Renal cell carcinoma biomarkers and their applications

Abstract

The present invention discloses a renal cell carcinoma biomarker and its application, wherein the renal cell carcinoma biomarker is ZNF883 or hsa-miR-567, or the expression product of ZNF883 or hsa-miR-567. The present invention finds that ZNF883 is significantly underexpressed in RCC cells, and hsa-miR-567 is significantly overexpressed in RCC cells, indicating that ZNF883 or hsa-miR-567 can be used as RCC biomarkers, providing a certain reference for early screening or diagnosis of RCC and prognosis prediction; at the same time, studies have shown that subjects with high expression of ZNF883 have higher chemotherapy sensitivity to sunitinib, and the chemotherapy sensitivity of patients can be predicted by detecting the expression level of ZNF883, and the chemotherapy sensitivity of patients to sunitinib can be improved by promoting ZNF883 expression or silencing hsa-miR-567.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a renal cell carcinoma biomarker and application thereof. Background Art

[0002] Renal cell carcinoma (RCC) originates from the renal parenchyma and is the most common renal cell carcinoma, accounting for nearly 90% of all renal malignancies. The incidence of RCC is still increasing in most countries, and the incidence is higher in developed countries. Studies have reported more than 330,000 cases of RCC and more than 140,000 RCC-related deaths worldwide. Because the initial symptoms of RCC are usually not obvious, early diagnosis of RCC is not easy. In fact, about 30% of RCC patients have already metastasized when they are first diagnosed.

[0003] Although targeted drugs such as sunitinib have been used to treat patients with advanced RCC, unfortunately, drug resistance will appear within 6-15 months, making the overall survival of RCC still unsatisfactory. Therefore, improving the sensitivity of RCC to sunitinib may be an important way to improve the prognosis of RCC.

[0004] Long noncoding RNAs (lncRNAs) are defined as a group of non-protein-coding RNAs with a length of at least 200 nucleotides. They play an important role in regulating the transcription and translation of protein-coding genes. Based on these functions, lncRNAs are involved in a variety of oncogenic processes, including tumor cell proliferation, cell metastasis, cell apoptosis inhibition, and cell drug resistance.

[0005] ZNF883 is a lncRNA that is known to be involved in the development of ovarian cancer and lung cancer, but there are no reports indicating that ZNF883 is associated with the occurrence and development of RCC, nor are there any reports indicating that ZNF883 is associated with the sensitivity of RCC to sunitinib. Summary of the invention

[0006] The purpose of the present invention is to provide a renal cell carcinoma biomarker and its application, which provides a new approach for early screening of renal cell carcinoma and early prediction of chemotherapy sensitivity of renal cell carcinoma.

[0007] In order to achieve the above-mentioned object of the invention, the technical solution of the present invention is:

[0008] A renal cell carcinoma biomarker is ZNF883 or hsa-miR-567 gene, or the expression product of ZNF883 or hsa-miR-567 gene.

[0009] The present invention is the first to study and find that the expression level of ZNF883 in renal cell carcinoma cells is significantly lower than the expression level of ZNF883 in normal renal epithelial cells, indicating that ZNF883 can be used as a renal cell carcinoma biomarker to provide a certain reference for early screening or diagnosis and prognosis prediction of renal cell carcinoma.

[0010] At the same time, the present invention also found that ZNF883 and hsa-miR-567 interact with each other in cells, and when ZNF883 is overexpressed in cells, it can inhibit the expression of hsa-miR-567 in cells; this is consistent with the conclusion of the present invention that hsa-miR-567 is significantly highly expressed in renal cell carcinoma cells, indicating that ZNF883 can affect the occurrence and development of renal cell carcinoma cells by targeting and binding to hsa-miR-567.

[0011] Based on this, the present invention provides the use of the above-mentioned renal cell carcinoma biomarker in the preparation of early screening or auxiliary diagnosis reagents for renal cell carcinoma, and the use of the above-mentioned renal cell carcinoma biomarker in the preparation of renal cell carcinoma prognosis prediction reagents.

[0012] The present invention also provides a renal cell carcinoma early screening or auxiliary diagnosis reagent, and a renal cell carcinoma prognosis prediction reagent; the reagent comprises:

[0013] Oligonucleotide probes that specifically recognize the ZNF883 or hsa-miR-567 gene;

[0014] or, primers that specifically amplify the ZNF883 or hsa-miR-567 gene;

[0015] Or, an antibody or ligand that specifically binds to the expression product of ZNF883 or hsa-miR-567 gene.

[0016] Preferably, in the above-mentioned early screening or auxiliary diagnosis reagent for renal cell carcinoma, the primers for specifically amplifying the ZNF883 gene include:

[0017] Upstream primer: 5′-GCATTGGAAGATGTCAGAGAC-3′;

[0018] Downstream primer: 5′-GTAGACCAATCCAATGAGATGAG-3′;

[0019] The primers for specifically amplifying the hsa-miR-567 gene include:

[0020] Upstream primer: 5′-CTTCCAGGACAGAACGTCGT-3′;

[0021] Downstream primer: 5′-GTATCCAGTGCGTGTCGTGG-3′.

[0022] The present invention also provides a kit for early screening or auxiliary diagnosis of renal cell carcinoma, which contains the above-mentioned early screening or auxiliary diagnosis reagent for renal cell carcinoma.

[0023] The present invention also provides a renal cell carcinoma prognosis prediction kit, which contains the above-mentioned renal cell carcinoma prognosis prediction reagent.

[0024] The present invention also found that the expression level of ZNF883 in sunitinib-resistant renal cell carcinoma cells is significantly lower than that in ordinary renal cell carcinoma cells, that is, subjects with low expression of ZNF883 have lower chemotherapy sensitivity to sunitinib, while subjects with high expression of ZNF883 have higher chemotherapy sensitivity to sunitinib. Based on this, the present invention also provides the use of the above-mentioned renal cell carcinoma biomarker in the preparation of a renal cell carcinoma chemotherapy sensitivity prediction reagent, that is, predicting the patient's chemotherapy sensitivity by detecting the expression level of ZNF883, providing a reference for formulating a treatment plan.

[0025] The present invention also provides a reagent for predicting the chemotherapy sensitivity of renal cell carcinoma, wherein the chemotherapy sensitivity prediction comprises:

[0026] Oligonucleotide probes that specifically recognize the ZNF883 or hsa-miR-567 gene;

[0027] or, primers that specifically amplify the ZNF883 or hsa-miR-567 gene;

[0028] Or, an antibody or ligand that specifically binds to the expression product of ZNF883 or hsa-miR-567 gene.

[0029] The present invention also found that promoting ZNF883 expression (ie, reducing the expression of hsa-miR-567 or silencing hsa-miR-567) can enhance the chemosensitivity of renal cell cancer cells to sunitinib and inhibit the migration and invasion of renal cell cancer cells.

[0030] Based on this, the present invention also provides the use of the above-mentioned renal cell carcinoma biomarker in the preparation of a renal cell carcinoma chemotherapy sensitivity enhancing reagent; and a renal cell carcinoma chemotherapy sensitivity enhancing reagent, which includes a ZNF883 expression promoter, or an hsa-miR-567 inhibitor or silencing agent.

[0031] The present invention has no special requirements on the specific forms of the ZNF883 expression promoter and the hsa-miR-567 inhibitor or silencing agent, as long as they can promote the expression of ZNF883, reduce the expression of hsa-miR-567 or silence hsa-miR-567.

[0032] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0033] (1) The present invention first discovered that the expression level of ZNF883 in renal cell carcinoma cells is significantly lower than that in normal renal epithelial cells, and that ZNF883 interacts with hsa-miR-567 in cells. ZNF883 can affect the occurrence and development of renal cell carcinoma cells by targeting and binding to hsa-miR-567. When ZNF883 is overexpressed in cells, it can inhibit the expression of hsa-miR-567 in cells. This is consistent with the conclusion of the present invention that hsa-miR-567 is significantly overexpressed in renal cell carcinoma cells, indicating that ZNF883 and hsa-miR-567 can be used as biomarkers for renal cell carcinoma, providing a certain reference for early screening or diagnosis of renal cell carcinoma and prognosis prediction.

[0034] (2) The present invention also found that the expression level of ZNF883 in sunitinib-resistant renal cell carcinoma cells was significantly lower than that in ordinary renal cell carcinoma cells, that is, subjects with low ZNF883 expression had lower chemotherapy sensitivity to sunitinib, while subjects with high ZNF883 expression had higher chemotherapy sensitivity to sunitinib; indicating that ZNF883 and hsa-miR-567 can be used as renal cell carcinoma biomarkers to detect the chemotherapy sensitivity of renal cell carcinoma patients to sunitinib, providing a reference for formulating treatment plans.

[0035] (3) The present invention also found that promoting ZNF883 expression (i.e., reducing the expression of hsa-miR-567 or silencing hsa-miR-567) can enhance the chemosensitivity of renal cell carcinoma cells to sunitinib and inhibit the migration and invasion of renal cell carcinoma cells; administering a ZNF883 expression promoter or an hsa-miR-567 silencing agent to patients can enhance the chemosensitivity of renal cell carcinoma patients to sunitinib and improve the chemotherapy effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The results of differentially expressed lncRNA analysis in sunitinib-resistant renal cell carcinoma cells;

[0037] Among them, log2 (fold change) represents the logarithm of gene expression with base 2, and -log10 (P value) represents the negative logarithm of P value with base 10;

[0038] Figure 2 The effect of different concentrations of sunitinib on the viability of renal cell carcinoma cells;

[0039] Wherein, SU (μM) means sunitinib (micromoles per liter), IC50 values ​​(μM) means half inhibitory concentration (micromoles per liter), 769P and CAKI-2 are renal cell carcinoma cells, 769P-SU and CAKI-2-SU are renal cell carcinoma cells resistant to sunitinib, Relative cell viability (%) means relative cell viability (percentage); ## means that compared with 769P, the cell viability of 769P-SU is stronger (P < 0.01); &&& means that compared with CAKI-2, the cell viability of CAKI-2-SU is stronger (P < 0.001); the same below;

[0040] Figure 3 is the relative expression level of lncRNA ZNF883 in different cell lines;

[0041] Among them, HK-2 is a normal renal epithelial cell, Relative lncRNA ZNF883 expression level indicates the relative expression level of lncRNA ZNF883; *** indicates that compared with HK-2, the relative expression levels of lncRNA ZNF883 in 769P, CAKI-2, 769P-SU and CAKI-2-SU were significantly decreased (P < 0.001); ### indicates that compared with 769P, the relative expression level of lncRNA ZNF883 in 769P-SU was significantly decreased (P < 0.001); &&& indicates that compared with CAKI-2, the relative expression level of lncRNA ZNF883 in CAKI-2-SU was significantly decreased (P < 0.001); the same below;

[0042] Figure 4 Effects of different concentrations of sunitinib on the expression of lncRNA ZNF883 in 769P cell line;

[0043] Figure 5 Effects of different concentrations of sunitinib on the expression of lncRNA ZNF883 in CAKI-2 cell lines;

[0044] Figure 4 and Figure 5 In the table, ++ and +++ indicate that the relative expression level of lncRNA ZNF883 in cells treated with sunitinib was significantly increased compared with that without sunitinib treatment (P < 0.01, P < 0.001); the same below;

[0045] Figure 6Effects of different concentrations of sunitinib on the expression of lncRNA ZNF883 in 769P-SU cell line;

[0046] Figure 7 Effects of different concentrations of sunitinib on the expression of lncRNA ZNF883 in CAKI-2-SU cell line;

[0047] Figure 8 The effect of ZNF883 overexpression on the expression of lncRNA ZNF883 in 769P-SU cell line;

[0048] Fig. 9 The effect of ZNF883 overexpression on the expression of lncRNA ZNF883 in CAKI-2-SU cell line;

[0049] Figure 8 and Fig. 9 In the figure, the NC group indicates cells transfected with an empty vector, the ZNF883 group indicates cells transfected with a ZNF883 overexpression plasmid, the NC+SU group indicates cells transfected with an empty vector and then co-incubated with 2.5 μM sunitinib for 24 h, and the ZNF883+SU group indicates cells transfected with a ZNF883 overexpression plasmid and then co-incubated with 2.5 μM sunitinib for 24 h; the same below;

[0050] *** indicates that compared with the NC group, the relative expression level of lncRNA ZNF883 in the ZNF883 group was significantly increased (P < 0.001); &&& indicates that compared with the NC+SU group, the relative expression level of lncRNA ZNF883 in the ZNF883+SU group was significantly increased (P < 0.001);

[0051] Fig.10 The effect of ZNF883 overexpression on 769P-SU cell viability;

[0052] Fig.11 The effect of ZNF883 overexpression on the viability of CAKI-2-SU cells;

[0053] Fig.10 and Fig.11 In the table, ** and *** indicate that compared with the NC group, the cell viability of the ZNF883 group was significantly increased (P < 0.01, P < 0.001); && and &&& indicate that compared with the NC + SU group, the cell viability of the ZNF883 + SU group was significantly increased (P < 0.01, P < 0.001);

[0054] Fig.12 The effect of ZNF883 overexpression on the migration ability of 769P-SU and CAKI-2-SU cells;

[0055] Fig.13 The effect of ZNF883 overexpression on the migration ability of 769P-SU cells;

[0056] Fig.14 The effect of ZNF883 overexpression on the migration ability of CAKI-2-SU cells;

[0057] Fig.13 and Fig.14 In the table, Relative migration rate (%) means relative migration rate (percentage), the same below; **, *** means that compared with the NC group, the relative cell migration rate of the ZNF883 group was significantly increased (P < 0.01, P < 0.001); &&& means that compared with the NC + SU group, the relative cell migration rate of the ZNF883 + SU group was significantly increased (P < 0.001);

[0058] Fig.15 The effect of ZNF883 overexpression on the invasion ability of 769P-SU and CAKI-2-SU cells;

[0059] Fig.16 The effect of ZNF883 overexpression on the invasion ability of 769P-SU cells;

[0060] Fig.17 The effect of ZNF883 overexpression on the invasion ability of CAKI-2-SU cells;

[0061] Fig.16 and Fig.17 In the table, Relative invasion rate (%) indicates relative invasion rate (percentage), the same below; *** indicates that compared with the NC group, the relative cell invasion rate of the ZNF883 group was significantly increased (P < 0.001); &&& indicates that compared with the NC + SU group, the relative cell invasion rate of the ZNF883 + SU group was significantly increased (P < 0.001);

[0062] Fig.18 The results show the main expression location of ZNF883 in 769P-SU cells;

[0063] Wherein, Relative RNA expression level refers to the relative RNA expression level, cytoplasm refers to cytoplasm, and nucleus refers to nucleus, the same below;

[0064] Fig.19 The results show the main expression location of ZNF883 in CAKI-2-SU cells;

[0065] Fig. 20 Schematic diagram of the screening scheme for ZNF883 downstream target genes;

[0066] Fig.21 Schematic diagram of the binding site between ZNF883 and miR-567;

[0067] Fig. 22 The expression of miR-567 in RNA complexes pulled down by different probes (769P-SU cells);

[0068] Fig.23 The expression of miR-567 in RNA complexes pulled down by different probes (CAKI-2-SU cells);

[0069] Fig. 22 and Fig.23 In the table, input is the positive control, Control probe indicates the negative control probe, ZNF883probe indicates the ZNF883 probe, Enrichment of miR-567in pull-down RNA indicates the content of miR-567 in the RNA complex pulled down by the probe, and *** indicates that the content of miR-567 in the RNA complex pulled down by the ZNF883 probe group was significantly increased compared with the Control probe group (P < 0.001);

[0070] Fig.24 The effect of ZNF883 overexpression on miR-567 expression in 769P-SU cells;

[0071] Fig.25 The effect of ZNF883 overexpression on miR-567 expression in CAKI-2-SU cells;

[0072] Fig.24 and Fig.25 In the table, Relative miR-567expression level indicates the relative expression level of miR-567, and +++ indicates that the relative expression level of miR-567 in the ZNF883 overexpression group was significantly increased compared with the NC group (P < 0.001);

[0073] Fig.26 The effect of ZNF883 overexpression or miR-567 overexpression on miR-567 expression in 769P-SU cells;

[0074] Among them, NC+MC means cells co-transfected with pcDNA3.1 empty vector and miR-567 mimics control, ZNF883+MC means cells co-transfected with ZNF883 overexpression plasmid and miR-567 mimics control, M+NC means cells co-transfected with pcDNA3.1 empty vector and miR-567 mimics, and M+ZNNF883 means cells co-transfected with ZNF883 overexpression plasmid and miR-567 mimics; the same below;

[0075] Fig. 27 The effect of ZNF883 overexpression or miR-567 overexpression on miR-567 expression in CAKI-2-SU cells;

[0076] Fig.26 and Fig. 27 In the table, * and *** indicate that compared with the NC+MC group, the relative expression level of miR-567 in the ZNF883+MC group and the M+NC group was significantly decreased or increased (P<0.05, P<0.001); +++ indicates that compared with the M+NC group, the relative expression level of miR-567 in the M+ZNNF883 group was significantly decreased (P<0.001); &&& indicates that compared with the ZNF883+MC group, the relative expression level of miR-567 in the M+ZNNF883 group was significantly decreased (P<0.001);

[0077] Fig.28 The effect of ZNF883 overexpression or miR-567 overexpression on the viability of 769P-SU cells;

[0078] Fig.29 The effect of ZNF883 overexpression or miR-567 overexpression on the viability of CAKI-2-SU cells;

[0079] Fig.28 and Fig.29 In the table, ** indicates that compared with the NC+MC group, the cell viability of the ZNF883+MC group and the M+NC group was significantly decreased or increased (P<0.01); +, ++ indicates that compared with the M+NC group, the cell viability of the M+ZNNF883 group was significantly decreased (P<0.05, P<0.01); &&, &&& indicates that compared with the ZNF883+MC group, the cell viability of the M+ZNNF883 group was significantly decreased (P<0.01, P<0.001);

[0080] Fig.30 The effect of ZNF883 overexpression or miR-567 overexpression on the migration ability of 769P-SU and CAKI-2-SU cells;

[0081] Fig.31The effect of ZNF883 overexpression or miR-567 overexpression on the migration ability of 769P-SU cells;

[0082] Fig.32 The effect of ZNF883 overexpression or miR-567 overexpression on the migration ability of CAKI-2-SU cells;

[0083] Fig.31 and Fig.32 In the table, * and *** indicate that the relative cell migration rates of the ZNF883+MC group and the M+NC group were significantly decreased or increased compared with the NC+MC group (P<0.05, P<0.001); + and ++ indicate that the relative cell migration rate of the M+ZNNF883 group was significantly decreased compared with the M+NC group (P<0.05, P<0.01); &&& indicates that the relative cell migration rate of the M+ZNNF883 group was significantly decreased compared with the ZNF883+MC group (P<0.001);

[0084] Fig.33 The effect of ZNF883 overexpression or miR-567 overexpression on the invasion ability of 769P-SU and CAKI-2-SU cells;

[0085] Fig.34 The effect of ZNF883 overexpression or miR-567 overexpression on the invasion ability of 769P-SU cells;

[0086] Fig.35 The effect of ZNF883 overexpression or miR-567 overexpression on the invasion ability of CAKI-2-SU cells;

[0087] Fig.34 and Fig.35 In the table, *** indicates that compared with the NC+MC group, the relative cell invasion rates of the ZNF883+MC group and the M+NC group were significantly decreased or increased (P<0.001); +++ indicates that compared with the M+NC group, the relative cell invasion rate of the M+ZNNF883 group was significantly decreased (P<0.001); &&, &&& indicate that compared with the ZNF883+MC group, the relative cell invasion rate of the M+ZNNF883 group was significantly decreased (P<0.01, P<0.001). DETAILED DESCRIPTION

[0088] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0089] Example 1 Expression of ZNF883 in Renal Cell Carcinoma Cells and Drug-Resistant Renal Cell Carcinoma Cells 1. Bioinformatics Analysis

[0090] Differentially expressed lncRNAs in sunitinib-resistant renal cell carcinoma cells (hereafter referred to as RCC cells) were analyzed by GEO2R (https: / / www.ncbi.nlm.nih.gov / geo / geo2r / ) (GSE146305 dataset), and ZNF883 (nucleotide sequence number: NM_001101338.2;

[0091] https: / / www.ncbi.nlm.nih.gov / nuccore / NM_001101338.2) was significantly down-expressed in sunitinib-resistant RCC cells, such as Figure 1 shown.

[0092] To verify this finding, this example actually detected the expression level of ZNF883 in normal renal epithelial cells HK-2, RCC cell lines (769P, CAKI-2) and sunitinib-resistant RCC cell lines (769P-SU, CAKI-2-SU).

[0093] 2. Acquisition of experimental cell lines and construction of sunitinib-resistant RCC cell lines

[0094] Normal kidney epithelial cell line HK-2 and RCC cell lines (769P, CAKI-2) were obtained from Procell (Wuhan, China) and cultured in DMEM supplemented with 10% fetal bovine serum.

[0095] The method for constructing a sunitinib-resistant RCC cell line is as follows: the parental RCC cell line (769P, CAKI-2) was treated with sunitinib malate at an initial dose of 0.25 μM for 72 hours; then, the concentration of sunitinib was increased by 0.25 μM every 72 hours; the surviving cells were then passaged until the IC50 value reached 18 μM at the 10th month; and the stable sunitinib-resistant RCC cell line (769P-SU, CAKI-2-SU) was maintained with culture medium supplemented with 0.02 μM sunitinib.

[0096] 3. Cell viability detection of experimental cell lines

[0097] The cell viability of RCC cell lines (769P, CAKI-2) and sunitinib-resistant RCC cell lines (769P-SU, CAKI-2-SU) was determined by MTT assay, and the half maximal inhibitory concentration (IC50) of sunitinib on each cell line was calculated.

[0098] The viability of the treated cells was measured by MTT cell proliferation assay kit: first, cells were seeded in 96-well plates (5000 cells / well); then 769P and CAKI-2 cells, as well as 769P-SU and CAKI-2-SU cells were treated with 0, 5, 10, 20 and 30 μM sunitinib for 24 hours, 10 μL of MTT reagent was added to each well and incubated for 4 hours, after which DMSO was used to dissolve the formazan, and the absorbance in each well was read at a wavelength of 570 nm by a microplate reader. The test results are shown in Figure 2. Figure 2 shown.

[0099] Depend on Figure 2 It can be seen that the IC50 of sunitinib for 769P cells is 2.83±0.13μM, and the IC50 of sunitinib for CAKI-2 cells is 3.04±0.19μM; the IC50 of sunitinib for 769P-SU cells is 18.28±1.05μM, and the IC50 of sunitinib for CAKI-2-SU cells is 17.28±2.34μM. It can be seen that the cell viability of 769P-SU and CAKI-2-SU cells is greater than that of 769P and CAKI-2 cells due to the sunitinib resistance treatment, indicating that the sunitinib-resistant cell line was successfully constructed.

[0100] 4. QRT-PCR test of ZNF883 expression level

[0101] Total RNA was extracted from cells using a total RNA isolation reagent, and then the RNA was used to reverse transcribe cDNA with the help of a reverse transcription kit, followed by QRT-PCR reaction using SYBR Green PCR Master Mix.

[0102] The reaction conditions were as follows: 95°C pre-denaturation for 2 minutes; 95°C denaturation for 15 seconds, 60°C annealing / extension for 1 minute, for a total of 40 cycles. The primer sequences are shown in Table 1. GAPDH or U6 was used as the endogenous control, and the data were obtained using 2 -ΔΔCT Legal amount.

[0103] Table 1 Primer sequence list

[0104]

[0105] Test results such as Figure 3 shown.

[0106] Depend on Figure 3It can be seen that the relative expression level of ZNF883 in 769P and CAKI-2 cells was significantly lower than that in HK-2 cells (p < 0.001); at the same time, the relative expression level of ZNF883 in 769P-SU and CAKI-2-SU cells was not only significantly lower than that in HK-2 cells (p < 0.001), but also significantly lower than that in 769P and CAKI-2 cells (p < 0.001). This shows that ZNF883 can not only be used as a biomarker for renal cell carcinoma, providing a certain reference for early screening or diagnosis and prognosis prediction of renal cell carcinoma, but also can predict the chemotherapy sensitivity of renal cell carcinoma patients to sunitinib and provide a reference for formulating treatment plans.

[0107] 5. Effect of sunitinib treatment on ZNF883 expression in experimental cell lines

[0108] 769P and CAKI-2 cells, as well as 769P-SU and CAKI-2-SU cells were treated with 0, 5, 10, 20 and 30 μM sunitinib for 24 hours, and then QRT-PCR was performed in the same manner as in part (2) of this example to detect the relative expression level of ZNF883 in each cell line. The test results are shown in Figure 4 , Figure 5 , Figure 6 and Figure 7 shown.

[0109] Depend on Figure 4 and Figure 5 It can be seen that with the increase of sunitinib concentration, the expression of ZNF883 in 769P and CAKI-2 cells continued to increase, and there was a significant difference; Figure 6 and Figure 7 It can be seen that with the increase of sunitinib concentration, the expression of ZNF883 in 769P-SU and CAKI-2-SU cells did not change significantly. This further confirmed that ZNF883 can be used as a biomarker for renal cell carcinoma and predict the chemotherapy sensitivity of renal cell carcinoma patients to sunitinib.

[0110] Example 2 Effect of ZNF883 overexpression on the biological behavior of sunitinib-resistant cells

[0111] 1. Cell transfection

[0112] ZNF883 transcripts were amplified by PCR and then inserted into the pcDNA3.1(+) vector to construct a ZNF883 overexpression plasmid. The empty pcDNA3.1(+) vector was used as a negative control (NC). Lipo3000 transfection reagent was used for transfection: 5×10 5The cells were seeded in a 6-well plate at a density of cells / well and cultured to 80% confluence; next, 2.5 g of plasmid was diluted with medium without antibiotics and serum; then Lipo3000 transfection reagent was added to the dilution and mixed thoroughly; finally, DNA-lipid complexes were added to each well, and the cells were subsequently cultured at 37°C for 24 hours.

[0113] 2. Cell Grouping

[0114] The cells were divided into 4 groups: NC group (769P-SU and CAKI-2-SU cells were transfected with empty vector), ZNF883 group (769P-SU and CAKI-2-SU cells were transfected with ZNF883 overexpression plasmid), NC+SU group (769P-SU and CAKI-2-SU cells were transfected with empty vector and co-incubated with 2.5 μM sunitinib for 24 hours) and ZNF883+SU group (769P-SU and CAKI-2-SU cells were transfected with ZNF883 overexpression plasmid and co-incubated with 2.5 μM sunitinib for 24 hours).

[0115] 3. Transfection efficiency assessment

[0116] After the cells were grouped and treated according to the above section (2), QRT-PCR was performed according to the method of section (3) in Example 1. The results are as follows: Figure 8 and Fig. 9 shown.

[0117] Depend on Figure 8 and Fig. 9 It can be seen that compared with the NC group, the ZNF883 group was transfected with the ZNF883 overexpression plasmid, resulting in a significant high expression of ZNF883 in the cells (p < 0.001); and compared with the NC + SU group, in the ZNF883 + SU group, although 769P-SU and CAKI-2-SU cells were resistant to sunitinib, the expression level of ZNF883 in the ZNF883 + SU group was also significantly increased due to the transfection of the ZNF883 overexpression plasmid in the cells (p < 0.001). This indicates that regardless of the chemosensitivity of renal cell carcinoma cells to sunitinib, the use of ZNF883 expression promoters can promote the high expression of ZNF883 in cells, thereby enhancing the chemosensitivity of renal cell carcinoma cells to sunitinib and improving the efficacy of sunitinib.

[0118] 4. Cell Viability Assay

[0119] The cells were seeded in a 96-well plate (5000 cells / well), and then the cells were grouped and treated according to the above section (2). Then, 10 μL of MTT reagent was added to each well and incubated for 4 hours; then, DMSO was used to dissolve the formazan, and the absorbance in each well was read at a wavelength of 570 nm using a microplate reader. The test results are shown in Figure 2. Fig.10 and Fig.11 shown.

[0120] Depend on Fig.10 and Fig.11 It can be seen that compared with the NC group, the cell viability in the ZNF883 group was significantly reduced due to the transfection of the ZNF883 overexpression plasmid (p < 0.001); at the same time, compared with the NC + SU group, the cell viability in the ZNF883 + SU group was also significantly reduced (p < 0.001). This conclusion is consistent with the conclusion of the above part (3).

[0121] 5. Cell migration ability assay

[0122] The cells in the NC group, ZNF883 group, NC+SU group, and ZNF883+SU group were respectively cultured at 2×10 4 The cells were seeded at a density of 100 μg / mL in a six-well plate and cultured to 70-80% confluence; the cells were scratched with a pipette tip, and then the cell debris was removed with PBS; the scratch images were captured at 0 and 24 h using a camera equipped with an optical microscope (magnification × 100), and the relative migration rate of cells in each group was calculated; the results are shown in Fig.12 , Fig.13 and Fig.14 shown.

[0123] Depend on Fig.12 , Fig.13 and Fig.14 It can be seen that compared with the NC group, the migration ability of cells in the ZNF883 group was significantly decreased due to transfection of the ZNF883 overexpression plasmid (P < 0.01); at the same time, compared with NC + SU, the migration ability of cells in the ZNF883 + SU group was also significantly inhibited (P < 0.001). This conclusion is consistent with the conclusions of the above sections (3) and (4).

[0124] 6. Cell invasion ability assay

[0125] The invasion ability of transfected cells was evaluated using the Transwell assay. The evaluation method was as follows: the cell density was adjusted to 5 × 10 5 cells / mL, then 200 μL of cells were added to the transwell chamber pre-coated with matrix gel, and 600 μL of culture medium containing 10% FBS was added to the lower chamber as a chemical inducer; after incubation for 24 hours, the cells that failed to invade the bottom of the chamber were removed with a cotton swab; then, the invaded cells were fixed and stained with 4% paraformaldehyde and crystal violet, and the results were observed under an inverted microscope (magnification 250 times), and the relative invasion rate of cells in each group was calculated; the results are shown in Fig.15 , Fig.16 and Fig.17 shown.

[0126] Depend on Fig.15 , Fig.16 and Fig.17 It can be seen that compared with the NC group, the cell invasion ability of the ZNF883 group was significantly decreased due to transfection of the ZNF883 overexpression plasmid (P < 0.001); at the same time, compared with the NC + SU group, the invasion ability of the cells in the ZNF883 + SU group was also significantly inhibited (P < 0.001). This conclusion is consistent with the conclusions of the above sections (3), (4) and (5).

[0127] Example 3 Screening and verification of ZNF883 downstream target genes

[0128] 1. Determination of the expression location of ZNF883

[0129] The nuclear protein and cytoplasmic protein were separated by using a nuclear protein and cytoplasmic protein extraction kit, and then the expression levels of ZNF883, GAPDH and U6 in the nuclear protein and cytoplasmic protein were detected according to the method in part (2) of Example 1. GAPDH was used as a control in the cytoplasm, and U6 was used as a control in the nucleus. The test results are shown in FIG. Fig.18 and Fig.19 shown.

[0130] Depend on Fig.18 and Fig.19 It can be seen that ZNF883 is mostly expressed in the cytoplasm.

[0131] 2. Bioinformatics analysis of ZNF883 downstream target genes

[0132] GPL13329 in the GSE37766 dataset was used to screen for differentially expressed miRNAs with log2 (fold change) ≤ -2 in sunitinib-resistant RCC cells by GEO2R; and the downstream target miRNAs of ZNF883 were predicted by LncBase Predicted v.2 (Threshold ≥ 0.8). The intersection of the two results (such as Fig. 20 ) and then a miRNA, hsa-miR-567, was obtained. The binding site of this miRNA with ZNF883 is as follows Fig.21 shown.

[0133] 3. RNA pull-down experiment

[0134] The interaction between miR-567 and ZNF883 was detected using Pierce Magnetic RNA Protein pull-down Kit (ThermoFisher Scientific) according to the manufacturer's recommendations. The biotinylated ZNF883 probe and negative control probe (antisense RNA of ZNF883) were synthesized by Ribo, and Input was used as a positive control.

[0135] The detection method is as follows: the magnetic beads and the probe are incubated at room temperature for 2 hours to produce probe-coated magnetic beads, and 1×10 7 The cells were lysed and sonicated, and then incubated with magnetic beads coated with probes at 4°C overnight; after washing, the RNA complex bound to the magnetic beads was eluted and extracted using RNeasy Mini Kit (Qiagen) and analyzed by qRT-PCR; the analysis results are shown in Fig. 22 and Fig.23 shown.

[0136] like Fig. 22 and Fig.23 As shown, the expression of miR-567 in the RNA complex pulled down by the ZNF883 probe was significantly higher than that of the negative control probe (P < 0.001), indicating that the two have a targeted binding relationship.

[0137] 4. Effect of ZNF883 overexpression on miR-567 expression

[0138] After 769P-SU and CAKI-2-SU cells were transfected with ZNF883 overexpression plasmid or negative control plasmid, the expression level of miR-567 in the cells was detected by QRT-PCR according to the method of part (2) of Example 1; the detection results are as follows: Fig.24 and Fig.25 shown.

[0139] like Fig.24 and Fig.25 As shown, ZNF883 overexpression plasmid inhibited the expression of miR-567 in cells, indicating that ZNF883 may affect the occurrence and development of renal cell carcinoma by targeting miR-567. Example 4 ZNF883 affects the biological behavior of sunitinib-resistant cells by targeting miR-567

[0140] 1. Cell grouping

[0141] The cells were divided into 4 groups: NC+MC group (769P-SU and CAKI-2-SU cells were co-transfected with pcDNA3.1 empty vector and miR-567 mimics control), ZNF883+MC group (769P-SU and CAKI-2-SU cells were co-transfected with ZNF883 overexpression plasmid and miR-567 mimics control), M+NC group (769P-SU and CAKI-2-SU cells were co-transfected with pcDNA3.1 empty vector and miR-567 mimics), M+ZNNF883 group (769P-SU and CAKI-2-SU cells were co-transfected with ZNF883 overexpression plasmid and miR-567 mimics); the nucleotide sequence of miR-567 mimics is:

[0142] AGUAUGUUCUUCCAGGACAGAAC (SEQ ID No. 5).

[0143] 2. Cell transfection

[0144] Cell transfection was performed according to the method of Example 2 (1), and then QRT-PCR was performed according to the method of Example 1 (3) to detect the expression of miR-567 in the cells; the detection results are as follows: Fig.26 and Fig. 27 shown.

[0145] Depend on Fig.26 and Fig. 27 As shown, compared with the NC+MC group, the ZNF883 overexpression plasmid transfected in the ZNF883+MC group inhibited the expression of miR-567, while the miR-567 mimics transfected in the M+NC group promoted the expression of miR-567; compared with the ZNF883+MC group, although the ZNF883 overexpression plasmid and miR-567 mimics were co-transfected in the M+ZNF883 group, the miR-567 mimics took effect faster than the ZNF883 overexpression plasmid, and overall, the expression level of miR-567 in the cells was still higher than that in the ZNF883+MC group; but compared with the M+NC group, the ZNF883 overexpression plasmid in the M+ZNF883 group regulated the expression level of miR-567, so overall, the expression level of miR-567 in the cells was lower than that in the M+NC group.

[0146] 3. Cell Viability Assay

[0147] The cell viability was detected according to the method in part (4) of Example 2. The results are as follows Fig.28 and Fig.29 shown.

[0148] Depend on Fig.28 and Fig.29As shown, compared with the NC+MC group, the cell viability in the ZNF883+MC group was significantly decreased due to the transfection of the ZNF883 overexpression plasmid; while the cell viability in the M+NC group was significantly increased due to the transfection of the miR-567 mimics; compared with the ZNF883+MC group, although the ZNF883 overexpression plasmid and miR-567 mimics were co-transfected in the M+ZNF883 group, the miR-567 mimics took effect faster than the ZNF883 overexpression plasmid. Overall, the cell viability of the M+ZNF883 group was still higher than that of the ZNF883+MC group; but compared with the M+NC group, the ZNF883 overexpression plasmid in the M+ZNF883 group regulated the expression level of miR-567, so overall, the cell viability of the M+ZNF883 group was worse than that of the M+NC group.

[0149] 4. Cell migration ability assay

[0150] The cell migration ability was tested according to the method in part (5) of Example 2. The results are as follows Fig.30 , Fig.31 and Fig.32 shown.

[0151] Depend on Fig.30 , Fig.31 and Fig.32 It can be seen that compared with the NC+MC group, the migration ability of cells in the ZNF883+MC group was significantly decreased due to the transfection of ZNF883 overexpression plasmid; while the migration ability of cells in the M+NC group was significantly increased due to the transfection of miR-567 mimics; compared with the ZNF883+MC group, although the ZNF883 overexpression plasmid and miR-567 mimics were co-transfected in the M+ZNF883 group, the miR-567 mimics took effect faster than the ZNF883 overexpression plasmid. In general, the cell migration ability of the M+ZNF883 group was still higher than that of the ZNF883+MC group; but compared with the M+NC group, the ZNF883 overexpression plasmid in the M+ZNF883 group regulated the expression level of miR-567, so in general, the cell migration ability of the M+ZNF883 group was worse than that of the M+NC group.

[0152] 5. Cell invasion ability assay

[0153] The cell invasion ability was tested according to the method in section (6) of implementation case 2. The results are as follows Fig.33 , Fig.34 and Fig.35 shown.

[0154] Depend on Fig.33 , Fig.34 and Fig.35It can be seen that compared with the NC+MC group, the invasion ability of cells in the ZNF883+MC group was significantly decreased due to the transfection of ZNF883 overexpression plasmid; while the invasion ability of cells in the M+NC group was significantly increased due to the transfection of miR-567 mimics; compared with the ZNF883+MC group, although the ZNF883 overexpression plasmid and miR-567 mimics were co-transfected in the M+ZNF883 group, the miR-567 mimics took effect faster than the ZNF883 overexpression plasmid. Overall, the invasion ability of cells in the M+ZNF883 group was still higher than that in the ZNF883+MC group; but compared with the M+NC group, the ZNF883 overexpression plasmid in the M+ZNF883 group regulated the expression level of miR-567, so overall, the invasion ability of cells in the M+ZNF883 group was worse than that in the M+NC group.

Claims

1. Application of ZNF883 gene expression level detection reagent in the preparation of early screening or auxiliary diagnosis reagent for renal cell carcinoma.

2. The use according to claim 1, characterized in that The detection reagents for ZNF883 gene expression level include: An oligonucleotide probe that specifically recognizes the ZNF883 gene; Or, primers that specifically amplify the ZNF883 gene.

3. The use according to claim 2, characterized in that The primers for specific amplification of ZNF883 gene include: Upstream primer: 5′-GCATTGGAAGATGTCAGAGAC-3′; Downstream primer: 5′-GTAGACCAATCCAATGAGATGAG-3′.

4. Application of ZNF883 gene expression level detection reagent in the preparation of reagent for predicting the chemotherapy sensitivity of renal cell carcinoma to sunitinib.

5. The use according to claim 4, characterized in that The detection reagents for ZNF883 gene expression level include: An oligonucleotide probe that specifically recognizes the ZNF883 gene; Or, primers that specifically amplify the ZNF883 gene.

6. Application of ZNF883 gene expression promoter in the preparation of reagents to enhance the sensitivity of renal cell carcinoma to sunitinib chemotherapy.

Images