing codon, so that transcription and translation of optimization can occur in host cell.The known transformation method that can be suitably selected by those skilled in the art is introduced, and protein can be produced by expressing the polynucleotide introduced in host cell, and as a result, its activity can be improved.

[0054] The activity of the introduced protein can be enhanced by:

[0055] 1) increasing the intracellular copy number of a gene or a polynucleotide encoding the protein,

[0056] 2) replacing the gene expression regulatory region on the chromosome encoding the protein with a sequence having strong activity,

[0057] 3) Modify the nucleotide sequence of the start codon or 5'-UTR region of the protein,

[0058] 4) Modify the polynucleotide sequence on the chromosome to increase the activity of the protein,

[0059] 5) Combinations of the above methods, but not limited thereto.

[0060] The term "vector" as used herein refers to a DNA construct containing a target polynucleotide sequence, which is operably linked to a suitable regulatory sequence so that the target gene can be introduced into a suitable host. Regulatory sequences include promoters capable of initiating transcription, any operator sequences for controlling transcription, sequences encoding suitable mRNA ribosome binding domains, and sequences regulating transcription and translation termination. After transformation into a suitable host cell, the vector can be replicated or function independently of the host genome, and can be integrated into the host genome itself. For example, the target polynucleotide in the chromosome can be replaced by a modified polynucleotide for a chromosome insertion vector. Insertion of a polynucleotide into a chromosome can be performed by any method known in the art, such as homologous recombination, but is not limited thereto.

[0061] The vector of the present application is not particularly limited, and any vector known in the art can be used. Examples of common vectors may include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, as phage vectors or cosmid vectors, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used, and as plasmid vectors, those based on pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, pET can be used. Specifically, pDZ, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc. can be used.

[0062] The term "transformation" as used herein refers to the process of introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. As long as the converted polynucleotide can be expressed in the host cell, it can be inserted into the chromosome of the host cell and located therein or located outside the chromosome, and both situations can be included at the same time. In addition, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide can be introduced in any form, as long as it can be introduced into the host cell and expressed therein. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression. The expression cassette can generally include a promoter operably connected to the polynucleotide, a transcription terminator, a ribosome binding domain and a translation terminator. The expression cassette can be in the form of an expression vector capable of self-replication. In addition, the polynucleotide can be introduced into the host cell as it is and operably connected to the sequence necessary for expression in the host cell, but is not limited thereto.

[0063] In addition, the term "operably linked" as used herein refers to a functional connection between the above-mentioned gene sequence and the promoter sequence, which initiates and mediates the transcription of the polynucleotide encoding the target protein of the present application.

[0064] The method for transforming the vector of the present application includes any method for introducing nucleic acid into cells, and can be carried out by selecting suitable standard techniques known in the art according to the host cell. For example, the method may include electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) technology, DEAE-dextran technology, cationic liposome technology, lithium acetate-DMSO technology, etc., but is not limited thereto.

[0065] The microorganism of the present application can include wild-type microorganisms and natural or artificial genetically modified microorganisms. As explained in the present application, any microorganisms that introduce or contain exogenous metZ gene can be included without any limitation.

[0066] The microorganism may be an L-methionine-producing microorganism, and the microorganism comprises any one or more exogenous metZ genes of the present application, proteins encoded thereby, and a vector comprising the metZ gene.

[0067] The term "L-methionine producing microorganism" used herein includes all wild-type microorganisms, or naturally or artificially genetically modified microorganisms, and the microorganism may be a microorganism in which a specific mechanism is weakened or enhanced due to the insertion of a foreign gene or the enhancement or inactivation of the activity of an endogenous gene, and the microorganism may be a microorganism including a genetic modification for producing the desired L-methionine.

[0068] The L-methionine-producing microorganism may be a microorganism comprising a protein encoded by the exogenous metZ gene of the present application, thereby having an enhanced ability to produce L-methionine compared to a parent strain or an unmodified microorganism.

[0069] The term "strain before modification" or "microorganism before modification" as used herein may refer to, but not exclude, strains, wild-type strains or natural strains themselves, including mutations that may exist naturally in microorganisms, or strains before characteristics are changed due to genetic variations caused by natural or artificial factors. "Strain before modification" or "microorganism before modification" can be used interchangeably with "unmodified strain", "unmodified type strain", "unmodified microorganism", "unmodified type microorganism" or "reference microorganism". Alternatively, it can be a microorganism in which the expression level of genes involved in the L-methionine biosynthetic pathway is not regulated, or a microorganism in which the metZ gene is inherently absent and has not been introduced.

[0070] The L-methionine-producing microorganism of the present application may be a microorganism having enhanced L-methionine production ability by enhancing the activity of a part of proteins in the L-methionine biosynthesis pathway or by weakening the activity of a part of proteins in the L-methionine decomposition pathway.

[0071] Specifically, examples of proteins or genes whose expression can be regulated to enhance the L-methionine biosynthetic pathway or weaken / inactivate the L-methionine decomposition pathway are as follows: Describe the protein, the representative gene encoding the protein, and the representative EC number in sequence. The protein starts with a capital letter and the gene is italicized. For example, the L-amino acid biosynthetic pathway can be enhanced or the L-amino acid decomposition pathway can be weakened by enhancing the activity of a part of one or more proteins or systems selected from the following or by overexpressing the polynucleotides encoding them: thiosulfate sulfotransferase such as Rdl2p, GlpE, PspE, YgaP, ThiI, YbbB, SseA, YnjE, YceA, YibN, NCgl0671, NCgl1369, NCgl2616, NCgl0053, NCgl0054, NCGl2678, NCgl2890, etc.; sulfite reductase, cysI; thiosulfate / sulfate transport system, cysPUWA (EC3.6.3.25); 3'-phosphoadenosine 5'-phosphosulfate reductase, cysH (EC1.8.4.8); sulfite reductase, cysJI (EC1.8.1.2); cysteine ​​synthetase A, cysK (EC2.5.1.47); cysteine ​​synthase B, cysM (EC2.5.1.47); serine acetyltransferase, cysE (EC2.3.1.30); glycine cleavage system, gcvTHP-1pd (EC2.1.2.10, EC1.4.4.2, EC1.8.1.4); acyl synthase, lipA (EC2.8.1.8); acyl-protein ligase, lipB (EC 2.3.1.181); phosphoglycerate dehydrogenase, serA (EC 1.1.1.1.95); 3-phosphoserine phosphatase, serB (EC 3.1.3.3); 3-phosphoserine / phosphohydroxythreonine aminotransferase, serC (EC 2.6.1.52); serine hydroxymethyltransferase, glyA (EC 2.1.2.1); aspartate kinase I (EC2.7.2.4); homoserine dehydrogenase I, thrA (EC1.1.1.3); aspartate kinase, lysC (EC2.7.2.4); homoserine dehydrogenase, hom (EC1.1.1.1.3); homoserine O-acetyltransferase, metX (EC2.3.1.31); homoserine O-succinyltransferase, metA (EC2.3.1.46); cystathionine γ-synthase, metB (EC2.5.1.48); β-CS-lyase, aecD (EC4.4.1.8, β-lyase); cystathionine β-lyase, metC (EC4.4.1.8); B12-independent homocysteine ​​S-methyltransferase, metE (EC 2.1.1.1.14); methionine synthase, metH (EC 2.1.1.13); methylenetetrahydrofolate reductase, metF (EC1.5.1.20); L-methionine export protein, BrnFE; valine export protein, YgaZH (B2682, B2683), ygaZH (B2682, B2683); export protein YjeH, b4141; pyridine nucleotide transhydrogenase PntAB, pntAB (EC1.6.1.2); and phosphoenolpyruvate carboxylase Pyc (EC4.1.1.1.31). Alternatively, the activity of one or more proteins selected from the following can be inactivated or attenuated, or the expression of genes encoding these proteins can be inhibited or eliminated: glucose 6-phosphate isomerase, pgi (EC5.3.1.9); homoserine kinase, thrB (EC2.7.1.39); S-adenosylmethionine synthase, metK (EC2.5.1.6); dihydropicolinate synthase, dapA (EC4.2.1.52); phosphoenolpyruvate carboxykinase, pck (EC4.1.1.1.49); formyltetrahydrofolate hydrolase, purU (EC3.5.1.10); pyruvate kinase I, pykF (EC 2.7.1.40); pyruvate kinase II, pykA (EC2.7.1.40); cystathionine gamma-lyase, cg3086 (EC4.4.1.1); cystathionine beta-synthase, cg2344 (EC4.2.1.22); regulatory protein Cg3031, cg3031; methionine and cysteine ​​biosynthesis inhibitory protein McbR, mcbR; L-methionine (Met) transcriptional inhibitory protein, metJ; L-methionine transporter MetQNI, metQ, metN, metI; N-acyltransferase, yncA; sRNAfnrS; and L-methionine transporter, metP. .

[0072] In a specific embodiment, the L-methionine production microorganism of the present application may include one or more genetic modifications selected from the following in addition to the introduction of metZ: weakening or inactivation of the activity of cystathionine gamma synthase; weakening or inactivation of the activity of O-acetylhomoserine sulfhydrylase; weakening or inactivation of the activity of methionine-cysteine ​​biosynthesis inhibitor protein; enhancement of methionine synthase activity; enhancement of sulfite reductase activity. Alternatively, the genetic modification may include one or more modifications selected from the following: deletion / expression inhibition of metB gene; metY gene deletion; deletion / expression inhibition of mcbR gene; enhanced expression of metH and cysI genes. For example, metB gene, metY gene, mcbR gene, metH gene and cysI gene may include polynucleotide sequences having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology or identity with the polynucleotide sequences of SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:1, SEQ ID NO:39 and SEQ ID NO:40, respectively, but are not limited thereto. The above description of homology or identity also applies to metB, metY, mcbR, metH and cysI genes.

[0073] However, the above genes are merely examples and are not limited thereto, and the microorganism may be a microorganism in which the activity of various known proteins of the L-methionine biosynthesis pathway is enhanced or the activity of proteins of the L-methionine decomposition pathway is inactivated or weakened.

[0074] As used herein, the term "enhancement" of the activity of a polypeptide or protein refers to the activity of a polypeptide or protein that is enhanced compared to the intrinsic activity of the polypeptide or protein. Enhancement can be used interchangeably with the terms "upregulation", "overexpression", "increase", etc. In this article, compared to the intrinsic activity before modification, increase can include showing an activity that was not originally present or showing an improved activity. The term "intrinsic activity" refers to the activity of a specific polypeptide or protein that a parent strain or unmodified microorganism originally had before transformation when the genetic modification caused by natural or artificial factors changes the trait. This can be used interchangeably with the term "activity before modification". "Compared to the intrinsic activity, the activity of a polypeptide or protein is enhanced or improved" refers to the activity that is improved compared to the activity of a specific polypeptide or protein that a parent strain or unmodified microorganism originally had before transformation. "Activity increase" can be achieved by introducing exogenous polypeptides or proteins or by enhancing the activity of intrinsic polypeptides or proteins, particularly by enhancing the activity of intrinsic polypeptides or proteins. Whether the activity of a polypeptide or protein is enhanced can be identified by the activity degree of the corresponding polypeptide or protein, the increase in the amount of the expression level or the product of the corresponding protein.

[0075] Various methods well known in the art can be used to enhance the activity of a polypeptide or protein, and the method is not limited, as long as the activity of the desired polypeptide or protein can be enhanced compared to the activity of the microorganism before modification. The method can be, but is not limited to, using genetic engineering and / or protein engineering methods well known to those skilled in the art, which are conventional molecular biology methods (Sitnicka et al. "Functional Analysis of Genes". Advances in Cell Biology. 2010, Vol. 2.1-16; Sambrook et al. Molecular Cloning 2012, etc.).

[0076] The method of using genetic engineering to enhance the activity of a polypeptide or protein can be implemented, for example, by the following method:

[0077] 1) A method for increasing the intracellular copy number of a gene or polynucleotide encoding a polypeptide or protein;

[0078] 2) A method of replacing the gene expression regulatory region on the chromosome encoding a polypeptide or protein with a sequence having strong activity,

[0079] 3) A method for modifying the nucleotide sequence of the start codon or 5'-UTR region of a polypeptide or protein,

[0080] 4) A method for modifying a polynucleotide sequence on a chromosome to increase the activity of a polypeptide or protein,

[0081] 5) a method of introducing an exogenous polynucleotide that exhibits polypeptide or protein activity or introducing a variant polynucleotide by codon optimization of the polynucleotide, or

[0082] 6) Combinations of the above methods, but not limited to these.

[0083] The method of enhancing the activity of a polypeptide or protein using protein engineering can be performed by, for example, analyzing the tertiary structure of the polypeptide or protein, selecting an exposed site, and then changing or chemically modifying the site, but is not limited thereto.

[0084] 1) The method of increasing the intracellular copy number of a gene or polynucleotide encoding a polypeptide or protein can be performed by any method known in the art, for example, by introducing a vector into a host cell, the vector is operably linked to a gene or polynucleotide encoding the corresponding polypeptide or protein, and can replicate and function independently of the host cell. Alternatively, it can be performed by introducing a vector into a host cell, the vector is operably linked to a gene, and can insert a gene or polynucleotide into a chromosome of the host cell, but is not limited thereto. The vector is the same as described above.

[0085] 2) The method of replacing the gene expression regulatory region (or expression regulatory sequence) on the chromosome encoding the polypeptide or protein with a sequence having strong activity can be carried out by any method known in the art, such as introducing mutations in the sequence by deletion, insertion, non-conservative or conservative substitution of the nucleotide sequence or a combination thereof to further enhance the activity of the expression regulatory region, or by replacing the sequence with a nucleotide sequence having stronger activity. The expression regulatory region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence regulating transcription and translation termination, etc. This method can particularly connect a strong heterologous promoter instead of replacing the original promoter, but is not limited thereto.

[0086] Examples of known strong promoters may include cj1 to cj7 promoters (U.S. Patent No. 7662943B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (U.S. Patent No. 10584338B2), O2 promoter (U.S. Patent No. 10273491B2), tkt promoter, yccA promoter, etc., but are not limited to these.

[0087] 3) The method of modifying the start codon or the nucleotide sequence of the 5′-UTR region of a polypeptide or protein can be performed by any method known in the art, for example, by replacing the inherent start codon of the polypeptide or protein with another start codon, wherein the other start codon has a higher expression rate of the polypeptide or protein than the inherent start codon, but is not limited thereto.

[0088] 4) The method of modifying the polynucleotide sequence on the chromosome to increase the activity of the polypeptide or protein can be carried out by any method known in the art, for example, by deletion, insertion, non-conservative or conservative substitution of the nucleotide sequence or a combination thereof, introducing mutations in the expression control sequence to further enhance the activity of the polynucleotide sequence, or by replacing the sequence with a polynucleotide sequence improved to have stronger activity. The replacement can be carried out by inserting the gene specifically into the chromosome by homologous recombination, but is not limited thereto.

[0089] The vector used herein may further include a selection marker to identify chromosome insertion. The selection marker is the same as above.

[0090] 5) The method of introducing an exogenous polynucleotide that exhibits polypeptide or protein activity can be carried out by any method known in the art, for example, by introducing an exogenous polynucleotide encoding a polypeptide or protein that exhibits the same / similar activity as the polypeptide or protein, or a codon-optimized variant polynucleotide into a host cell. Any exogenous polynucleotide can be used, without limitation to its source or sequence, as long as it exhibits the same or similar activity as the polypeptide or protein. In addition, the exogenous polynucleotide can be introduced into the host cell after codon optimization so that optimized transcription and translation occur in the host cell. The introduction can be carried out by a known transformation method appropriately selected by a person skilled in the art, and the polynucleotide introduced into the host cell is expressed to produce a polypeptide or protein, and as a result, its activity can be increased.

[0091] Finally, 6) can be a combination of methods by applying any one or more of the methods from 1) to 5).

[0092] The enhanced activity of a polypeptide or protein can be based on the activity or concentration of the polypeptide or protein expressed in a wild-type strain or a microbial strain before modification, an increase in the activity or concentration of the corresponding polypeptide or protein, or an increase in the amount of a product produced from the corresponding polypeptide or protein, but is not limited thereto.

[0093] The concept of "inactivation" or "attenuation" of the term polypeptide or protein used herein includes all situations where the activity is reduced or the activity is missing compared to the intrinsic activity. Inactivation or attenuation can be used interchangeably with the terms "downregulation", "reduction", "reduction", etc. Inactivation or attenuation can also include situations where the activity of the protein itself is reduced or removed due to mutations in the gene encoding the protein, etc. compared to the activity of the protein originally possessed by the microorganism, situations where the total level of intracellular protein activity is lower than the total level of the natural strain due to expression inhibition or translation inhibition of the gene encoding the protein, situations where the expression of the gene does not occur at all, and situations where the protein does not show activity even if expressed. The term "intrinsic activity" refers to the activity of a specific polypeptide or protein originally possessed by the parent strain or unmodified microorganism before transformation when the trait is changed due to genetic modification caused by natural or artificial factors. "Intrinsic activity" can be used interchangeably with the term "activity before modification". "Compared with the intrinsic activity, the activity of a polypeptide or protein is reduced" refers to the activity reduced compared to the activity of a specific polypeptide or protein originally possessed by the parent strain or unmodified microorganism before transformation.

[0094] Inactivation or attenuation of protein activity can be achieved by, but not limited to, various methods well known in the art (Nakashima N et al., "Bacterial cellular engineering by genome editing and gene silencing". Int J Mol Sci. 2014; 15(2): 2773-2793; Sambrook et al. Molecular Cloning 2012; etc.).

[0095] Examples of methods may include:

[0096] 1) A method of deleting all or part of a gene encoding a protein;

[0097] 2) A method of modifying the expression regulatory region (or expression regulatory sequence) to reduce the expression of the gene encoding the protein;

[0098] 3) A method for modifying the gene sequence encoding a protein so that the protein activity is removed or weakened;

[0099] 4) A method of introducing an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to a transcript of a gene encoding a protein;

[0100] 5) A method of adding a complementary sequence to a Shine-Dalgarno sequence upstream of a protein-coding gene to form a secondary structure, thereby inhibiting ribosome binding; and

[0101] 6) Reverse transcription engineering (RTE) method, which adds a promoter to the 3′ end of the open reading frame (ORF) of the polynucleotide sequence of a gene encoding a protein so as to be reverse transcribed, and can be achieved by a combination of the above methods, but is not particularly limited thereto.

[0102] Specifically, a method for deleting part or all of a gene encoding a protein can be performed by replacing a polynucleotide encoding an endogenous target protein in a chromosome with a polynucleotide having a partially deleted nucleotide sequence or marker gene via a vector for inserting into the chromosome of a microorganism. An example of a method for deleting part or all of a polynucleotide can be a method for deleting a polynucleotide by homologous recombination, but is not limited thereto.

[0103] In addition, the method of deleting some or all of the genes can be carried out by using light (such as UV) or chemical substances to induce mutations, and then selecting the strain in which the target gene is deleted from the obtained mutant. The method of deleting genes includes the method by DNA recombination technology. DNA recombination technology can be carried out by, for example, injecting a nucleotide sequence having homology with the target gene or a vector comprising the nucleotide sequence into a microorganism to induce homologous recombination. In addition, the nucleotide sequence or vector to be injected can include a dominant selection marker, but is not limited to this.

[0104] In addition, the method of modifying the expression control sequence can be achieved by applying various methods well known in the art. Examples of methods can be induced mutations in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution or a combination thereof of the polynucleotide sequence to further weaken the activity of the expression control region (or expression control sequence), or by replacing the sequence with a polynucleotide sequence with weaker activity. The expression control region may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence regulating transcription and translation termination, etc., but is not limited thereto.

[0105] In addition, the method of modifying the gene sequence can be to induce mutations in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further weaken the activity of the polypeptide, or by replacing the sequence with a gene sequence that is changed to have weaker activity or a gene sequence that is changed to have no activity, but is not limited to this.

[0106] For example, by introducing a mutation into the gene sequence to form a stop codon, the expression of a gene can be inhibited or attenuated.

[0107] However, the above methods are only examples, and methods for enhancing or inactivating protein activity and gene manipulation methods are known in the art, and therefore, L-methionine-producing microorganisms can be prepared by applying various known methods.

[0108] The microorganism of the present application may be a microorganism of the genus Corynebacterium.

[0109] In the present application, "microorganisms of the genus Corynebacterium" may include all microorganisms of the genus Corynebacterium, in particular Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagene, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens, more specifically Corynebacterium glutamicum.

[0110] Substratum and other culture conditions that are used to cultivate the microorganism of the present application can be any substratum that is generally used to cultivate Corynebacterium microorganism, but without any special restriction.Particularly, the microorganism of the present application can be cultivated under aerobic or anaerobic conditions in the common substratum containing suitable carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid and / or vitamin etc., and regulates temperature, pH etc. simultaneously.

[0111] In the present application, the carbon source may include carbohydrates such as glucose, fructose, sucrose, maltose, etc.; carbohydrates such as glucose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysates, molasses, blackstrap molasses, rice bran, cassava, cane molasses, corn syrup, etc. may be used, and specifically, carbohydrates such as glucose, sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used. In addition, various other carbon sources may be used in appropriate amounts without limitation. These carbon sources may be used alone or in combination of two or more thereof, but are not limited thereto.

[0112] The nitrogen source may include an inorganic nitrogen source such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; and an organic nitrogen source such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more thereof, but are not limited thereto.

[0113] The phosphorus source may include monopotassium phosphate, dipotassium phosphate or corresponding sodium salts, etc. The inorganic compound may include sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, etc.

[0114] The sulfur source may include alkanesulfonates, such as methanesulfonates and ethanesulfonates, organic and inorganic sulfur-containing compounds, such as sulfates, sulfites, hydrogen sulfide (e.g., H2S), sulfides, sulfide derivatives, mixtures of organic and inorganic sulfur-containing compounds, and thiosulfates, such as thioglycolates, thiocyanates, and / or thioureas, or the sulfur source may not include substances other than thiosulfates, but is not limited thereto.

[0115] The method for producing L-methionine of the present application may include culturing a microorganism in a culture medium containing thiosulfate. Specifically, the microorganism of the present application may be a microorganism comprising exogenous metZ and utilizing thiosulfate as a sulfur source. Thiosulfate can be used as a sulfur source for the microorganism, but is not limited thereto.

[0116] As the inorganic compound, sodium chloride, calcium chloride, ferric chloride, calcium carbonate, etc. can be used. In addition, the culture medium may include vitamins and / or suitable precursors, etc. Vitamins or precursors may be added to the culture medium in a batch or continuous manner, but are not limited thereto.

[0117] In the present application, the pH of the culture medium can be adjusted during the cultivation of the microorganism by adding a compound (such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc.) to the culture medium in an appropriate manner. In addition, during the cultivation process, a defoaming agent (such as fatty acid polyethylene glycol ester) can be added to prevent the generation of foam. In addition, oxygen or oxygen-containing gas can be injected into the culture medium to maintain the aerobic state of the culture medium; or gas can be not injected, or nitrogen, hydrogen or carbon dioxide gas can be injected into the culture medium to maintain an anaerobic or microaerobic state, but is not limited thereto.

[0118] The temperature of the culture medium may be 25° C. to 40° C., more specifically 28° C. to 37° C., but not limited thereto. The culture may be continued until a desired amount of useful substances is obtained, specifically 1 hour to 100 hours, but not limited thereto.

[0119] The method for producing methionine of the present application may include recovering L-methionine from the microorganism or the culture medium.

[0120] The target sulfur-containing amino acid or sulfur-containing amino acid derivative can be recovered from the culture medium using a suitable method known in the art according to the method for culturing the microorganism of the present application, such as batch, continuous or fed-batch culture method. For example, methods such as centrifugation, filtration, treatment with a protein crystallization precipitant (salting out method), extraction, ultrasonic treatment, ultrafiltration, dialysis, various chromatography (such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, etc.) and HPLC can be used alone or in combination, but the method is not limited thereto.

[0121] The method may include additional purification processes. In the purification process, suitable purification methods known in the art can be used.

[0122] Still another aspect of the present application provides a composition for producing L-methionine, the composition comprising a microorganism and thiosulfate.

[0123] The composition of the present application may further include any suitable excipients commonly used in compositions for producing L-methionine, and these excipients may include, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, isotonic agents, etc., but are not limited thereto.

[0124] Another aspect of the present application provides a method for preparing an L-methionine-producing microorganism, the method comprising the step of introducing a protein encoded by an exogenous metZ gene into the microorganism.

[0125] Another aspect of the present application provides use of a microorganism in L-methionine production, wherein a protein encoded by an exogenous metZ gene is introduced into the microorganism.

[0126] The microorganism, the exogenous metZ gene and the protein encoded by it, and the introduction of the protein are the same as above.

[0127] Hereinafter, the present application will be described in more detail with reference to exemplary embodiments. However, these exemplary embodiments are only for illustrative purposes, and the scope of the present application is not intended to be limited by these exemplary embodiments.

[0128] Reference Example 1: Preparation of plasmid

[0129] Plasmid (pDCM2, Figure 1, SEQ ID NO:81) is designed to insert and replace genes in the coryneform bacteria chromosome, and the gene synthesis service of Bionics Co. is used to synthesize plasmids. With reference to the article about the known sacB system (Gene, 145 (1994) 69-73), plasmids are designed to include restriction endonucleases that are easy to be used for cloning. The synthetic pDCM2 plasmid has the following characteristics:

[0130] 1) It can replicate itself in E. coli but not in Corynebacterium because it has a replication origin that only works in E. coli;

[0131] 2) The pDCM2 plasmid has a kanamycin resistance gene as a selection marker;

[0132] 3) the pDCM2 plasmid uses the Levan sucrose gene (sacB) as a secondary positive selection marker; and

[0133] 4) In the finally prepared strain, the pDCM2 plasmid does not leave any genetic information derived therefrom.

[0134] Example 1: Preparation of a recombinant vector for deleting the mcbR gene

[0135] In this example, in order to prepare a methionine-producing strain, a vector for inactivating mcbR encoding a methionine-cysteine ​​biosynthesis inhibitory protein previously disclosed (J. Biotechnol. 103: 51-65, 2003) was prepared using the wild-type ATCC13032 strain.

[0136] Specifically, in order to delete the mcbR gene on the chromosome of Corynebacterium ATCC13032, a recombinant plasmid vector was prepared by the following method: Based on the nucleotide sequence reported in GenBank of the National Institutes of Health (NIH), the mcbR gene of Corynebacterium glutamicum and its surrounding sequence (SEQ ID NO: 1) were obtained.

[0137] In order to obtain the deleted mcbR gene, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template and primers of SEQ ID NO: 2 and SEQ ID NO: 3, and SEQ ID NO: 4 and SEQ ID NO: 5 (Table 1).

[0138] [Table 1]

[0139]

[0140]

[0141] PCR was performed under the following conditions: denaturation at 95° C. for 5 minutes, 30 cycles (denaturation at 95° C. for 30 seconds, annealing at 53° C. for 30 seconds, extension at 72° C. for 30 seconds), followed by extension at 72° C. for 7 minutes. As a result, DNA fragments of 700 bp were obtained respectively.

[0142] The mcbR gene fragment of the pDCM2 vector and amplification that cannot be replicated in Corynebacterium glutamicum was processed with restriction endonuclease SmaI for chromosome introduction. After isothermal assembly cloning reaction, the product was transformed into Escherichia coli DH5α, then smeared on the LB solid medium containing kanamycin (25mg / L). The bacterium colony transformed by the carrier in which the target gene deletion fragment was inserted was selected by PCR, and plasmid was obtained using a plasmid extraction method, which was named pDCM2-ΔmcbR.

[0143] Example 2: Preparation and cultivation of mcbR gene-deficient strains

[0144] Utilize electroporation (van der Rest et al., Appl Microbiol Biotechnol 52:541–545,1999), transform ATCC13032 bacterial strain with the pDC-ΔmcbR carrier of preparation in embodiment 1 by homologous recombination on chromosome.Then, on the solid medium containing sucrose, carry out secondary recombination.Use SEQ ID NO:6 and 7 (table 2) to carry out PCR to the Corynebacterium glutamicum bacterial strain of the conversion that wherein secondary recombination has been completed, to identify the bacterial strain of mcbR gene deletion.This recombinant bacterial strain is called after Corynebacterium glutamicum CM02-0618.

[0145] CM02-0618 was deposited with the Korean Culture Center of Microorganisms, an international depository, on January 4, 2019 under the provisions of the Budapest Treaty and assigned the accession number KCCM12425P.

[0146] [Table 2]

[0147] SEQ ID NO: Sequence (5'-3') 6 AATCTGGATTTCCGCCAGGT 7 CTTCCTAACTCCTGAGGAAG

[0148] In order to analyze the L-methionine-producing ability of the prepared CM02-0618, the strain was cultured together with its parent strain, Corynebacterium glutamicum ATCC13032 strain, in the following manner.

[0149] Corynebacterium glutamicum ATCC13032 and the application's Corynebacterium glutamicum CM02-0618 are inoculated in the 250mL Erlenmeyer flask that contains 25mL substratum described below respectively, then at 30 ℃ with 200rpm shaking culture 20 hours.After this, 1mL seed culture medium is inoculated in the 250mL Erlenmeyer flask that contains 24mL production substratum, then at 30 ℃ with 200rpm shaking culture 48 hours.The composition of seed culture medium and production substratum is as follows.In production substratum, use (NH ) s o as sulphur source, (NH ) s o a kind of thiosulfate.

[0150] <Seed culture medium (pH 7.0)>

[0151] Glucose 20g, peptone 10g, yeast extract 5g, urea 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4·7H2O 0.5g, biotin 100μg, thiamine hydrochloride 1000μg, calcium pantothenate 2000μg, nicotinamide 2000μg (based on 1L distilled water)

[0152] <Production medium (pH 8.0)>

[0153] Glucose 50g, (NH4)2S2O3 12g, yeast extract 5g, KH2PO4 1g, MgSO4·7H2O 1.2g, biotin 100μg, thiamine hydrochloride 1000μg, calcium pantothenate 2000μg, niacinamide 3000μg, CaCO3 30g, cyanocobalamin (vitamin B12) 1μg (based on 1L distilled water)

[0154] After culturing by the above-mentioned culturing method, the concentration of L-methionine in the medium was analyzed and shown in Table 3 below.

[0155] [Table 3]

[0156] Verification of L-methionine production capacity of wild-type and mcbR-deficient strains

[0157] strain L-Methionine(g / L) Corynebacterium glutamicum ATCC13032 (wild type) 0.00 CM02-0618 0.04

[0158] As a result, in the strain from which mcbR alone was deleted, production of L-methionine was observed.

[0159] Example 3-1: Preparation of vectors for introducing three exogenous metZ genes

[0160] By introducing exogenous metZ into a Corynebacterium strain, an attempt is made to compensate for the shortcomings of existing methionine biosynthesis methods while increasing methionine production. Specifically, a vector for introducing metZ derived from Chromobacterium violaceum, Hyphomonas neptunium, and Rhodobacter sphaeroides was prepared.

[0161] Specifically, a recombinant plasmid vector was prepared by the following method so as to additionally insert each of three foreign metZ genes into the chromosome of Corynebacterium ATCC13032.

[0162] First, in order to insert metZ, a vector for removing Ncgl1021 (transposase) was prepared. Based on the nucleotide sequence reported in the GenBank of the National Institutes of Health (NIH), Ncgl1021 of Corynebacterium glutamicum and its surrounding sequence (SEQ ID NO:8) were obtained. In order to obtain the Ncgl1021 gene of deletion, the chromosomal DNA of Corynebacterium glutamicum ATCC13032 was used as template, and the primers of SEQ ID NO:9 and SEQ ID NO:10 and SEQ ID NO:11 and SEQ ID NO:12 were used to carry out PCR (Table 4).

[0163] [Table 4]

[0164] SEQ ID NO: Sequence (5'-3') 9 ACCCGGGGATCCTCTAGAATGTTTGTGATGCGCAG 10 GTCAGAGAGTACTTACGCTGATCGGGAGGGAAAGC 11 ATCAGCGTAAGTACTCTGACTAGCGTCACCCTC 12 CTGCAGGTCGACTCTAGAAAAGGGATTGGAGTGTT

[0165] Carry out PCR under the following conditions: denaturation at 95 ℃ for 5 minutes, 30 cycles in total (denaturation at 95 ℃ for 30 seconds, annealing at 53 ℃ for 30 seconds, and extension at 72 ℃ for 30 seconds), then extension at 72 ℃ for 7 minutes.As a result, DNA fragmentation was obtained respectively.The Ncgl1021 gene fragment of non-replicable pDCM2 vector and amplification in Corynebacterium glutamicum was processed with restriction endonuclease smaI, for chromosome introduction.After isothermal assembly cloning reaction, product was transformed into Escherichia coli DH5α, then smeared on the LB solid medium containing kanamycin (25mg / L).By PCR, select the bacterium colony transformed with the carrier of the deletion fragment having inserted the target gene, and use plasmid extraction method to obtain plasmid, it is named as pDCM2-ΔNcgl1021.

[0166] To obtain metZ genes (derived from Chromobacterium violaceum, Hyphomonas neptunium and Rhodobacter sphericalus), PCR was performed using primers SEQ ID NOs: 13 and 14, SEQ ID NOs: 15 and 16, and SEQ ID NOs: 17 and 18, with chromosomal DNA of each of Chromobacterium violaceum, Hyphomonas neptunium and Rhodobacter sphericalus as templates. To express three metZ genes, respectively, Pspl1 promoter was used, and PCR was performed on Pspl1 using previously disclosed spl1-GFP (KR10-1783170B1) vector DNA as a template and primers SEQ ID NOs: 19 and 20, SEQ ID NOs: 19 and 21, SEQ ID NOs: 19 and 22 (Table 5). PCR was performed under the following conditions: denaturation at 95°C for 5 minutes, a total of 30 cycles (denaturation at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and extension at 72°C for 30 seconds), followed by extension at 72°C for 7 minutes.

[0167] [Table 5]

[0168]

[0169]

[0170] As a result, three exogenous metZ gene fragments (SEQ ID NO: 63 to 65) and corresponding spl1 promoter fragments for expressing three metZ genes were obtained respectively. The pDCM2-ΔNcgl1021 vector that is not replicable in Corynebacterium glutamicum was treated with restriction enzyme scaI. After the amplified spl1 promoter fragment was subjected to isothermal assembly cloning reaction with the metZ fragment according to each strain, each product was transformed into Escherichia coli DH5α, and then smeared on LB solid medium containing kanamycin (25 mg / L). Colonies transformed with the vector inserted with the target gene were selected by PCR, and a total of three plasmids were obtained using a plasmid extraction method, which were then named pDCM2-ΔNcgl1021-PsplCvimetZ (Chromobacterium metZ), pDCM2-ΔNcgl1021-PsplHnemetZ (Hyphomonas neptunium metZ), and pDCM2-ΔNcgl1021-Psp1RspmetZ (Rhodobacter sphaeroides metZ).

[0171] Example 3-2: Preparation of vector for introducing metZ gene

[0172] In addition, vectors of six previously known metZ gene sequences derived from Rhodobacter sphericalus were prepared. In the same manner as in Example 3-1 (see US 2013-0273614 A1 and US 2018-0355389A1), vectors containing metZ genes were prepared, each encoding an amino acid sequence of SEQ ID NO: 66 to 71. The metZ genes were named RspmetZ_long, RspmetZ_3, RspmetZ_65, RspmetZ_104, RspmetZ_196 and RspmetZ_3_65_104, respectively, and the primers used to introduce each gene were as follows.

[0173] [Table 6]

[0174]

[0175]

[0176] First, in order to obtain RspmetZ_long, PCR was performed with chromosomal DNA of Rhodobacter sphaeroides using SEQ ID NOs: 19 and 22 and SEQ ID NOs: 72 and 18 as primers.

[0177] As a result, a gene fragment and a spl1 promoter fragment were obtained.

[0178] The pDCM2-ΔNcgl1021 vector that is not replicable in Corynebacterium glutamicum was treated with restriction enzyme scaI. After the amplified spl1 promoter fragment was subjected to isothermal assembly cloning reaction with the metZ fragment according to each strain, each product was transformed into Escherichia coli DH5α, and then smeared on LB solid medium containing kanamycin (25 mg / L). The colonies transformed with the vector into which the target gene was inserted were selected by PCR, and plasmids were obtained using a plasmid extraction method, which was named pDCM2-ΔNcgl1021-PsplRspmetZ_long.

[0179] In order to obtain RspmetZ_3, RspmetZ_65, RspmetZ_104, RspmetZ_196 and RspmetZ_3_65_104, pDCM2-ΔNcgl1021-PsplRspmetZ_long vector was used as a template, and PCR was performed using SEQ ID NOs: 72 and 73, 74 and 18 (RspmetZ_3), SEQ ID NOs: 72 and 75, 76 and 18 (RspmetZ_65), SEQ ID NOs: 72 and 77, 78 and 18 (RspmetZ_104), SEQ ID NOs: 71 and 79, 80 and 18 (RspmetZ_196), and SEQ ID NOs: 72 and 73, 74 and 75, 76 and 77, 77 and 18 (RspmetZ_3_65_104). PCR was performed under the following conditions: denaturation at 95°C for 5 min, a total of 30 cycles (denaturation at 95°C for 30 sec, annealing at 53°C for 30 sec, extension at 72°C for 30 sec), followed by extension at 72°C for 7 min.

[0180] As a result, a total of 10 fragments were obtained.

[0181] [Table 7]

[0182]

[0183]

[0184] The pDCM2-ΔNcgl1021 vector that is not replicable in Corynebacterium glutamicum was treated with restriction enzyme scaI. After isothermal assembly cloning reaction of RspmetZ_3 and fragment 1, fragment 2, RspmetZ_65 and fragment 3, fragment 4, RspmetZ_104 and fragment 5, fragment 6, RspmetZ_196 and fragment 7, fragment 8, RspmetZ_3_65_104 and fragment 1, fragment 11, fragment 12, fragment 6, each product was transformed into Escherichia coli DH5α, and then smeared on LB solid medium containing kanamycin (25 mg / L). Colonies transformed with the vector inserted with the target gene were selected by PCR, and a total of 6 plasmids were obtained using the plasmid extraction method, which were named pDCM2-ΔNcgl1021-PsplRspmetZ_long, pDCM2-ΔNcgl1021-PsplRspmetZ_3, pDCM2-ΔNcgl1021-PsplRspmetZ_65, pDCM2-ΔNcgl1021-PsplRspmetZ_104, pDCM2-ΔNcgl1021-PsplRspmetZ_196, and pDCM2-ΔNcgl1021-PsplRspmetZ_3_65_104.

[0185] Example 4: Preparation and cultivation of strains into which exogenous metZ is introduced

[0186] The nine exogenous metZ genes were introduced into the methionine-producing strain CM02-0618 prepared in Example 2, respectively.

[0187] Specifically, electroporation (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999) was used to generate pDCM2-ΔNcgl1021, pDCM2-ΔNcgl1021-PsplCvimetZ prepared in Example 3 by homologous recombination on chromosome. The methionine-producing strain CM02-0618 prepared in Example 2 was transformed with pDCM2-ΔNcgl1021-PsplHnemetZ, pDCM2-ΔNcgl1021-PsplRspmetZ, pDCM2-ΔNcgl1021-PsplRspmetZ_long, pDCM2-ΔNcgl1021-PsplRspmetZ_3, pDCM2-ΔNcgl1021-PsplRspmetZ_65, pDCM2-ΔNcgl1021-PsplRspmetZ_104, pDCM2-ΔNcgl1021-PsplRspmetZ_196 and pDCM2-ΔNcgl1021-PsplRspmetZ_3_65_104 vectors.

[0188] Then, secondary recombination was carried out on a solid medium containing sucrose. SEQ ID NO:23 and 24 were used to carry out PCR on the transformed Corynebacterium glutamicum strains in which secondary recombination had been completed to identify the strain with Ncgl1021 gene deletion and the strain with Ncgl1021 gene deletion and insertion of metZ gene. The recombinant strains prepared by introducing one of 9 vectors into CM02-0618 were named CM02-0618 / ΔNcgl021 and CM02-0757, CM02-0758, CM02-0759-1, CM02-0759-2, CM02-0759-3, CM02-0759-4, CM02-0759-5 and CM02-0759, respectively.

[0189] In order to analyze the L-methionine-producing ability of the prepared strains, each strain was cultured together with its parent strain CM02-0618 in the following manner.

[0190] Each strain was inoculated into a 250 mL Erlenmeyer flask containing 25 mL of the following medium, and then cultured with shaking at 200 rpm at 30° C. for 20 hours. Thereafter, 1 mL of the seed medium was inoculated into a 250 mL Erlenmeyer flask containing 24 mL of the production medium, and then cultured with shaking at 200 rpm at 30° C. for 48 hours. The compositions of the seed medium and the production medium are as follows.

[0191] <Seed culture medium (pH 7.0)>

[0192] Glucose 20g, peptone 10g, yeast extract 5g, urea 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4·7H2O 0.5g, biotin 100μg, thiamine hydrochloride 1000μg, calcium pantothenate 2000μg, nicotinamide 2000μg (based on 1L distilled water)

[0193] <Production medium (pH 8.0)>

[0194] Glucose 50g, (NH4)2S2O3 12g, yeast extract 5g, KH2PO4 1g, MgSO4·7H2O 1.2g, biotin 100μg, thiamine hydrochloride 1000μg, calcium pantothenate 2000μg, niacinamide 3000μg, CaCO3 30g, cyanocobalamin (vitamin B12) 1μg (based on 1L distilled water)

[0195] In addition, in order to compare with the sulfur source used in the existing methionine invertase, the sulfur source used in the production medium was replaced by methyl mercaptan (CH SH) from thiosulfate (S O ), and the strain was cultured in the same manner. After completing each culture, the L-methionine concentration in each medium was analyzed and shown in Table 8.

[0196] [Table 8]

[0197] Verification of L-methionine production capacity of metZ expression-enhanced strain

[0198]

[0199]

[0200] As a result, when 9 metZ genes were introduced respectively, the L-methionine production capacity was increased by 266% or more compared with the control strain, indicating that the exogenous metZ of the present application greatly improved the L-methionine production capacity through sulfhydrylation. In particular, the efficiency was high compared with the use of methyl mercaptan as a sulfur source in the existing method. This can be explained by the fact that, unlike metB and metY of Corynebacterium glutamicum, the exogenous metZ of the present application is not subject to feedback inhibition, so the methionine production is increased.

[0201] The CM02-0757, CM02-0758 and CM02-0759 strains were deposited in the Korean Culture Center of Microorganisms, an international depository institution, on May 2, 2019 under the provisions of the Budapest Treaty and were assigned accession numbers KCCM12506P, KCCM12507P and KCCM12508P.

[0202] Example 5: Preparation of a recombinant vector for deletion of metB and metY genes

[0203] In order to verify the function (activity) of the protein encoded by metZ of the present application and in order to compare activity with metY and metB activity, metY and metY possessed by Corynebacterium glutamicum were deleted respectively. Specifically, in order to delete metB and metY gene respectively, recombinant plasmid vector was prepared by the following method. Based on the nucleotide sequence reported in GenBank of National Institutes of Health (NIH), metB and metY gene and surrounding sequences thereof (SEQID NO:25 and 26) of Corynebacterium glutamicum were obtained.

[0204] In order to obtain the deleted metB and metY genes, respectively, chromosomal DNA of Corynebacterium glutamicum ATCC13032 was used as a template and PCR was performed using primers SEQ ID NOs: 27 and 28, SEQ ID NOs: 29 and 30 (metB) and primers SEQ ID NOs: 31 and 32, SEQ ID NOs: 33 and 34 (metY) (Table 9).

[0205] [Table 9]

[0206]

[0207]

[0208] PCR was performed under the following conditions: denaturation at 95° C. for 5 minutes, 30 cycles in total (denaturation at 95° C. for 30 seconds, annealing at 53° C. for 30 seconds, extension at 72° C. for 30 seconds), followed by extension at 72° C. for 7 minutes. As a result, DNA fragments of 700 bp were obtained respectively.

[0209] The pDCM2 vector that cannot be replicated in Corynebacterium glutamicum was treated with restriction endonuclease smaI, and the metB and metY gene fragments of amplification were used for chromosome introduction. After connecting with DNA ligase, the product was transformed into Escherichia coli DH5α, and then smeared on LB solid medium containing kanamycin (25mg / L). The bacterium colony transformed by each carrier in which the target gene deletion fragment was inserted was selected by PCR, and each plasmid was obtained using a plasmid extraction method, and the plasmids obtained were then named as pDCM2-ΔmetB and pDCM2-ΔmetY respectively.

[0210] Example 6: Preparation and cultivation of metB or metY gene-deficient strains from three metZ-enhanced strains

[0211] Utilize electroporation (van der Rest et al., Appl Microbiol Biotechnol 52:541–545, 1999), by homologous recombination on chromosome, transform CM02-0618, CM02-0757, CM02-0758 and CM02-0759 bacterial strains with pDCM2-ΔmetB and pDCM2-ΔmetY carriers prepared above respectively.Then, on the solid medium containing sucrose, carry out secondary recombination.Use SEQ ID NO:35 and 36 (metB) and SEQ ID NO:37 and 38 (metY) (table 10) to detect the disappearance of metB and metY gene of the transformed Corynebacterium glutamicum bacterial strain that wherein secondary recombination has been completed respectively.

[0212] [Table 10]

[0213] SEQ ID NO: Sequence (5'-3') 35 TTCCTGGTCTGACGACAGTG 36 GATGTCTTCAGCTTCACCCTG 37 CCGAGGATAATCCACAAGGT 38 CGAAGCGTTCGTCGATTTCT

[0214] These recombinant strains were named Corynebacterium glutamicum CM02-0618 / ΔmetB CM02-0757 / ΔmetB, CM02-0758 / ΔmetB, CM02-0759 / ΔmetB, CM02-0618 / ΔmetY, CM02-0757 / ΔmetY, CM02-0758 / ΔmetY, and CM02-0759 / ΔmetY, respectively.

[0215] In order to analyze the L-methionine production ability of the prepared CM02-0618 / ΔmetB, CM02-0757 / ΔmetB, CM02-0758 / ΔmetB, CM02-0759 / ΔmetB, CM02-0618 / ΔmetY, CM02-0757 / ΔmetY, CM02-0758 / ΔmetY and CM02-0759 / ΔmetY strains, they were cultured by the following methods, respectively.

[0216] CM02-0618, CM02-0757, CM02-0758 and CM02-0759 were used as parent strains and CM02-0618 / ΔmetB, CM02-0757 / ΔmetB, CM02-0758 / ΔmetB, CM02-0759 / ΔmetB, CM02-0618 / ΔmetY, CM02-0757 / ΔmetY, CM02-0758 / ΔmetY and CM02-0759 / ΔmetY prepared above were inoculated into a 250 mL conical flask containing 25 mL of the following medium, and then shake-cultured at 30°C at 200 rpm for 20 hours. Thereafter, 1 mL of each seed culture medium was inoculated into a 250 mL conical flask containing 24 mL of production medium, and then shake-cultured at 30°C at 200 rpm for 48 hours. The composition of the seed culture medium and the production medium is as follows.

[0217] <Seed culture medium (pH 7.0)>

[0218] Glucose 20g, peptone 10g, yeast extract 5g, urea 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4·7H2O 0.5g, biotin 100μg, thiamine hydrochloride 1000μg, calcium pantothenate 2000μg, nicotinamide 2000μg (based on 1L distilled water)

[0219] <Production medium (pH 8.0)>

[0220] Glucose 50g, (NH4)2S2O3 12g, yeast extract 5g, KH2PO4 1g, MgSO4·7H2O 1.2g, biotin 100μg, thiamine hydrochloride 1000μg, calcium pantothenate 2000μg, niacinamide 3000μg, CaCO3 30g, cobalamin (vitamin B12) 1μg (based on 1L distilled water).

[0221] The concentrations of L-methionine and by-product homolanthionine in each culture medium cultured by the above-mentioned culture method were analyzed and shown in Table 11.

[0222] [Table 11]

[0223] Verification of L-methionine or homolanthionine production ability of metB or metY deletion strains

[0224]

[0225]

[0226] According to the results, it was confirmed that exogenous metZ has the same function as metB, that is, methionine is produced by transsulfurization using cysteine ​​as a sulfur source. In other words, even if metB or metY is missing, methionine production can be maintained at a high yield by using metZ, and therefore, the gene can be replaced by exogenous metZ to compensate for the shortcomings of metB and / or metY in Corynebacterium.

[0227] In addition, compared with the control (CM02-0618), in the strain with metB and the introduction of exogenous metZ, methionine production increased and homolanthionine production was only about 20%, indicating that when metZ increased, the production of the byproduct homolanthionine decreased. Homolanthionine is a substance synthesized by consuming O-acetylhomoserine, so the production of homolanthionine reduces the production of methionine. Exogenous metZ that inhibits the production of byproducts compensates for the shortcomings of metB, inhibits byproduct production and enhances methionine synthesis.

[0228] The above results revealed for the first time that the metZ of the present application can mediate transsulfurization by using cysteine, and that the metZ of the present application can not only be used to increase methionine production but also can be used to compensate for the shortcomings of metB of Corynebacterium strains.

[0229] Example 7: Preparation of a recombinant vector for simultaneously enhancing metH and cysI

[0230] In this example, in order to prepare a methionine-producing strain without mcbR deletion, a vector was prepared in which metH encoding methionine synthase (Ncgl1450) and cysI encoding sulfite reductase (Ncgl2718) were simultaneously enhanced.

[0231] Specifically, in order to insert metH and cysI genes into the chromosome of Corynebacterium ATCC13032 in addition, a recombinant plasmid vector was prepared by the following method.Based on the nucleotide sequence reported in GenBank of the National Institutes of Health (NIH), the metH gene and its surrounding sequence (SEQ ID NO:39) and the cysI gene and its surrounding sequence (SEQ ID NO:40) of Corynebacterium glutamicum were obtained.

[0232] In order to obtain metH and cysI genes, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, using primers SEQ ID NO:41 and SEQ ID NO:42, SEQ ID NO:43 and SEQ ID NO:44. The expression of the metH gene was enhanced with the Pcj7 promoter, and the expression of the cysI gene was enhanced with the Pspl1 promoter. In order to obtain each promoter, for Pcj7, PCR was performed using chromosomal DNA of Corynebacterium ammoniagenes ATCC6872 as a template using SEQ ID NO:45 and 46; for Pspl1, PCR was performed using SEQ ID NO:47 and 48, using the previously disclosed spl1-GFP (KR10-1783170B1) vector DNA as a template. The sequences of the primers used are shown in Table 12 below.

[0233] [Table 12]

[0234] SEQ ID NO: Sequence (5'-3') 41 CAACGAAAGGAAACAATGTCTACTTCAGTTACTTC 42 TAGTCAGAGAGTGATTTAGACGTTAAAGTACTTTG 43 ATCAAAACAGATATCATGACAACAACCACCGGAAG 44 CGCTAGTCAGAGAGTTCACAACCAAATCTTCCTCAG 45 CCGATCAGCGTAAGTAGAAACATCCCAGCGCTACT 46 AACTGAAGTAGACATTGTTTCCTTTCGTTGGGTAC 47 TACTTTAACGTCTAAGGTACCGGCGCTTCATGTCA 48 GGTGGTTGTTGTCATGATATCTGTTTTTTGATCTCCT

[0235] PCR was performed under the following conditions: denaturation at 95° C. for 5 minutes, 30 cycles in total (denaturation at 95° C. for 30 seconds, annealing at 53° C. for 30 seconds, extension at 72° C. for 4 minutes), followed by extension at 72° C. for 7 minutes. As a result, metH and cysI, Pcj7 promoter and Pspl1 promoter DNA fragments were obtained, respectively.

[0236] The pDCM2-ΔNcgl1021 vector that is not replicable in Corynebacterium glutamicum was treated with restriction endonuclease scaI, and 4 amplified DNA fragments were treated with scaI for chromosome introduction. After IST reaction, the product was transformed into Escherichia coli DH5α, and then smeared on LB solid medium containing kanamycin (25 mg / L). The colonies transformed with the vector into which the deletion fragment of the target gene was inserted were selected by PCR, and plasmids were obtained using a plasmid extraction method, which was then named pDCM2-ΔNcgl1021-Pcj7metH-Psp11cysI.

[0237] Example 8: Preparation of a strain with enhanced metH and cysI and production of L-methionine using the strain

[0238] Utilize electroporation (van der Rest et al., Appl Microbiol Biotechnol 52:541–545, 1999), by homologous recombination on chromosome, transform ATCC13032 strain with pDCM2-ΔNcgl1021 and pDCM2-ΔNcgl1021-Pcj7metH-Pspl1cysI carrier prepared above.Then, carry out secondary recombination on solid medium containing sucrose.Detect the deletion of Ncgl1021 gene and the insertion of Pcj7-metH-Psp11cysI gene of the transformed Corynebacterium glutamicum strain in which secondary recombination has been completed with SEQ ID NO:23 and 24 respectively.Recombinant strains are named as 13032 / ΔNcgl1021 and CM02-0753 respectively.

[0239] In order to analyze the L-methionine-producing ability of the prepared 13032 / ΔNcgl1021 and CM02-0753 strains, they were cultured together with the parent Corynebacterium glutamicum ATCC13032 strain by the following methods, respectively.

[0240] Corynebacterium glutamicum ATCC13032 and 13032 / ΔNcgl1021 and CM02-0753 strains prepared above were inoculated into 250mL conical flasks containing 25mL of the culture medium described below, and then cultured with shaking at 200rpm for 20 hours at 30°C. Thereafter, 1mL of each seed culture medium was inoculated into a 250mL conical flask containing 24mL of production culture medium, and then cultured with shaking at 200rpm for 48 hours at 30°C. The composition of the seed culture medium and the production culture medium is as follows.

[0241] <Seed culture medium (pH 7.0)>

[0242] Glucose 20g, peptone 10g, yeast extract 5g, urea 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4·7H2O 0.5g, biotin 100μg, thiamine hydrochloride 1000μg, calcium pantothenate 2000μg, nicotinamide 2000μg (based on 1L distilled water)

[0243] <Production medium (pH 8.0)>

[0244] Glucose 50g, (NH4)2S2O3 12g, yeast extract 5g, KH2PO4 1g, MgSO4·7H2O 1.2g, biotin 100μg, thiamine hydrochloride 1000μg, calcium pantothenate 2000μg, niacinamide 3000μg, CaCO3 30g, cobalamin (vitamin B12) 1μg (based on 1L distilled water).

[0245] The concentration of L-methionine in each culture medium cultured by the above-mentioned culture method was analyzed and shown in Table 13.

[0246] [Table 13]

[0247] Verification of L-methionine production ability of strains with mcbR

[0248] strain L-Methionine(g / L) Corynebacterium glutamicum ATCC13032 (wild type) 0 13032 / ΔNcgl1021 0 CM02-0753 0.03

[0249] The results confirmed that the L-methionine production capacity of the metH and cysI overexpressing strain in which mcbR still existed was increased by 0.03 g / L compared with the control strain.

[0250] Example 9-1: Preparation of a vector for enhancing the metZ gene at sites other than the Ncgl1021 site

[0251] In order to insert three exogenous metZ genes into other sites besides the existing sites on the chromosome of Corynebacterium ATCC13032, a recombinant plasmid vector was prepared by the following method.

[0252] At first, in order to insert metZ, prepare the vector for deletion Ncgl2748 (transposase).Based on the nucleotide sequence reported in the GenBank of the National Institutes of Health (NIH), obtain Ncgl2748 of Corynebacterium glutamicum and its surrounding sequence (SEQ ID NO:49).In order to obtain the Ncgl2748 gene of deletion, use the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as template, use primer SEQ ID NO:50 and SEQ ID NO:51, SEQ ID NO:52 and SEQ ID NO:53 to carry out PCR (table 14).Carry out PCR under the following conditions: 95 ℃ of denaturation 5 minutes, 30 cycles (95 ℃ of denaturation 30 seconds, 53 ℃ of annealing 30 seconds, 72 ℃ of extension 30 seconds) in total, extend 7 minutes at 72 ℃ subsequently.As a result, obtain DNA fragmentation respectively.

[0253] [Table 14]

[0254] SEQ ID NO: Sequence (5'-3') 50 GTACCCGGGGATCCTCTAGACCTGGGTAACTTCCTGTCCA 51 CAGGTTAGCAGTACTTCTCAAGTTTCTCGGCGGTG 52 AACTTGAGAAGTACTGCTAACCTGCAGAAACCTTG 53 GCCTGCAGGTCGACTCTAGACTCCGCAGAAATCGTGGGGC

[0255] The pDCM2 vector and the Ncgl2748 gene fragment of amplification that cannot be replicated in Corynebacterium glutamicum were processed with restriction endonuclease smaI for chromosome introduction. After IST reaction, the product was transformed into Escherichia coli DH5α, which was then smeared on the LB solid medium containing kanamycin (25 mg / L). The bacterium colony transformed by the vector having the deletion fragment of the target gene inserted therein was selected by PCR, and a plasmid was obtained using a plasmid extraction method, which was named pDCM2-ΔNcgl2748.

[0256] In order to obtain three metZ genes (Chromobacterium violetum, Hyphomonas neptunium and Rhodobacter sphericalus), the prepared pDCM2-ΔNcgl1021-PsplCvimetZ (Chromobacterium violetum metZ), pDCM2-ΔNcgl1021-PsplHnemetZ (Hyphomonas neptunium metZ), pDCM2-ΔNcgl1021-Psp1RspmetZ (Rhodobacter sphericalus metZ) vectors were used as templates, and PCR was performed using SEQ ID NOs: 54 and 55, 54 and 56, and 54 and 57 (Table 15). PCR was performed under the following conditions: denaturation at 95°C for 5 minutes, a total of 30 cycles (denaturation at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and extension at 72°C for 60 seconds), followed by extension at 72°C for 7 minutes. As a result, three DNA fragments were obtained.

[0257] [Table 15]

[0258]

[0259]

[0260] The pDCM2-ΔNcgl2748 vector that cannot be replicated in Corynebacterium glutamicum is processed with restriction enzyme scaI. After carrying out IST reaction according to each bacterial strain and the fragment of amplification, the product is transformed into Escherichia coli DH5α, and then smeared on the LB solid medium containing kanamycin (25mg / L). The bacterium transformed by the vector in which the target gene is inserted is selected by PCR, and a total of three plasmids are obtained using a plasmid extraction method, and then named as pDCM2-ΔNcgl2748-PsplCvimetZ (purple color bacillus metZ), pDCM2-ΔNcgl2748-PsplHnemetZ (Hyphomonas neptunium metZ), pDCM2-ΔNcgl2748-Psp1RspmetZ (spherical red bacillus metZ).

[0261] Example 9-2: Preparation of a vector for enhancing the metZ gene at sites other than the Ncgl1021 site

[0262] Furthermore, in order to examine whether methionine production is also increased in a strain into which a metZ gene having a sequence homology of 99% or more is introduced, vectors of the five metZ genes of Example 3-2 were additionally prepared.

[0263] Vectors were prepared in the same manner as in Example 9-1, each of which was introduced with one of the six metZ genes.

[0264] A total of 6 vectors were prepared as follows: named pDCM2-ΔNcgl2748-PsplRspmetZ_long, ΔNcgl2748-PsplRspmetZ_3, pDCM2-ΔNcgl2748-PsplRspmetZ_65, pDCM2-ΔNcgl2748-PsplRspmetZ_104, pDCM2-ΔNcgl2748-PsplRspmetZ_196 and pDCM2-ΔNcgl2748-PsplRspmetZ_3_65_104 respectively. To prepare these vectors, ΔNcgl1021-PsplRspmetZ_long, pDCM2-ΔNcgl1021-PsplRspmetZ_3, pDCM2-ΔNcgl1021-PsplRspmetZ_65, pDCM2-ΔNcgl1021-PsplRspmetZ_104, pDCM2-ΔNcgl1021-PsplRspmetZ_196 and pDCM2-ΔNcgl1021-PsplRspmetZ_3_65_104 prepared in Example 4 were used as DNA templates, and primers SEQ ID NOs: 54 and 57 were used, respectively. The other steps were the same as in Example 9-1.

[0265] Example 10: Development of an exogenous metZ-enhanced strain based on an L-methionine-producing strain having mcbR and production of L-methionine using the strain

[0266] By electroporation (van der Rest et al., Appl Microbiol Biotechnol 52:541–545, 1999), the pDCM2-ΔNcgl2748, pDCM2-ΔNcgl2748-PsplCvimetZ, pDCM2-ΔNcgl2748-PsplHnemetZ, pDCM2-ΔNcgl2748-PsplRspmetZ, pDCM2-ΔNcgl2748-PsplRspmetZ_long, pDCM 2-ΔNcgl2748-PsplRspmetZ_3, pDCM2-ΔNcgl2748-PsplRspmetZ_65, pDCM2-ΔNcgl2748-PsplRspmetZ_104, pDCM2-ΔNcgl2748-PsplRspmetZ_196 and pDCM2-ΔNcgl2748-PsplRspmetZ_3_65_104 transformed CM02-0753 bacterial strain.Then, on the solid medium containing sucrose, carry out secondary recombination.Detect the insertion of each exogenous metZ gene of the Corynebacterium glutamicum bacterial strain of the conversion that wherein secondary recombination has been completed at Ncgl2748 site respectively with SEQ ID NO:58 and 59 (table 16).

[0267] [Table 16]

[0268] SEQ ID NO: Sequence (5'-3') 58 TTCTCCGTGCCGAGAAAATC 59 GTAGATGATCTCGCCATTTG

[0269] These recombinant strains were named Corynebacterium glutamicum 13032 / ΔNcgl2748, CM02-0765, CM02-0766, CM02-0767-1, CM02-0767-2, CM02-0767-3, CM02-0767-4, CM02-0767-5, CM02-0767-6, and CM02-0767, respectively.

[0270] In order to analyze the L-methionine-producing abilities of the prepared strains, they were cultured together with the parent strain Corynebacterium glutamicum CM02-0753 by the following methods, respectively.

[0271] Each strain was inoculated into a 250 mL Erlenmeyer flask containing 25 mL of the following medium, and then cultured with shaking at 200 rpm at 30° C. for 20 hours. Thereafter, 1 mL of each seed culture medium was inoculated into a 250 mL Erlenmeyer flask containing 24 mL of production medium, and then cultured with shaking at 200 rpm at 30° C. for 48 hours. The compositions of the seed medium and production medium are as follows.

[0272] <Seed culture medium (pH 7.0)>

[0273] Glucose 20g, peptone 10g, yeast extract 5g, urea 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4·7H2O 0.5g, biotin 100μg, thiamine hydrochloride 1000μg, calcium pantothenate 2000μg, nicotinamide 2000μg (based on 1L distilled water)

[0274] <Production medium (pH 8.0)>

[0275] Glucose 50g, (NH4)2S2O3 12g, yeast extract 5g, KH2PO4 1g, MgSO4·7H2O 1.2g, biotin 100μg, thiamine hydrochloride 1000μg, calcium pantothenate 2000μg, niacinamide 3000μg, CaCO3 30g, cobalamin (vitamin B12) 1μg (based on 1L distilled water)

[0276] The concentration of L-methionine in each culture medium cultured by the above-mentioned culture method was analyzed and shown in Table 17.

[0277] [Table 17]

[0278] Verification of L-methionine production capacity of overexpressed exogenous metZ in a strain with mcbR

[0279] strain L-Methionine(g / L) CM02-0753 0.03 CM02-0753 / ΔNcgl2748 0.03 CM02-0765(CvimetZ) 0.10 CM02-0766(HnemetZ) 0.09 CM02-0767-1(RspmetZ) 0.10 CM02-0767-2(RspmetZ_long) 0.10 CM02-0767-3(RspmetZ_3) 0.10 CM02-0767-4(RspmetZ_65) 0.10 CM02-0767-5(RspmetZ_104) 0.10 CM02-0767-6(RspmetZ_196) 0.10 CM02-0767(RspmetZ_3_65_104) 0.11

[0280] The results confirmed that when the exogenous metZ gene was introduced into the methionine-producing strains having mcbR, respectively, the methionine production was also increased.

[0281] The CM02-0765, CM02-0766 and CM02-0767 strains were deposited at the Korean Culture Center of Microorganisms, an international depository, on May 2, 2019 under the provisions of the Budapest Treaty and were assigned accession numbers KCCM12509P, KCCM12510P and KCCM12511P.

[0282] Based on the above description, it will be appreciated by those skilled in the art that the present application can be realized in different specific forms without changing the technical spirit or essential characteristics of the present application. In this respect, it should be understood that the above-described embodiments are not restrictive, but are illustrative in all respects. The scope of the present application is limited by the appended claims, rather than being limited by the above description, and therefore all changes and modifications within the limit and scope of the claims or the equivalents of this limit and scope are intended to be covered by the claims.

[0283] Effects of the Invention

[0284] A microorganism into which the activity of the protein encoded by metZ of the present application is introduced exhibits high yield because it produces fewer by-products compared to metY, and the microorganism is not subject to feedback inhibition, unlike metB which is subject to feedback inhibition by methionine, and therefore produces L-methionine in high yield, thereby being effectively applied to the industrial production of L-methionine.

[0285]

[0286]

[0287]

[0288]

[0289]

[0290]

[0291]

Claims

1. An L-methionine producing microorganism into which a protein encoded by an exogenous metZ gene is introduced, wherein the microorganism comprises one or more genetic modifications selected from the group consisting of: a weakening or inactivation of cystathionine gamma synthase activity and a weakening or inactivation of O-acetylhomoserine sulfhydrylase activity, The polypeptide sequence of the protein is any one of SEQ ID NOs: 60, 61 and 62, and the microorganism is Corynebacterium glutamicum.

2. The L-methionine-producing microorganism according to claim 1, wherein the protein has O-acylhomoserine sulfhydryltransferase activity.

3. The L-methionine producing microorganism according to claim 1, wherein the protein is derived from Chromobacterium violaceum, Hyphomonas neptunium or Rhodobacter sphaeroides.

4. L-methionine production microorganism as claimed in claim 1, wherein the microorganism comprises one or more genetic modifications selected from: weakening or inactivation of the activity of a methionine-cysteine ​​biosynthesis inhibitory protein; enhancement of methionine synthase activity; and enhancement of sulfite reductase activity.

5. The L-methionine-producing microorganism according to claim 1, wherein the production of homolanthionine is reduced.

6. A composition for producing L-methionine, comprising the microorganism according to any one of claims 1 to 5 and thiosulfate.

7. The purpose of a microorganism in the production of L-methionine, wherein the protein encoded by the exogenous metZ gene is introduced into the microorganism, wherein the microorganism comprises one or more genetic modifications selected from the group consisting of: a weakening or inactivation of cystathionine gamma synthase activity and a weakening or inactivation of O-acetylhomoserine sulfhydrylase activity, The polypeptide sequence of the protein is any one of SEQ ID NOs: 60, 61 and 62, and the microorganism is Corynebacterium glutamicum.

8. A method for producing L-methionine, said method comprising culturing a microorganism in a medium containing thiosulfate, wherein a protein encoded by an exogenous metZ gene is introduced into said microorganism, wherein said microorganism comprises one or more genetic modifications selected from the group consisting of: a weakening or inactivation of cystathionine gamma synthase activity and a weakening or inactivation of O-acetylhomoserine sulfhydrylase activity, The polypeptide sequence of the protein is any one of SEQ ID NOs: 60, 61 and 62, and the microorganism is Corynebacterium glutamicum.

9. The method for producing L-methionine according to claim 8, wherein the protein has O-acylhomoserine sulfhydryltransferase activity.

10. The method for producing L-methionine according to claim 8, wherein the protein is derived from Chromobacterium violaceum, Hyphomonas neptunium or Rhodobacter sphaeroides.

11. The method for producing L-methionine as claimed in claim 8, wherein the microorganism comprises one or more genetic modifications selected from: a weakening or inactivation of the activity of a methionine-cysteine ​​biosynthesis inhibitor; an enhancement of methionine synthase activity; and an enhancement of sulfite reductase activity.

12. The method for producing L-methionine according to claim 8, comprising recovering L-methionine from the microorganism or culture medium.

13. The method for producing L-methionine according to claim 8, wherein the production of homolanthionine is reduced.

Images